Revisiting the Central Dogma The role of Small RNA in Bacteria
|
|
|
- Colin Foster
- 5 years ago
- Views:
Transcription
1 Graduate Student Seminar Revisiting the Central Dogma The role of Small RNA in Bacteria The Chinese University of Hong Kong Supervisor : Prof. Margaret Ip Faculty of Medicine Student : Helen Ma (PhD student) Department of Microbiology Date :
2 Content (I) Introduciton - Revisiting the Central Dogma - Types of RNA / Small RNAs in Bacteria (II) Functions and Mechanisms of Small RNA - (A) Antisense RNAs - (B) Riboswitches - (C) Intergenic RNAs (III) Small RNA Prediction Softwares and Databases - RNAfold vs. CoFold - BSDR - Bacterial Small Regulatory RNA Database (IV) Future Perspectives - Hijacking nature's design - Artificial small RNAs
3 (I) Introduction Revisiting the Central Dogma RNA World Hypothesis Flow of information Biological Molecules 6: An introduction to molecular biology and evolution
4 (I) Introduction Types of RNA in Bacteria Coding RNA - code for / translated to a protein Messenger RNA (mrna, ~1-2kb) Non-coding RNA (ncrna) - does not code for / translated to a protein Transfer RNA (trna, ~60-95bp) Ribosomal RNA (rrna, ~ kb) Small RNAs (~30-500nts) Principles of Cell Biology Becker's World of the Cell, 8th edition Hardin, Bertoni & Kleinsmith,
5 (I) Introduction Types of Small RNA in Bacteria (A) Antisense RNAs (asrna) (B) Riboswitches (C) Intergenic Small RNAs Dinan A.M. Loftus B.J. (Non-)translational medicine: targeting bacterial RNA Front. Genet., 08 November 2013 doi: /fgene
6 (II) Functions and Mechanisms (A) Antisense RNAs Study in E. coli since 1960s Transcribed from opposite strand Maintain plasmid number Against bacteriophage development Blocks ribosome for protein expression Down-regulate gene expression e.g. outer membrane proteins OmpF(efflux pump), DicF (cell division), etc. Wager E.G.H. and Simons R.W. ANTISENSE RNA CONTROL INBACTERIA, PHAGES, ANDPLASMIDS. Annu. Rev. Microbiol
7 (II) Functions and Mechanisms (A) Antisense RNAs Post-segregation killing system in plasmid R1 Stem-loop structures of translated parb gene hok : host killing mok : mediator of killing sok / sokt : supression of killing Guillermo de la Cueva Méndez, Belén Pimentel Gene and cell survival: lessons from prokaryotic plasmid R1EMBO reports: 8 (5)01 May 2007 pp
8 (II) Functions and Mechanisms (A) Antisense RNAs Hypothesis : - (1) Antisense RNA acts as a threshold level to control level of sense RNA, to prevent over reaction to enviromental stimuli - (2) Control over genes in the same operon by one antisense RNA molecule - (3) Potential role of short RNA fragments on target gene expression Lasa S. et. al., An effort to make sense of antisense transcription in bacteria. RNA Biology 9:8, ; August 2012; 2012 Landes Bioscience
9 (II) Functions and Mechanisms (B) Riboswitches Discovered in 2000s RNA-based intracellular sensors Stem-loop structures Serganov A. and Nudler V. A Decade of Riboswitches. Cell. Jan 17, 2013; 152(0):
10 (II) Functions and Mechanisms (B) Riboswitches "Junctional" riboswitches Position of metabolic sensors Stability of stem-loop structures Class Ia (A) e.g. purines Class Ib (B) e.g. vitamine derivatives Class II (C) e.g. Mg2+ Serganov A. and Nudler V. A Decade of Riboswitches. Cell. Jan 17, 2013; 152(0):
11 (II) Functions and Mechanisms (C) Intergenic small RNAs Binds to target mrna in short stretches (7-12nt) generally overlapping with / close to ribosomal binding site (RBS) Stem-loop structures block 70S ribosome formation and translation initiation Dinan A.M. Loftus B.J. (Non-)translational medicine: targeting bacterial RNA Front. Genet., 08 November 2013 doi: /fgene
12 (II) Functions and Mechanisms Virulence regulation by thermosensor in Yersinia Boheme K. et. al. Concerted Actions of a Thermo-labile Regulator and a Unique Intergenic RNA Thermosensor Control Yersinia Virulence. PLoS Pathog. Feb 2012; 8(2): e
13 (III) Softwares and Databases (III) Small RNA Prediction Softwares and Databases Pichon C. and Felden B. Small RNA gene identification and mrna target predictions in bacteria.bioinformatics Dec 15;24(24):
14 (III) Softwares and Databases (III) Small RNA Prediction Softwares and Databases Pichon C. and Felden B. Small RNA gene identification and mrna target predictions in bacteria.bioinformatics Dec 15;24(24):
15 (III) Softwares and Databases DNA base pairing : A-T, G-C RNA base pairing : A-U, G-C, G-U... Sample RNA string: CGUCACAGUAGAAGCCUAUAUGUGAGGCUACUCGGC (36nt) Wobble Bonding and RNA Secondary Structures
16 (III) Softwares and Databases RNAfold CoFold RNAfold CoFold
17 (III) Softwares and Databases RNAfold vs. CoFold 23S rrna of P. aeruginosa (2893nt) 16S rrna fresh water algae Cryptomonas sp. (1493bp) Proctor J. R. and Meyer I. M. CoFold: an RNA secondary structure prediction method that takes co-transcriptional folding into account. Nucleic Acids Res. May 2013; 41(9): e102.
18 (III) Small RNA Prediction Softwares and Databases BSRD: a repository for bacterial small regulatory RNA Li L. et. al. BSRD: a repository for bacterial small regulatory RNA. Nucleic Acids Res. Jan 2013; 41(Database issue): D233 D238.
19 (III) Small RNA Prediction Softwares and Databases BSRD: a repository for bacterial small regulatory RNA Li L. et. al. BSRD: a repository for bacterial small regulatory RNA. Nucleic Acids Res. Jan 2013; 41(Database issue): D233 D238.
20 (IV) Future Perspectives Hijacking nature's design - Artificial small RNAs Switching off the aminoglycoside resistance gene, aac(6 )-Ib Sarno R. et. al. Inhibition of Aminoglycoside 6 -N-Acetyltransferase Type Ib-Mediated Amikacin Resistance by Antisense OligodeoxynucleotidesAntimicrob. Agents Chemother. October 2003 vol. 47 no Ramirez M. S. et. al. Rise and dissemination of aminoglycoside resistance: the aac(6 )-Ib paradigm. Front. Microbiol., 17 May 2013 doi: /fmicb
21 (IV) Future Perspectives (IV) Future Perspectives EGSC1-8 Solar Bistue A. J. C. et. al. External Guide Sequences Targeting the aac(6 )-Ib mrna Induce Inhibition of Amikacin Resistance. Antimicrob. Agents Chemother. June 2007 vol. 51 no Ramirez M. S. et. al. Rise and dissemination of aminoglycoside resistance: the aac(6 )-Ib paradigm. Front. Microbiol., 17 May 2013 doi: /fmicb
CHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
In Genomes, Two Types of Genes
In Genomes, Two Types of Genes Protein-coding: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] + DNA codons translated to amino acids to form a protein Non-coding RNAs (NcRNAs) No consistent patterns
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
Name: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
Computational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
Name Period The Control of Gene Expression in Prokaryotes Notes
Bacterial DNA contains genes that encode for many different proteins (enzymes) so that many processes have the ability to occur -not all processes are carried out at any one time -what allows expression
Bio 119 Bacterial Genomics 6/26/10
BACTERIAL GENOMICS Reading in BOM-12: Sec. 11.1 Genetic Map of the E. coli Chromosome p. 279 Sec. 13.2 Prokaryotic Genomes: Sizes and ORF Contents p. 344 Sec. 13.3 Prokaryotic Genomes: Bioinformatic Analysis
Warm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22)
Warm-Up Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Yesterday s Picture The first cell on Earth (approx. 3.5 billion years ago) was simple and prokaryotic,
BME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
Translation and Operons
Translation and Operons You Should Be Able To 1. Describe the three stages translation. including the movement of trna molecules through the ribosome. 2. Compare and contrast the roles of three different
Introduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
Chapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
L3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus
L3.1: Circuits: Introduction to Transcription Networks Cellular Design Principles Prof. Jenna Rickus In this lecture Cognitive problem of the Cell Introduce transcription networks Key processing network
Multiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11
UNIT 6 PART 3 *REGULATION USING OPERONS* Hillis Textbook, CH 11 REVIEW: Signals that Start and Stop Transcription and Translation BUT, HOW DO CELLS CONTROL WHICH GENES ARE EXPRESSED AND WHEN? First of
Chapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes
Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2
UNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
Types of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell.
RNAs L.Os. Know the different types of RNA & their relative concentration Know the structure of each RNA Understand their functions Know their locations in the cell Understand the differences between prokaryotic
Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
From Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
Topic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
1. In most cases, genes code for and it is that
Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod
GENE REGULATION AND PROBLEMS OF DEVELOPMENT
GENE REGULATION AND PROBLEMS OF DEVELOPMENT By Surinder Kaur DIET Ropar Surinder_1998@ yahoo.in Mob No 9988530775 GENE REGULATION Gene is a segment of DNA that codes for a unit of function (polypeptide,
Control of Gene Expression in Prokaryotes
Why? Control of Expression in Prokaryotes How do prokaryotes use operons to control gene expression? Houses usually have a light source in every room, but it would be a waste of energy to leave every light
Prokaryotic Regulation
Prokaryotic Regulation Control of transcription initiation can be: Positive control increases transcription when activators bind DNA Negative control reduces transcription when repressors bind to DNA regulatory
Initiation of translation in eukaryotic cells:connecting the head and tail
Initiation of translation in eukaryotic cells:connecting the head and tail GCCRCCAUGG 1: Multiple initiation factors with distinct biochemical roles (linking, tethering, recruiting, and scanning) 2: 5
+ regulation. ribosomes
central dogma + regulation rpl DNA tsx rrna trna mrna ribosomes tsl ribosomal proteins structural proteins transporters enzymes srna regulators RNAp DNAp tsx initiation control by transcription factors
Bacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
Flow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
GCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
Prokaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
Translation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Controlling Gene Expression
Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping
Boolean models of gene regulatory networks. Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016
Boolean models of gene regulatory networks Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016 Gene expression Gene expression is a process that takes gene info and creates
Regulation of Gene Expression at the level of Transcription
Regulation of Gene Expression at the level of Transcription (examples are mostly bacterial) Diarmaid Hughes ICM/Microbiology VT2009 Regulation of Gene Expression at the level of Transcription (examples
Introduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
PROTEIN SYNTHESIS: TRANSLATION AND THE GENETIC CODE
PROTEIN SYNTHESIS: TRANSLATION AND THE GENETIC CODE HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 Nucleic Acids are important for their roles
Molecular Biology - Translation of RNA to make Protein *
OpenStax-CNX module: m49485 1 Molecular Biology - Translation of RNA to make Protein * Jerey Mahr Based on Translation by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative
(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
Introduction to molecular biology. Mitesh Shrestha
Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of
Biology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
Gene regulation I Biochemistry 302. Bob Kelm February 25, 2005
Gene regulation I Biochemistry 302 Bob Kelm February 25, 2005 Principles of gene regulation (cellular versus molecular level) Extracellular signals Chemical (e.g. hormones, growth factors) Environmental
2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?
Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was
From gene to protein. Premedical biology
From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha
Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary
Topic 1 - The building blocks of. cells! Name:!
B2 - Revision Topic 1 - The building blocks of Lesson cells Name: Topic B2.1 Plant and Animal Cells B2.2 Inside Bacteria B2.3 DNA B2.4 Extracting DNA: PCA B2.5 DNA Discovery B2.6 Genetic Engineering B2.7
Lecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,
RNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA
RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order
Gene Regulation and Expression
THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.
Lesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression
13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.
Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Types of RNA Messenger RNA (mrna) makes a copy of DNA, carries instructions for making proteins,
Vital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)
We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Tuesday, December 27, 16
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Enduring understanding 3.B: Expression of genetic information involves cellular and molecular
Biology 105/Summer Bacterial Genetics 8/12/ Bacterial Genomes p Gene Transfer Mechanisms in Bacteria p.
READING: 14.2 Bacterial Genomes p. 481 14.3 Gene Transfer Mechanisms in Bacteria p. 486 Suggested Problems: 1, 7, 13, 14, 15, 20, 22 BACTERIAL GENETICS AND GENOMICS We still consider the E. coli genome
Genetics 304 Lecture 6
Genetics 304 Lecture 6 00/01/27 Assigned Readings Busby, S. and R.H. Ebright (1994). Promoter structure, promoter recognition, and transcription activation in prokaryotes. Cell 79:743-746. Reed, W.L. and
Chapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
9/11/18. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
Unit 3: Control and regulation Higher Biology
Unit 3: Control and regulation Higher Biology To study the roles that genes play in the control of growth and development of organisms To be able to Give some examples of features which are controlled
Lesson Overview. Ribosomes and Protein Synthesis 13.2
13.2 The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to mrna. This transcribed information contains a code for making proteins. The Genetic
Gene regulation II Biochemistry 302. Bob Kelm February 28, 2005
Gene regulation II Biochemistry 302 Bob Kelm February 28, 2005 Catabolic operons: Regulation by multiple signals targeting different TFs Catabolite repression: Activity of lac operon is restricted when
Regulation and signaling. Overview. Control of gene expression. Cells need to regulate the amounts of different proteins they express, depending on
Regulation and signaling Overview Cells need to regulate the amounts of different proteins they express, depending on cell development (skin vs liver cell) cell stage environmental conditions (food, temperature,
Chapter
Chapter 17 17.4-17.6 Molecular Components of Translation A cell interprets a genetic message and builds a polypeptide The message is a series of codons on mrna The interpreter is called transfer (trna)
GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription
Honors Biology Reading Guide Chapter 11
Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins
Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.
Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis: Protein synthesis uses the information in genes to make proteins. 2 Steps
Lecture 7: Simple genetic circuits I
Lecture 7: Simple genetic circuits I Paul C Bressloff (Fall 2018) 7.1 Transcription and translation In Fig. 20 we show the two main stages in the expression of a single gene according to the central dogma.
9/2/17. Molecular and Cellular Biology. 3. The Cell From Genes to Proteins. key processes
Molecular and Cellular Biology Animal Cell ((eukaryotic cell) -----> compare with prokaryotic cell) ENDOPLASMIC RETICULUM (ER) Rough ER Smooth ER Flagellum Nuclear envelope Nucleolus NUCLEUS Chromatin
Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
Introduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
APGRU6L2. Control of Prokaryotic (Bacterial) Genes
APGRU6L2 Control of Prokaryotic (Bacterial) Genes 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP u if they have enough of a product, need to stop production
Prokaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Development Team. Regulation of gene expression in Prokaryotes: Lac Operon. Molecular Cell Biology. Department of Zoology, University of Delhi
Paper Module : 15 : 23 Development Team Principal Investigator : Prof. Neeta Sehgal Department of Zoology, University of Delhi Co-Principal Investigator : Prof. D.K. Singh Department of Zoology, University
PROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
15.2 Prokaryotic Transcription *
OpenStax-CNX module: m52697 1 15.2 Prokaryotic Transcription * Shannon McDermott Based on Prokaryotic Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons
CS-E5880 Modeling biological networks Gene regulatory networks
CS-E5880 Modeling biological networks Gene regulatory networks Jukka Intosalmi (based on slides by Harri Lähdesmäki) Department of Computer Science Aalto University January 12, 2018 Outline Modeling gene
Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.
Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The
Quantitative Molecular Biology
Quantitative Molecular Biology PHYS 176/276 Instructor: Terry Hwa Winter 2018 What is quantitative biology? èquantitative biology biology + numbers/equations biology-inspired physics application of existing
Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids. Prepared by Woojoo Choi
Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids Prepared by Woojoo Choi Dead or alive? 1) In this chapter we will explore the twilight zone of biology and the gene creature who live there.
Chapter 4 A Tour of the Cell. The human body is made up of trillions of cells many of which are specialized - Muscle cells
Chapter 4 A Tour of the Cell State Standards Standard 1.c. Standard 1.e. Introduction to Cells Organisms are either - Single-celled, such as - Multicelled, such as The human body is made up of trillions
Slide 1. Slide 2. Slide 3. Chapter 4 A Tour of the Cell. State Standards. Introduction to Cells. Standard 1.c. Standard 1.e.
Slide 1 Chapter 4 A Tour of the Cell Slide 2 State Standards Standard 1.c. Standard 1.e. Slide 3 Introduction to Cells Organisms are either - Single-celled, such as - Multicelled, such as The human body
What is the central dogma of biology?
Bellringer What is the central dogma of biology? A. RNA DNA Protein B. DNA Protein Gene C. DNA Gene RNA D. DNA RNA Protein Review of DNA processes Replication (7.1) Transcription(7.2) Translation(7.3)
the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
REGULATION OF GENE EXPRESSION. Bacterial Genetics Lac and Trp Operon
REGULATION OF GENE EXPRESSION Bacterial Genetics Lac and Trp Operon Levels of Metabolic Control The amount of cellular products can be controlled by regulating: Enzyme activity: alters protein function
The nature of genomes. Viral genomes. Prokaryotic genome. Nonliving particle. DNA or RNA. Compact genomes with little spacer DNA
The nature of genomes Genomics: study of structure and function of genomes Genome size variable, by orders of magnitude number of genes roughly proportional to genome size Plasmids symbiotic DNA molecules,
MIP543 RNA Biology Fall 2015
MIP543 RNA Biology Fall 2015 Credits: 3 Term Offered: Day and Time: Fall (odd years) Mondays and Wednesdays, 4:00-5:15 pm Classroom: MRB 123 Course Instructor: Dr. Jeffrey Wilusz, Professor, MIP Office:
Bio 101 General Biology 1
Revised: Fall 2016 Bio 101 General Biology 1 COURSE OUTLINE Prerequisites: Prerequisite: Successful completion of MTE 1, 2, 3, 4, and 5, and a placement recommendation for ENG 111, co-enrollment in ENF
A genomic-scale search for regulatory binding sites in the integration host factor regulon of Escherichia coli K12
The integration host factor regulon of E. coli K12 genome 783 A genomic-scale search for regulatory binding sites in the integration host factor regulon of Escherichia coli K12 M. Trindade dos Santos and
Introduction to Biology
Introduction to Biology Course Description Introduction to Biology is an introductory course in the biological sciences. Topics included are biological macromolecules, cell biology and metabolism, DNA
Protein synthesis I Biochemistry 302. February 17, 2006
Protein synthesis I Biochemistry 302 February 17, 2006 Key features and components involved in protein biosynthesis High energy cost (essential metabolic activity of cell Consumes 90% of the chemical energy