Early History up to Schedule. Proteins DNA & RNA Schwann and Schleiden Cell Theory Charles Darwin publishes Origin of Species

Size: px
Start display at page:

Download "Early History up to Schedule. Proteins DNA & RNA Schwann and Schleiden Cell Theory Charles Darwin publishes Origin of Species"

Transcription

1 Schedule Bioinformatics and Computational Biology: History and Biological Background (JH) 0.0 he Parsimony criterion GKN.0 Stochastic Models of Sequence Evolution GKN 7.0 he Likelihood criterion GKN 0.0 ut: 9-0 = (Friday) rees in phylogenetics and population genetics GKN.0 Estimating phylogenies and genealogies I GKN 7.0 Estimating phylogenies and genealogies II GKN.0 Estimating phylogenies and genealogies III. Alignment Algorithms I (Optimisation) (JH) 7. Alignment Algorithms II (Statistical Inference) (JH) 0. Finding Signals in Sequences (JH). Stochastic Grammars and their Biological Applications: Hidden Markov Models (JH) 7.0 Stochastic Grammars and their Biological Applications: Context Free Grammars (JH). RNA molecules and their analysis (JH). Open Problems in Bioinformatics and Computational Biology I (JH) 8. Possibly: Evolving Grammars, Pedigrees from Genomes Open Problems in Bioinformatics and Computational Biology II (GKN). Possibly: he phylogeny of language: traits and dates, What can FIV sequences tell us about their host cat population? Bioinformatics and Computational Biology: History & Biological Background Early History up to 9 88 Schwann and Schleiden Cell heory 89 Charles Darwin publishes Origin of Species 86 Mendel discovers basic laws of inheritance (largely ignored) 869 Miescher Discovers DNA 900 Mendels laws rediscovered. 9 Avery shows DNA contains genetic information 9 Corey & Pauling Secondary structure elements of a protein. 9 Watson & Crick proposes DNA structure and states Proteins Proteins: a string of amino acids. Often folds up in a well defined dimensional structure. Has enzymatic, structural and regulatory functions. DNA & RNA DNA: he Information carrier in the genetic material. Usually double helix. RNA: messenger tape from DNA to protein, regulatory, enzymatic and structural roles as well. More labile than DNA

2 An Example: t-rna History up to 9-66 Promoter Gene 9 Sanger first protein sequence Bovine Insulin 97 Kendrew structure of Whale Myoglobin 98 Crick, Goldschmidt,. Central Dogma 98 First quantitative method for phylogeny reconstruction (UGPMA - Sokal and Michener) 99 Operon Models proposed (Jakob and Monod) 966 Genetic Code Determined 967 First RNA sequencing From Paul Higgs he Central Dogma he Genetic Code Genetic Code: Mapping from - nucleotides (codons) to amino acids (0) + stop codon. his 6--> mapping creates the distinction silent/replacement substitution. Substitutions Number Percent otal in all codons 9 00 Synonymous Nonsynonymous 7 Missense 9 7 Nonsense Ser hr Glu Met Cys Leu Met Gly Gly CA AC GAG AG G A AG GGG GGA * * * * * * * ** CG ACA GGG AA A CA AG GG AA Ser hr Gly Ile yr Leu Met Gly Ile

3 History emin + Baltimore Reverse ranscriptase 970 Needleman-Wunch algorithm for pairwise alignment 97-7 Hartigan-Fitch-Sankoff algorithm for assigning nucleotides to inner nodes on a tree. Genes, Gene Structure & Alternative Splicing Presently estimated Gene Number:.000, Average Gene Size: 7 kb he largest gene: Dystrophin. Mb - 0.6% coding 6 hours to transcribe. he shortest gene: trna YR 00% coding Largest exon: ApoB exon 6 is 7.6 kb Smallest: <0bp Average exon number: 9 Largest exon number: itin 6 Smallest: Largest intron: WWOX intron 8 is 800 kb Smallest: 0s of bp Largest polypeptide: itin 8.8 smallest: tens small hormones. Intronless Genes: mitochondrial genes, many RNA genes, Interferons, Histones,.. 976/79 First viral genome MS/!X7 977/8 Sharp/Roberts Introns 979 Alternative Splicing 980 Mitochondrial Genome (6.69bp) and the discovery of alternative codes. A challenge to automated annotation.. How widespread is it?. Is it always functional?. How does it evolve? Cartegni,L. et al.(00) Listening to Silence and understanding nonsense: Exonic mutations that affect splicing Nature Reviews Genetics..8-, HMG p9-9 Strings and Comparing Strings 970 Needleman-Wunch algorithm for pairwise alignment for maximizing similarity 97 Sellers-Sankoff algorithm for pairwise alignment for minimizing distance (Parsimony) Initial condition: D 0,0 =0. D i,j := D(s[:i], s[:j]) D i,j =min{d i-,j- + d(s[i],s[j]), D i,j- + g, D i-,j +g} Alignment: CAGG I= v=) g=0 i v Cost 7 -G G C A G G 97- Sankoff algorithm for multiple alignment for minimizing distance (Parsimony) and finding phylogeny simultaneously History Felsenstein Proposes algorithm to calculate probability of observed nucleotides on leaves on a tree Griffiths, Hudson he Ancestral Recombination Graph. 987/89 First biological use of Hidden Markov Model (HMM) (Lander and Green, Churchill) 99 horne, Kishino and Felsenstein proposes statistical model for pairwise alignment. 99 First biological use of stochastic context free grammar (Haussler)

4 Homology: Genealogical Structures he existence of a common ancestor (for instance for sequences) Phylogeny Only finding common ancestors. Only one ancestor. Pedigree: cagtct ccagtcg ccggtcg ime slices ime All positions have found a common ancestors on one sequence All positions have found a common ancestors Ancestral Recombination Graph the ARG i. Finding common ancestors. ii. A sequence encounters Recombinations iii. A point ARG is a phylogeny N Population Enumerating rees: Unrooted & valency History First prokaryotic genome H. influenzae 996 First unicellular eukaryotic genome Yeast 998 he first multi-cellular eukaryotic genome C.elegans 000 Drosophila melanogaster, Arabidopsis thaliana 00 Human Genome n" (n " )! #( j " ) = (n " )! j= Recursion: n = (n-) n- Initialisation: = = = n" Mouse Genome 00 Chimp Genome

5 6 7 he Human Genome & R.Harding & HMG (00) p X Y mitochondria Molecular Evolution and Gene Finding: wo HMMs AGGGACCAAAGCG... P coding {AG-->GG} or AGGGACAAGGCG... P non-coding {AG-->GG} (chromosome ) "#globin $ globin Myoglobin.06.*0 9 bp *.000 6*0 bp Simple Prokaryotic Simple Eukaryotic Exon Exon Exon *0 flanking flanking *0 bp *0 DNA: Protein: AGCCAGCGAAAGGACAGGA aa aa aa aa aa aa aa aa aa aa 0 bp H H H hree Questions for Hidden Structures. What is the probability of the data? What is the most probable hidden configuration? What is the probability of specific hidden state? raining: Given a set of instances, find parameters making them probable if they were independent. HMM/Stochastic Regular Grammar O O O O O O 6 O 7 O 8 O 9 O 0 W L i i j j L W W R H P = O = P(O H = ) SCFG - Stochastic Context Free Grammars H P = j " O p j, H = j Bioinformatics and Computational Biology: History and Biological Background (JH) he Parsimony criterion GKN Stochastic Models of Sequence Evolution GKN he Likelihood criterion GKN rees in phylogenetics and population genetics GKN Estimating phylogenies and genealogies I GKN Estimating phylogenies and genealogies II GKN Estimating phylogenies and genealogies III GKN Alignment Algorithms I (Optimisation) (JH) Alignment Algorithms II (Statistical Inference) (JH) Finding Signals in Sequences (JH) Stochastic Grammars and their Biological Applications: Hidden Markov Models (JH) Stochastic Grammars and their Biological Applications: Context Free Grammars (JH) RNA molecules and their analysis (JH) Open Problems in Bioinformatics and Computational Biology I (JH) Possibly: Evolving Grammars, Pedigrees from Genomes Open Problems in Bioinformatics and Computational Biology II (GKN) Possibly: he phylogeny of language: traits and dates, What can FIV sequences tell us about their host cat population?

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

Hidden Markov Models in Bioinformatics 14.11

Hidden Markov Models in Bioinformatics 14.11 idden Markov Models in Bioinformatics 14.11 60 min Definition Three Key Algorithms Summing over Unknown States Most Probable Unknown States Marginalizing Unknown States Key Bioinformatic Applications Pedigree

More information

"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky

Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally

More information

1. In most cases, genes code for and it is that

1. In most cases, genes code for and it is that Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2007

Bio 1B Lecture Outline (please print and bring along) Fall, 2007 Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution

More information

Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.

Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever. CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains

More information

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution

Massachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution 1. Rates of amino acid replacement The initial motivation for the neutral

More information

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME

MATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:

More information

BME 5742 Biosystems Modeling and Control

BME 5742 Biosystems Modeling and Control BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various

More information

Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p

Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=

More information

Principles of Genetics

Principles of Genetics Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics

More information

Phylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5.

Phylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5. Five Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu v Distance Methods v Character Methods v Molecular Clock v UPGMA v Maximum Parsimony

More information

Chapter 17. From Gene to Protein. Biology Kevin Dees

Chapter 17. From Gene to Protein. Biology Kevin Dees Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting

More information

SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA

SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS 1 Prokaryotes and Eukaryotes 2 DNA and RNA 3 4 Double helix structure Codons Codons are triplets of bases from the RNA sequence. Each triplet defines an amino-acid.

More information

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM

HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM I529: Machine Learning in Bioinformatics (Spring 2017) HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington

More information

Algorithms in Computational Biology (236522) spring 2008 Lecture #1

Algorithms in Computational Biology (236522) spring 2008 Lecture #1 Algorithms in Computational Biology (236522) spring 2008 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: 15:30-16:30/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office hours:??

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Distance Methods Character Methods

More information

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid. 1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the

More information

Evolutionary Analysis of Viral Genomes

Evolutionary Analysis of Viral Genomes University of Oxford, Department of Zoology Evolutionary Biology Group Department of Zoology University of Oxford South Parks Road Oxford OX1 3PS, U.K. Fax: +44 1865 271249 Evolutionary Analysis of Viral

More information

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant? Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was

More information

Lecture 18 June 2 nd, Gene Expression Regulation Mutations

Lecture 18 June 2 nd, Gene Expression Regulation Mutations Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase

More information

3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM

3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM I529: Machine Learning in Bioinformatics (Spring 2017) Content HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University,

More information

O 3 O 4 O 5. q 3. q 4. Transition

O 3 O 4 O 5. q 3. q 4. Transition Hidden Markov Models Hidden Markov models (HMM) were developed in the early part of the 1970 s and at that time mostly applied in the area of computerized speech recognition. They are first described in

More information

From Gene to Protein

From Gene to Protein From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed

More information

Full file at CHAPTER 2 Genetics

Full file at   CHAPTER 2 Genetics CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Honors Biology Reading Guide Chapter 11

Honors Biology Reading Guide Chapter 11 Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins

More information

Molecular phylogeny How to infer phylogenetic trees using molecular sequences

Molecular phylogeny How to infer phylogenetic trees using molecular sequences Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 2009 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18

Outline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18 Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection

More information

Data Mining in Bioinformatics HMM

Data Mining in Bioinformatics HMM Data Mining in Bioinformatics HMM Microarray Problem: Major Objective n Major Objective: Discover a comprehensive theory of life s organization at the molecular level 2 1 Data Mining in Bioinformatics

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

GCD3033:Cell Biology. Transcription

GCD3033:Cell Biology. Transcription Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors

More information

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example

More information

Molecular phylogeny How to infer phylogenetic trees using molecular sequences

Molecular phylogeny How to infer phylogenetic trees using molecular sequences Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 200 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues

More information

full file at

full file at Chapter 1 1. Genetics contribute to advances in: Answer: E A. agriculture. B. pharmaceuticals. C. medicine. D. modern biology. E. All of the above. 2. Genetic information can be carried in which of the

More information

BINF6201/8201. Molecular phylogenetic methods

BINF6201/8201. Molecular phylogenetic methods BINF60/80 Molecular phylogenetic methods 0-7-06 Phylogenetics Ø According to the evolutionary theory, all life forms on this planet are related to one another by descent. Ø Traditionally, phylogenetics

More information

Translation Part 2 of Protein Synthesis

Translation Part 2 of Protein Synthesis Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation

More information

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail

More information

How Molecules Evolve. Advantages of Molecular Data for Tree Building. Advantages of Molecular Data for Tree Building

How Molecules Evolve. Advantages of Molecular Data for Tree Building. Advantages of Molecular Data for Tree Building How Molecules Evolve Guest Lecture: Principles and Methods of Systematic Biology 11 November 2013 Chris Simon Approaching phylogenetics from the point of view of the data Understanding how sequences evolve

More information

CHAPTERS 24-25: Evidence for Evolution and Phylogeny

CHAPTERS 24-25: Evidence for Evolution and Phylogeny CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology

More information

Bioinformatics Chapter 1. Introduction

Bioinformatics Chapter 1. Introduction Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!

More information

UNIT 5. Protein Synthesis 11/22/16

UNIT 5. Protein Synthesis 11/22/16 UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA

More information

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11 The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding

More information

Molecular Phylogenetics (part 1 of 2) Computational Biology Course João André Carriço

Molecular Phylogenetics (part 1 of 2) Computational Biology Course João André Carriço Molecular Phylogenetics (part 1 of 2) Computational Biology Course João André Carriço jcarrico@fm.ul.pt Charles Darwin (1809-1882) Charles Darwin s tree of life in Notebook B, 1837-1838 Ernst Haeckel (1934-1919)

More information

EVOLUTIONARY DISTANCES

EVOLUTIONARY DISTANCES EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:

More information

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION

GSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H* ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^

More information

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A

More information

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern

More information

Phylogenetic Tree Reconstruction

Phylogenetic Tree Reconstruction I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven

More information

CGS 5991 (2 Credits) Bioinformatics Tools

CGS 5991 (2 Credits) Bioinformatics Tools CAP 5991 (3 Credits) Introduction to Bioinformatics CGS 5991 (2 Credits) Bioinformatics Tools Giri Narasimhan 8/26/03 CAP/CGS 5991: Lecture 1 1 Course Schedules CAP 5991 (3 credit) will meet every Tue

More information

Molecular evolution - Part 1. Pawan Dhar BII

Molecular evolution - Part 1. Pawan Dhar BII Molecular evolution - Part 1 Pawan Dhar BII Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution Age of life on earth: 3.85 billion years Formation of planet: 4.5 billion

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab

Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Date: Agenda Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Ask questions based on 5.1 and 5.2 Quiz on 5.1 and 5.2 How

More information

Translation. A ribosome, mrna, and trna.

Translation. A ribosome, mrna, and trna. Translation The basic processes of translation are conserved among prokaryotes and eukaryotes. Prokaryotic Translation A ribosome, mrna, and trna. In the initiation of translation in prokaryotes, the Shine-Dalgarno

More information

Designer Genes C Test

Designer Genes C Test Northern Regional: January 19 th, 2019 Designer Genes C Test Name(s): Team Name: School Name: Team Number: Rank: Score: Directions: You will have 50 minutes to complete the test. You may not write on the

More information

Flow of Genetic Information

Flow of Genetic Information presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid

More information

FUNDAMENTALS OF MOLECULAR EVOLUTION

FUNDAMENTALS OF MOLECULAR EVOLUTION FUNDAMENTALS OF MOLECULAR EVOLUTION Second Edition Dan Graur TELAVIV UNIVERSITY Wen-Hsiung Li UNIVERSITY OF CHICAGO SINAUER ASSOCIATES, INC., Publishers Sunderland, Massachusetts Contents Preface xiii

More information

Controlling Gene Expression

Controlling Gene Expression Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping

More information

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

More information

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree)

9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree) I9 Introduction to Bioinformatics, 0 Phylogenetic ree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & omputing, IUB Evolution theory Speciation Evolution of new organisms is driven by

More information

Algorithmics and Bioinformatics

Algorithmics and Bioinformatics Algorithmics and Bioinformatics Gregory Kucherov and Philippe Gambette LIGM/CNRS Université Paris-Est Marne-la-Vallée, France Schedule Course webpage: https://wikimpri.dptinfo.ens-cachan.fr/doku.php?id=cours:c-1-32

More information

Understanding relationship between homologous sequences

Understanding relationship between homologous sequences Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

Comparative Bioinformatics Midterm II Fall 2004

Comparative Bioinformatics Midterm II Fall 2004 Comparative Bioinformatics Midterm II Fall 2004 Objective Answer, part I: For each of the following, select the single best answer or completion of the phrase. (3 points each) 1. Deinococcus radiodurans

More information

Honors Biology Final Exam Highlights First Semester Final Review, 200 Multiple Choice Questions, 200 Points

Honors Biology Final Exam Highlights First Semester Final Review, 200 Multiple Choice Questions, 200 Points Honors Biology Final Exam Highlights Name First Semester Final Review, 200 Multiple Choice Questions, 200 Points Chapter 1 the Science of Life Characteristics of life Levels of organization Themes of biology-homeostasis,

More information

Molecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016

Molecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016 Molecular phylogeny - Using molecular sequences to infer evolutionary relationships Tore Samuelsson Feb 2016 Molecular phylogeny is being used in the identification and characterization of new pathogens,

More information

Bioinformatics Practical for Biochemists

Bioinformatics Practical for Biochemists Bioinformatics Practical for Biochemists Andrei Lupas, Birte Höcker, Steffen Schmidt WS 2012/2013 01. DNA & Genomics 1 Description Lectures about general topics in Bioinformatics & History Tutorials will

More information

Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype

Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

The Gene The gene; Genes Genes Allele;

The Gene The gene; Genes Genes Allele; Gene, genetic code and regulation of the gene expression, Regulating the Metabolism, The Lac- Operon system,catabolic repression, The Trp Operon system: regulating the biosynthesis of the tryptophan. Mitesh

More information

Algorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment

Algorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot

More information

Evolutionary Models. Evolutionary Models

Evolutionary Models. Evolutionary Models Edit Operators In standard pairwise alignment, what are the allowed edit operators that transform one sequence into the other? Describe how each of these edit operations are represented on a sequence alignment

More information

Introduction to molecular biology. Mitesh Shrestha

Introduction to molecular biology. Mitesh Shrestha Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of

More information

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26

Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26 Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 4 (Models of DNA and

More information

Biology 112 Practice Midterm Questions

Biology 112 Practice Midterm Questions Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,

More information

Sequences, Structures, and Gene Regulatory Networks

Sequences, Structures, and Gene Regulatory Networks Sequences, Structures, and Gene Regulatory Networks Learning Outcomes After this class, you will Understand gene expression and protein structure in more detail Appreciate why biologists like to align

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

GENETICS - CLUTCH CH.22 EVOLUTIONARY GENETICS.

GENETICS - CLUTCH CH.22 EVOLUTIONARY GENETICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF EVOLUTION Evolution is a process through which variation in individuals makes it more likely for them to survive and reproduce There are principles to the theory

More information

Practice Test on Cell Biology (the REAL test is on Friday the 17th) KEY LO: Describe and explain the Central Dogma. SLE: Meet NGSS.

Practice Test on Cell Biology (the REAL test is on Friday the 17th) KEY LO: Describe and explain the Central Dogma. SLE: Meet NGSS. Practice Test on Cell Biology (the REAL test is on Friday the 17th) KEY LO: Describe and explain the Central Dogma. SLE: Meet NGSS. On the real test, you will be given this chart of the genetic code (from

More information

Tree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny

More information

Bioinformatics course

Bioinformatics course Bioinformatics course Phylogeny and Comparative genomics 10/23/13 1 Contents-phylogeny Introduction-biology, life classificationtaxonomy Phylogenetic-tree of life, tree representation Why study phylogeny?

More information

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu. Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The

More information

Phylogenetics: Parsimony

Phylogenetics: Parsimony 1 Phylogenetics: Parsimony COMP 571 Luay Nakhleh, Rice University he Problem 2 Input: Multiple alignment of a set S of sequences Output: ree leaf-labeled with S Assumptions Characters are mutually independent

More information

Organelle genome evolution

Organelle genome evolution Organelle genome evolution Plant of the day! Rafflesia arnoldii -- largest individual flower (~ 1m) -- no true leafs, shoots or roots -- holoparasitic -- non-photosynthetic Big questions What is the origin

More information

C3020 Molecular Evolution. Exercises #3: Phylogenetics

C3020 Molecular Evolution. Exercises #3: Phylogenetics C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from

More information

Bioinformatics 2 - Lecture 4

Bioinformatics 2 - Lecture 4 Bioinformatics 2 - Lecture 4 Guido Sanguinetti School of Informatics University of Edinburgh February 14, 2011 Sequences Many data types are ordered, i.e. you can naturally say what is before and what

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology

SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of

More information

GREENWOOD PUBLIC SCHOOL DISTRICT Genetics Pacing Guide FIRST NINE WEEKS Semester 1

GREENWOOD PUBLIC SCHOOL DISTRICT Genetics Pacing Guide FIRST NINE WEEKS Semester 1 FIRST NINE WEEKS Semester 1 1 Aug. 4 1 Introduction to Course Aug. 7 11 5 2 Aug. 14 18 5 Overarching Science Engineering Practices (SEPs) These concepts and skills should be continuously embedded during

More information

Information Theoretic Distance Measures in Phylogenomics

Information Theoretic Distance Measures in Phylogenomics Information Theoretic Distance Measures in Phylogenomics Pavol Hanus, Janis Dingel, Juergen Zech, Joachim Hagenauer and Jakob C. Mueller Institute for Communications Engineering Technical University, 829

More information

C.DARWIN ( )

C.DARWIN ( ) C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships

More information

Bioinformatics Practical for Biochemists

Bioinformatics Practical for Biochemists Bioinformatics Practical for Biochemists Andrei Lupas, Birte Höcker, Steffen Schmidt WS 2013/2014 01. DNA & Genomics!! 1 Description Lectures about general topics in Bioinformatics & History Tutorials

More information

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis: Protein synthesis uses the information in genes to make proteins. 2 Steps

More information

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics:

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics: Homework Assignment, Evolutionary Systems Biology, Spring 2009. Homework Part I: Phylogenetics: Introduction. The objective of this assignment is to understand the basics of phylogenetic relationships

More information

Interphase & Cell Division

Interphase & Cell Division 1 Interphase & Cell Division 2 G1 = cell grows and carries out its normal job. S phase = DNA is copied (replicated/duplicated) G2 = Cell prepares for division 3 During mitosis, the nuclear membrane breaks

More information

Endowed with an Extra Sense : Mathematics and Evolution

Endowed with an Extra Sense : Mathematics and Evolution Endowed with an Extra Sense : Mathematics and Evolution Todd Parsons Laboratoire de Probabilités et Modèles Aléatoires - Université Pierre et Marie Curie Center for Interdisciplinary Research in Biology

More information

Lecture Notes: BIOL2007 Molecular Evolution

Lecture Notes: BIOL2007 Molecular Evolution Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits

More information

7. Tests for selection

7. Tests for selection Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info

More information