3.94 ± 0.50 (95% CI) Correlative inhibition index (slope)
|
|
- Jared Warren
- 5 years ago
- Views:
Transcription
1 Supplementl Tle S. Selected rchitecturl prmeters of phy nd phyphy grown under. Vlues re mens ± SE, except for predicted primry rosette rnches where the vlues re the men with the ssocited 9% confidence intervl, nd the correltive inhiition vlue which is regression slope s descried in the text. phy phyphy Primry rosette leves. ± ±. Time to nthesis (dys). ±.. ±. Primry rosette rnches.9 ±.9.7 ±.9 Primry rosette uds. ±.. ±. Rosette rnch n secondry rnches. ±.. ±. Rosette rnch n secondry leves. ±..9 ±. Culine rnch n secondry rnches. ±..9 ±. Culine rnch n secondry leves.9 ±.. ±. Predicted primry rosette rnches t 7.7 rnches (phyphy verge).9 ±. (9% CI) Culine rnch n+ length. ±.9. ± 7.9 Culine rnch n+ length 9. ± ± 9. Culine rnch n+ length. ±..7 ±. Culine rnch n+ length.9 ±..7 ±.9 Culine rnch n length.7 ±.9. ± 7. Min shoot length 7.9 ±.. ±. Rosette rnch n length 79. ±.. ±.7 Rosette rnch n- length. ±.. ±.9 Rosette rnch n- length 9. ±.. ± 9. Rosette rnch n- length 77. ±.9.7 ±. Rosette rnch n- length 9. ± 9.7 Rosette rnch n- length.97 ±.9 Correltive inhiition index (slope). 9.
2 Supplementl Tle S. Sequence of primers used for QPCR. mrn Forwrd primer Reverse primer trget RC GTCCTCCCGCTC TTGTGCTGGGTCTCTTGG RC TCGGGCGCTTGG CCGGGTCTCTTCTCTC DRM TGTTGTGGCTGGCCTC TTGGGTTCCGGGCTCCT T TTTCCTCTTCCCGTCCCTG TGCTCTTCCTTGTGTCTCCTC PCN GGTTTTCTCTGCCGGTGCT TGTCCTCGGGCTGGG th- CTCCGGGCTTGCTTTCC CCCTTCCCTTGTCTTGCTC CLV GTTCGGCTTTCCCCGCG TCTCCTTTGCTCCCCCTT WUS CCGCTTCTCGGGTTTTCT GC TCTGTGCCTTGGCTTC CCCCT RR TCTTGGGGGCTGGTTTC TGCTTCGCTCTCTCTTGTGCT CYC; TCTCCGGCGCGC GGCTTGGTTCTTCGCTTCTT CYCD; CCTTTCGGGCGTGC TGTTCCCCGCCTTCTCCTC CYCD; TTGTCCCTTTGCCCTCTT TTGGTCTGTCCGTGC CLV CTTCTTGCTGGCTCTTTGG CTCCTCTTCTCGTCCCTTTC STM GGCTCGTCCCTGCTTGT CCTTGTTTTCTGTTTCTGGTCC From guilr- Mrtínez, J.., Poz-Crrión, C., nd Cus, P. (7) ridopsis RNCHED cts s n integrtor of rnching signls within xillry uds. Plnt Cell 9: -7 From Müller, R., orghi, L., Kwitkowsk, D., Lufs, P., nd Simon, R. () Dynmic nd Compenstory Responses of ridopsis Shoot nd Florl Meristems to CLV Signling. Plnt Cell : 9
3 time (dys) Dys to nthesis PHY phy rc rc rcrc xr- mx mx rc rc rcrc Supplementl Figure S. Time to nthesis of vrious ridopsis genotypes with or without functionl phy (left pnel of ech grph) or under high nd (shded right pnel of ech grph). sterisks indicte significnt difference etween genotypes or light tretments t α =.. Dt re mens ± SE. For nlyses compring lines with or without functionl phy, n = (phymx) to 7 (), verge n =. For high nd, n = (rc) to 7 (), verge n = 7.
4 PHY =.x +.9 r =.9 phy =.x -.9 r =. phy rc rc PHY =.x +. r =.9 phy =.x -.7 r =.9 PHY =.x +.79 r =.97 phy =.x +.9 r =.97 PHY =.9x +. r =.7 phy =.9x +. r =.9 Primry rosette rnches rcrc PHY =.7x +. r =.9 phy =.x +.9 r =. xr- mx mx PHY = -.x +. r =. phy =.x +. r =.9 PHY =.9x +. r =.99 phy =.x +. r =. PHY =.9x +.7 r =.9 phy =.9x +. r =.9 rc rc rcrc High R:FR =.7x +. r =. Low R:FR =.x +. r =.99 High R:FR =.x +.7 r =.79 Low R:FR =.9x -. r =. High R:FR = -.x +. r =. Low R:FR = -.x +. High R:FR =.7x +. r =.99 Low R:FR =.x -. r =.99 Primry rosette leves Primry rosette rnches 9% confidence intervl of regression t phy men lef numer =. ±.7 9% confidence intervl of phy men lef numer =.7 ±. PHY =. x +.9, r = difference in men rosette lef numer PHY vs. phy oserved PHY men PHY clculted PHY t oserved phy men phy phy men lef numer Primry rosette leves phy =. x -.9, r =. Method description ) PHY nd phy (or high nd ) dt were seprted into su-clsses sed on lef numer nd the mens for ech pplicle rnching prmeter were regressed ginst lef numer to revel the correltion. ) The stndrd errors of the intercept nd slope of the regression from () were used to generte the respective 9% confidence intervls. ) The regression eqution of PHY (or high R:FR) from () ws used to clculte the vlue of the rnching prmeter t the oserved phy (or ) men lef numer. The 9% confidence intervl ssocited with the clculted vlue were derived using the vlues otined in (). ) The 9% confidence intervl of the clculted rnching prmeter vlue for PHY (or ) from () ws compred to the 9% confidence intervl of the oserved men phy (or ) men rnching prmeter vlue. Exmple (PHY vs phy rosette rnches) PHY =. x +.9, r =.9 phy =. x -.9, r =. (not used for clcultion) PHY =. x +.9. Slope lower limit =., upper limit =.. Intercept lower limit =.9, upper limit =.9. Oserved men phy rosette lef numer = 7.9. PHY c = =.. 9% confidence limits for clculted PHY men rnch numer ( c ) =. ± (. -((. 7.9) +.9)) =. ±.7 PHY c =. ±.7 phy =.7 ±. The 9% confidence intervls do not overlp, therefore the stndrdized rnch numers re significntly different. Supplementl Figure S. ) Regressions of primry rosette rnch numers versus primry rosette lef numers of vrious ridopsis genotypes with or without functionl phy (top two rows) or under high nd (shded lower row). ) Exmple () of the method used to generte stndrdized rnch (ud) numers nd errors employing regression to clculte PHY or rnch (ud) numers t the sme men lef numer s phy or. Error rs re 9% confidence intervls.
5 PHY m =.x +. r =.9 phy m =.9x +. r =.9 phy rc rc PHY m =.x +. r =.97 phy m =.7x +. r =.97 PHY m =.9x +. r =. phy m =.x +.7 r =. PHY m =.97x +. r =. phy m =.x -. r =. Primry rosette uds rcrc PHY m =.9x +. r =.97 phy m =.9x -. r =.9 xr- mx mx PHY m =.x +.7 r =.9 phy m =.9x +. r =.97 PHY m =.x -.7 r =.9 phy m =.x +.7 r =. PHY m =.9x +. r =. phy m =.x +. r =.9 rc rc rcrc High R:FR m =.x -. r =. High R:FR m =.x -. r =.97 Low R:FR m =.9x +.7 r =. High R:FR m =.9x +.7 r =. Low R:FR m =.x -. High R:FR m =.x +. r =. Low R:FR m =.x -. r =.99 Low R:FR m =.9x -. r =.9 Primry rosette leves Supplementl Figure S. Regressions of primry rosette ud numers versus primry rosette lef numers of vrious ridopsis genotypes with or without functionl phy (top two rows) or under high nd (shded lower row).
6 Rosette rnch n secondry rnches PHY phy numer of leves numer of rnches Rosette rnch n secondry leves rc rc rcrc xr- mx mx rc rc Supplementl Figure S. Secondry rnching prmeters of primry rosette rnch n (uppermost rosette rnch) of vrious ridopsis genotypes t ten DP with or without functionl phy (left pnel of ech grph) or under high nd (shded right pnel of ech grph). Sttisticl comprisons for secondry rosette rnch numers () nd secondry rosette lef numers () were mde within ech genotype sufficient (PHY), or deficient (phy) for phy, or within ech genotype grown under high versus. sterisks indicte significnt difference etween genotypes or light tretments t α =.. Dt re mens ± SE. For nlyses compring lines with or without functionl phy, n = (phymx) to 7 (), verge n =. For high nd, n = (rc) to 7 (), verge n = 7. rcrc
7 7 Culine rnch n secondry rnches PHY phy numer of leves numer of rnches 7 Culine rnch n secondry leves rc rc rcrc xr- mx mx rc rc rcrc Supplementl Figure S. Secondry rnching prmeters of primry culine rnch n (lowest culine rnch) of vrious ridopsis genotypes t ten DP with or without functionl phy (left pnel of ech grph) or under high nd (shded right pnel of ech grph). Sttisticl comprisons for secondry culine rnch numers () nd secondry culine lef numers () were mde within ech genotype sufficient (PHY), or deficient (phy) for phy, or within ech genotype grown under high versus. sterisks indicte significnt difference etween genotypes or light tretments t α =.. Dt re mens ± SE. For nlyses compring lines with or without functionl phy, n = (phymx) to 7 (), verge n =. For high nd, n = (rc) to 7 (), verge n = 7.
8 length (mm) phy phy phyphy rc rc length (mm) rc phyrc rc phyrc rcrc phyrcrc rc rc rcrc rcrc length (mm) xr- phyxr- mx phymx mx phymx Supplementl Figure S. Min shoot height (longest r), lengths of culine rnches (to left of longest r, with lowest rnch to immedite left of longest r) nd lengths of rosette rnches (to right of longest r) of vrious ridopsis genotypes t ten DP grown under with or without functionl phy (left pnels) or under high nd (shded right pnels). sterisks indicte significnt height difference etween genotypes or light tretments t α =.. Dt re mens ± SE. For nlyses compring lines with or without functionl phy, n = (phymx) to 7 (), verge n =. For high nd, n = (rc) to 7 (), verge n = 7.
9 ud n ud n- RC RC ' ' DRM ' '..... T c TH- ' ' PCN trget trnscripts - S trnscripts..... CLV CYC; ' ' WUS CYCD; ' ' RR CYCD; ' ' STM ' CLV phy phy phy phy phy phy phy phy ' phy phy phy phy phy phy phy phy phy phy phy phy phy phy phy phy Supplementl Figure S7. undnce of vrious mrns in unelongted primry rosette ud n [uppermost ud] nd ud n- [ud immeditely elow ud n] of, phy, phy nd phyphy grown under (left pnel of ech grph) or grown under high nd (shded right pnel of ech grph). Results re the mens of QPCR nlysis of iologicl replictes ± SE of the men. rs with different letters re significntly different t α =..
10 RC RC DRM T PCN TH- CLV WUS RR CYC; CYCD; CYCD; STM CLV r =. q =.9 r =. q =. r =. q =. r =.7 q =. r =. q =.7 r =. q =. r =. q =.7 r =. q =. r =. q =. r =. q =. r =. q =. r =. q =. r =. q =. STM r =. q =. r =. q =.7 r =. q =. r =.9 q =. r =.7 q =. r =. q =. r =. q =. r =. q =. r =. q =. r =. q =. r =. q =. r =. q =. CYCD; r =.9 q =. r =. q =. r =. q =.9 r =.7 q =. r =. q =. r =. q =. r =.7 q =. r =. q =. r =. q =.9 r =. q =. r =. q =. CYCD; r =. q =. r =. q =. r =.9 q =. r =. q =.7 r =.7 q =. r =. q =. r =. q =.7 r =. q =. r =. q =. r =. q =. CYC; r =. q =. r =. q =. r =. q =.9 r =. q =.9 r =. q =.9 r =. q =. r =.7 q =. r =.9 q =. r =. q = RR. WUS trget trnscripts - S trnscripts.. r =. q =. r =.77 q =. r =.7 q =. r =.9 q =. r =. q =. r =. q =. r =. q =. r =. q =. r =. q =. r =. q =. r =.9 q =. r =. q =. r =. q =. r =. q =..... trget trnscripts - S trnscripts r =. q =. CLV.. r =. q =.9 r =.7 q =. r =. q =. r =. q =. r =.7 q =. r =.9 q =. TH- r =. q =.7 r =. q =. r =. q =.7 r =.9 q =. r =. q =. PCN r =. q =. r =. q =. r =. q =. r =. q = T... r =.9 q =. r =. q =. r =. q =. r =. q =. DRM r =. q =. r =. q =. RC Supplementl Figure S. Correltion mtrix of the undnce of ech mesured mrn species regressed ginst ll others. Significnt correltion t q =. is indicted y squre mgent symols.
11 DRM T PCN WUS TH- CLV RR rosette rnch length (mm) r =. p =. r =. p =.7 r =.7 p =. r =.7 p =. r =.9 p =. r =. p =.7 r =.7 p =. correltive inhiition (slope) ud n- ud n r =.7 p =.7 r =. p =.7 - r =. p =. r =. p =. r =. p =.7 r =. p =. r =. p =. r =.9 p =. r =.7 p =. r =.9 p =. r =.7 p =.9 r =. p =..... r =. p =.9 r =. p =..... trget trnscripts - S trnscripts Supplementl Figure S9. Correltion nlysis of the mrn undnce of selected genes regressed ginst rosette rnch lengths (ud n [uppermost ud] nd ud n- [ud immeditely elow ud n] dt regressed together) nd correltive inhiition (ud n nd n- dt regressed seprtely). Significnt correltion t α =. is indicted y green tringulr symols. Significnt correltion t α =. is indicted y squre mgent symols.
12 .... photon flux density (µmol m - s - )..... High R:FR Low R:FR wvelength (nm) Supplementl Figure S. Spectr of light sources used in the experiments. Spectrum of light source used for comprisons of vrious genotypes with nd without functionl phy (). Spectrum of light sources used for high nd low R:FR comprisons ().
Supplementary material
10.1071/FP11237_AC CSIRO 2012 Accessory Puliction: Functionl Plnt Biology 2012, 39(5), 379 393. Supplementry mteril Tle S1. Effect of wter regime nd genotype on different growth prmeters: spike dry mtter
More informationsupplementary information
DOI: 1.138/nc8 Top-GFP!-ctenin GFP Intensity 3 1 1 3 5 6 7 8 Nucler Bet-Ctenin c MUC FABP KRT 8 5 3 6 15 1 5 LGR5 ASCL AXIN 15 5 15 5 Figure S1 TOP-GFP expression nd reltion with nucler β-ctenin, wnt trgets
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture8499 doi:.38/nture8499 5 6 5 4.5 Firing rte (Hz) -67-65 -66-6 -58 V m (mv) -7-67 -68-66 -64 c Thet power (mv ) -73-69 -7-7 -7.5.8 3....9.9.4.6.6. 9 8 9 8 9 8 9 8 9 8 Supplementry Figure Firing
More informationScientific notation is a way of expressing really big numbers or really small numbers.
Scientific Nottion (Stndrd form) Scientific nottion is wy of expressing relly big numbers or relly smll numbers. It is most often used in scientific clcultions where the nlysis must be very precise. Scientific
More informationControl NaCl ABA * * Control 4ºC 37ºC
Dul regultion of wter retention nd cell growth y stress-ssocited protein (SAP) gene in Prunus A. Lloret, A. Conejero, C. Leid, C. Petri, F. Gil-Muñoz, L. Burgos, M.L. Bdenes, nd G. Ríos.5 PpSAP Reltive
More informationFORM FIVE ADDITIONAL MATHEMATIC NOTE. ar 3 = (1) ar 5 = = (2) (2) (1) a = T 8 = 81
FORM FIVE ADDITIONAL MATHEMATIC NOTE CHAPTER : PROGRESSION Arithmetic Progression T n = + (n ) d S n = n [ + (n )d] = n [ + Tn ] S = T = T = S S Emple : The th term of n A.P. is 86 nd the sum of the first
More informationMA 15910, Lessons 2a and 2b Introduction to Functions Algebra: Sections 3.5 and 7.4 Calculus: Sections 1.2 and 2.1
MA 15910, Lessons nd Introduction to Functions Alger: Sections 3.5 nd 7.4 Clculus: Sections 1. nd.1 Representing n Intervl Set of Numers Inequlity Symol Numer Line Grph Intervl Nottion ) (, ) ( (, ) ]
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures. Title of file for HTML: Peer Review File Description:
Title of file for HTML: Supplementry Informtion Description: Supplementry Figures Title of file for HTML: Peer Review File Description: WTP SST IPO PDO WTP leds IPO PDO Supplementry Figure 1 IPO (or PDO)
More informationSection 6: Area, Volume, and Average Value
Chpter The Integrl Applied Clculus Section 6: Are, Volume, nd Averge Vlue Are We hve lredy used integrls to find the re etween the grph of function nd the horizontl xis. Integrls cn lso e used to find
More informationCh AP Problems
Ch. 7.-7. AP Prolems. Willy nd his friends decided to rce ech other one fternoon. Willy volunteered to rce first. His position is descried y the function f(t). Joe, his friend from school, rced ginst him,
More informationSection 6.1 INTRO to LAPLACE TRANSFORMS
Section 6. INTRO to LAPLACE TRANSFORMS Key terms: Improper Integrl; diverge, converge A A f(t)dt lim f(t)dt Piecewise Continuous Function; jump discontinuity Function of Exponentil Order Lplce Trnsform
More informationDepartment of Physical Pharmacy and Pharmacokinetics Poznań University of Medical Sciences Pharmacokinetics laboratory
Deprtment of Physicl Phrmcy nd Phrmcoinetics Poznń University of Medicl Sciences Phrmcoinetics lbortory Experiment 1 Phrmcoinetics of ibuprofen s n exmple of the first-order inetics in n open one-comprtment
More informationChapter 9 Definite Integrals
Chpter 9 Definite Integrls In the previous chpter we found how to tke n ntiderivtive nd investigted the indefinite integrl. In this chpter the connection etween ntiderivtives nd definite integrls is estlished
More informationThe area under the graph of f and above the x-axis between a and b is denoted by. f(x) dx. π O
1 Section 5. The Definite Integrl Suppose tht function f is continuous nd positive over n intervl [, ]. y = f(x) x The re under the grph of f nd ove the x-xis etween nd is denoted y f(x) dx nd clled the
More informationUnit Six AP Calculus Unit 6 Review Definite Integrals. Name Period Date NON-CALCULATOR SECTION
Unit Six AP Clculus Unit 6 Review Definite Integrls Nme Period Dte NON-CALCULATOR SECTION Voculry: Directions Define ech word nd give n exmple. 1. Definite Integrl. Men Vlue Theorem (for definite integrls)
More informationSupplementary Figures
Electronic Supplementry Mteril (ESI) for Integrtie Biology. This journl is The Royl Society of Chemistry 214 Supplementry Figures CWound Are µm2 A EGTA Low Clcium 8 1 min. fter wounding Wound + 1 min.
More informationa cacnb1 ts25/ts25 Supplemental Figure 1
ccn1 ts/ts α -ungrotoxin prlyzed 0.6 ΔF/F 0.0 2 ΔF/F 2 s stimulus α -ungrotoxin ccn1 ts/ts Supplementl Figure 1 CSF-cNs recorded from lrv prlyzed with α-ungrotoxin nd ccn1 mutnt lrv show no difference
More informationSection 7.1 Area of a Region Between Two Curves
Section 7.1 Are of Region Between Two Curves White Bord Chllenge The circle elow is inscried into squre: Clcultor 0 cm Wht is the shded re? 400 100 85.841cm White Bord Chllenge Find the re of the region
More informationStudent Activity 3: Single Factor ANOVA
MATH 40 Student Activity 3: Single Fctor ANOVA Some Bsic Concepts In designed experiment, two or more tretments, or combintions of tretments, is pplied to experimentl units The number of tretments, whether
More informationI1 = I2 I1 = I2 + I3 I1 + I2 = I3 + I4 I 3
2 The Prllel Circuit Electric Circuits: Figure 2- elow show ttery nd multiple resistors rrnged in prllel. Ech resistor receives portion of the current from the ttery sed on its resistnce. The split is
More informationLinear Inequalities. Work Sheet 1
Work Sheet 1 Liner Inequlities Rent--Hep, cr rentl compny,chrges $ 15 per week plus $ 0.0 per mile to rent one of their crs. Suppose you re limited y how much money you cn spend for the week : You cn spend
More informationNon-Linear & Logistic Regression
Non-Liner & Logistic Regression If the sttistics re boring, then you've got the wrong numbers. Edwrd R. Tufte (Sttistics Professor, Yle University) Regression Anlyses When do we use these? PART 1: find
More informationSUPPLEMENTARY INFORMATION
Jhn, Supplementry Figure S1 c Supplementry Figure S1, Solvent flttened, single-wvelength nomlous dispersion electron density mp (gry mesh) of the synptic SNARE complex with its two linker regions nd TMRs
More informationComparison Procedures
Comprison Procedures Single Fctor, Between-Subects Cse /8/ Comprison Procedures, One-Fctor ANOVA, Between Subects Two Comprison Strtegies post hoc (fter-the-fct) pproch You re interested in discovering
More informationMathematics. Area under Curve.
Mthemtics Are under Curve www.testprepkrt.com Tle of Content 1. Introduction.. Procedure of Curve Sketching. 3. Sketching of Some common Curves. 4. Are of Bounded Regions. 5. Sign convention for finding
More information5.1 How do we Measure Distance Traveled given Velocity? Student Notes
. How do we Mesure Distnce Trveled given Velocity? Student Notes EX ) The tle contins velocities of moving cr in ft/sec for time t in seconds: time (sec) 3 velocity (ft/sec) 3 A) Lel the x-xis & y-xis
More informationThe Trapezoidal Rule
_.qd // : PM Pge 9 SECTION. Numericl Integrtion 9 f Section. The re of the region cn e pproimted using four trpezoids. Figure. = f( ) f( ) n The re of the first trpezoid is f f n. Figure. = Numericl Integrtion
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.2398 Locl virtionl coherences drive the primry photochemistry of vision Philip J. M. Johnson 1, Alexei Hlpin 1, Tkefumi Morizumi 2, Vlentyn I. Prokhorenko 3, Oliver P. Ernst 2,4, & R.
More informationBME 207 Introduction to Biomechanics Spring 2018
April 6, 28 UNIVERSITY O RHODE ISAND Deprtment of Electricl, Computer nd Biomedicl Engineering BME 27 Introduction to Biomechnics Spring 28 Homework 8 Prolem 14.6 in the textook. In ddition to prts -e,
More information1B40 Practical Skills
B40 Prcticl Skills Comining uncertinties from severl quntities error propgtion We usully encounter situtions where the result of n experiment is given in terms of two (or more) quntities. We then need
More informationA Matrix Algebra Primer
A Mtrix Algebr Primer Mtrices, Vectors nd Sclr Multipliction he mtrix, D, represents dt orgnized into rows nd columns where the rows represent one vrible, e.g. time, nd the columns represent second vrible,
More informationPopulation Dynamics Definition Model A model is defined as a physical representation of any natural phenomena Example: 1. A miniature building model.
Popultion Dynmics Definition Model A model is defined s physicl representtion of ny nturl phenomen Exmple: 1. A miniture building model. 2. A children cycle prk depicting the trffic signls 3. Disply of
More informationQuantum Nonlocality Pt. 2: No-Signaling and Local Hidden Variables May 1, / 16
Quntum Nonloclity Pt. 2: No-Signling nd Locl Hidden Vriles My 1, 2018 Quntum Nonloclity Pt. 2: No-Signling nd Locl Hidden Vriles My 1, 2018 1 / 16 Non-Signling Boxes The primry lesson from lst lecture
More informationLecture 21: Order statistics
Lecture : Order sttistics Suppose we hve N mesurements of sclr, x i =, N Tke ll mesurements nd sort them into scending order x x x 3 x N Define the mesured running integrl S N (x) = 0 for x < x = i/n for
More informationSUPPLEMENTARY INFORMATION
VOLUME: ARTICLE NUMBER: 3 In the formt provided y the uthors nd unedited. Developmentl constrints shpe the evolution of the nemtode mid-developmentl trnsition Hrel Zlts nd Iti Yni,3 Fculty of Biology,
More information2 b. , a. area is S= 2π xds. Again, understand where these formulas came from (pages ).
AP Clculus BC Review Chpter 8 Prt nd Chpter 9 Things to Know nd Be Ale to Do Know everything from the first prt of Chpter 8 Given n integrnd figure out how to ntidifferentite it using ny of the following
More informationProbabilistic Investigation of Sensitivities of Advanced Test- Analysis Model Correlation Methods
Probbilistic Investigtion of Sensitivities of Advnced Test- Anlysis Model Correltion Methods Liz Bergmn, Mtthew S. Allen, nd Dniel C. Kmmer Dept. of Engineering Physics University of Wisconsin-Mdison Rndll
More information7.1 Integral as Net Change Calculus. What is the total distance traveled? What is the total displacement?
7.1 Integrl s Net Chnge Clculus 7.1 INTEGRAL AS NET CHANGE Distnce versus Displcement We hve lredy seen how the position of n oject cn e found y finding the integrl of the velocity function. The chnge
More informationDerivations for maximum likelihood estimation of particle size distribution using in situ video imaging
2 TWMCC Texs-Wisconsin Modeling nd Control Consortium 1 Technicl report numer 27-1 Derivtions for mximum likelihood estimtion of prticle size distriution using in situ video imging Pul A. Lrsen nd Jmes
More informationList all of the possible rational roots of each equation. Then find all solutions (both real and imaginary) of the equation. 1.
Mth Anlysis CP WS 4.X- Section 4.-4.4 Review Complete ech question without the use of grphing clcultor.. Compre the mening of the words: roots, zeros nd fctors.. Determine whether - is root of 0. Show
More informationExploring parametric representation with the TI-84 Plus CE graphing calculator
Exploring prmetric representtion with the TI-84 Plus CE grphing clcultor Richrd Prr Executive Director Rice University School Mthemtics Project rprr@rice.edu Alice Fisher Director of Director of Technology
More information2.4 Linear Inequalities and Interval Notation
.4 Liner Inequlities nd Intervl Nottion We wnt to solve equtions tht hve n inequlity symol insted of n equl sign. There re four inequlity symols tht we will look t: Less thn , Less thn or
More informationWe partition C into n small arcs by forming a partition of [a, b] by picking s i as follows: a = s 0 < s 1 < < s n = b.
Mth 255 - Vector lculus II Notes 4.2 Pth nd Line Integrls We begin with discussion of pth integrls (the book clls them sclr line integrls). We will do this for function of two vribles, but these ides cn
More informationLesson 8.1 Graphing Parametric Equations
Lesson 8.1 Grphing Prmetric Equtions 1. rete tle for ech pir of prmetric equtions with the given vlues of t.. x t 5. x t 3 c. x t 1 y t 1 y t 3 y t t t {, 1, 0, 1, } t {4,, 0,, 4} t {4, 0,, 4, 8}. Find
More informationSupplementary Figure 1
Supplementry Figure (nesthetized) (wke) Normlized mplitude.5 Pek width (ms).6.4.2 4 2 2 x 3 Wveform slope Normlized mplitude.5 Pek width (ms).6.4.2 x 3 3 2 Wveform slope c (nesthetized) d (wke) Normlized
More informationUnit #10 De+inite Integration & The Fundamental Theorem Of Calculus
Unit # De+inite Integrtion & The Fundmentl Theorem Of Clculus. Find the re of the shded region ove nd explin the mening of your nswer. (squres re y units) ) The grph to the right is f(x) = -x + 8x )Use
More informationChapter 4: Techniques of Circuit Analysis. Chapter 4: Techniques of Circuit Analysis
Chpter 4: Techniques of Circuit Anlysis Terminology Node-Voltge Method Introduction Dependent Sources Specil Cses Mesh-Current Method Introduction Dependent Sources Specil Cses Comprison of Methods Source
More informationSummer Work Packet for MPH Math Classes
Summer Work Pcket for MPH Mth Clsses Students going into Pre-clculus AC Sept. 018 Nme: This pcket is designed to help students sty current with their mth skills. Ech mth clss expects certin level of number
More information10.2 The Ellipse and the Hyperbola
CHAPTER 0 Conic Sections Solve. 97. Two surveors need to find the distnce cross lke. The plce reference pole t point A in the digrm. Point B is meters est nd meter north of the reference point A. Point
More informationPredict Global Earth Temperature using Linier Regression
Predict Globl Erth Temperture using Linier Regression Edwin Swndi Sijbt (23516012) Progrm Studi Mgister Informtik Sekolh Teknik Elektro dn Informtik ITB Jl. Gnesh 10 Bndung 40132, Indonesi 23516012@std.stei.itb.c.id
More information7.1 Integral as Net Change and 7.2 Areas in the Plane Calculus
7.1 Integrl s Net Chnge nd 7. Ares in the Plne Clculus 7.1 INTEGRAL AS NET CHANGE Notecrds from 7.1: Displcement vs Totl Distnce, Integrl s Net Chnge We hve lredy seen how the position of n oject cn e
More informationLAMEPS Limited area ensemble forecasting in Norway, using targeted EPS
Limited re ensemle forecsting in Norwy, using trgeted Mrit H. Jensen, Inger-Lise Frogner* nd Ole Vignes, Norwegin Meteorologicl Institute, (*held the presenttion) At the Norwegin Meteorologicl Institute
More informationb a wt ccd8 dad2 Secondary branches 15 e cd normal low b 2
A 3 1 Shoot mss (g) B Root mss (g) C 8 Primry rnhes D 8 Seonry rnhes 1 e E 8 Shoot mss/rnhes norml low 1 F 8 8 Shoot mss/root mss 8 8 Supplementl Figure 1 Aitionl phenotypi t reore from the plnts esrie
More informationDepartment of Chemical Engineering ChE-101: Approaches to Chemical Engineering Problem Solving MATLAB Tutorial VII
Tutoril VII: Liner Regression Lst updted 5/8/06 b G.G. Botte Deprtment of Chemicl Engineering ChE-0: Approches to Chemicl Engineering Problem Solving MATLAB Tutoril VII Liner Regression Using Lest Squre
More informationA Critical Path Problem Using Intuitionistic. Trapezoidal Fuzzy Number
pplied Mthemticl Sciences, Vol. 8, 0, no. 5, 555-56 HIKRI Ltd, www.m-hikri.com http://dx.doi.org/0.988/ms.0.9 Criticl Pth Prolem Using Intuitionistic Trpezoidl Fuzzy Numer P. Jygowri Deprtment of Mthemtics
More informationMIXED MODELS (Sections ) I) In the unrestricted model, interactions are treated as in the random effects model:
1 2 MIXED MODELS (Sections 17.7 17.8) Exmple: Suppose tht in the fiber breking strength exmple, the four mchines used were the only ones of interest, but the interest ws over wide rnge of opertors, nd
More informationAlgebra Readiness PLACEMENT 1 Fraction Basics 2 Percent Basics 3. Algebra Basics 9. CRS Algebra 1
Algebr Rediness PLACEMENT Frction Bsics Percent Bsics Algebr Bsics CRS Algebr CRS - Algebr Comprehensive Pre-Post Assessment CRS - Algebr Comprehensive Midterm Assessment Algebr Bsics CRS - Algebr Quik-Piks
More informationI. Theory of Automata II. Theory of Formal Languages III. Theory of Turing Machines
CI 3104 /Winter 2011: Introduction to Forml Lnguges Chpter 16: Non-Context-Free Lnguges Chpter 16: Non-Context-Free Lnguges I. Theory of utomt II. Theory of Forml Lnguges III. Theory of Turing Mchines
More informationPhysics 202H - Introductory Quantum Physics I Homework #08 - Solutions Fall 2004 Due 5:01 PM, Monday 2004/11/15
Physics H - Introductory Quntum Physics I Homework #8 - Solutions Fll 4 Due 5:1 PM, Mondy 4/11/15 [55 points totl] Journl questions. Briefly shre your thoughts on the following questions: Of the mteril
More informationNUMERICAL STUDY OF COEXISTING ATTRACTORS FOR THE HÉNON MAP
NUMERICAL STUDY OF COEXISTING ATTRACTORS FOR THE HÉNON MAP ZBIGNIEW GALIAS Deprtment of Electricl Engineering, AGH University of Science nd Technology, Mickiewicz 30, 30 059 Krków, Polnd glis@gh.edu.pl
More information14.3 comparing two populations: based on independent samples
Chpter4 Nonprmetric Sttistics Introduction: : methods for mking inferences bout popultion prmeters (confidence intervl nd hypothesis testing) rely on the ssumptions bout probbility distribution of smpled
More informationNote 12. Introduction to Digital Control Systems
Note Introduction to Digitl Control Systems Deprtment of Mechnicl Engineering, University Of Ssktchewn, 57 Cmpus Drive, Ssktoon, SK S7N 5A9, Cnd . Introduction A digitl control system is one in which the
More informationChapter 9: Inferences based on Two samples: Confidence intervals and tests of hypotheses
Chpter 9: Inferences bsed on Two smples: Confidence intervls nd tests of hypotheses 9.1 The trget prmeter : difference between two popultion mens : difference between two popultion proportions : rtio of
More informationEnergy (kcal mol -1 ) Force (kcal mol -1 Å -1 ) Pore axis (Å) Mixed Mo-only S-only Graphene
Force (kcl mol -1 Å -1 ) Energy (kcl mol -1 ) 3 1-1 - -3 Mixed Mo-only S-only Grphene 6 5 3 1 Mixed Mo-only S-only Grphene - -1-1 1 Pore xis (Å) -1 1 Pore xis (Å) Supplementry Figure 1 Energy Brriers.
More information( dg. ) 2 dt. + dt. dt j + dh. + dt. r(t) dt. Comparing this equation with the one listed above for the length of see that
Arc Length of Curves in Three Dimensionl Spce If the vector function r(t) f(t) i + g(t) j + h(t) k trces out the curve C s t vries, we cn mesure distnces long C using formul nerly identicl to one tht we
More information378 Relations Solutions for Chapter 16. Section 16.1 Exercises. 3. Let A = {0,1,2,3,4,5}. Write out the relation R that expresses on A.
378 Reltions 16.7 Solutions for Chpter 16 Section 16.1 Exercises 1. Let A = {0,1,2,3,4,5}. Write out the reltion R tht expresses > on A. Then illustrte it with digrm. 2 1 R = { (5,4),(5,3),(5,2),(5,1),(5,0),(4,3),(4,2),(4,1),
More informationy = f(x) This means that there must be a point, c, where the Figure 1
Clculus Investigtion A Men Slope TEACHER S Prt 1: Understnding the Men Vlue Theorem The Men Vlue Theorem for differentition sttes tht if f() is defined nd continuous over the intervl [, ], nd differentile
More informationImprovement of chilling efficiency and product quality of broiler carcasses using sub-zero saline solutions
Improvement of chilling efficiency nd product qulity of roiler crcsses using su-zero sline solutions I. Kng*, M.M. Metheny*, nd PhD, H.C. Lee*, PhD, D. Bennett *, PhD, S. Hurley, PhD, Animl Science*/Agriusiness
More informationFig. 1. Open-Loop and Closed-Loop Systems with Plant Variations
ME 3600 Control ystems Chrcteristics of Open-Loop nd Closed-Loop ystems Importnt Control ystem Chrcteristics o ensitivity of system response to prmetric vritions cn be reduced o rnsient nd stedy-stte responses
More informationNetwork Analysis and Synthesis. Chapter 5 Two port networks
Network Anlsis nd Snthesis hpter 5 Two port networks . ntroduction A one port network is completel specified when the voltge current reltionship t the terminls of the port is given. A generl two port on
More informationWe divide the interval [a, b] into subintervals of equal length x = b a n
Arc Length Given curve C defined by function f(x), we wnt to find the length of this curve between nd b. We do this by using process similr to wht we did in defining the Riemnn Sum of definite integrl:
More informationAdvanced Algebra & Trigonometry Midterm Review Packet
Nme Dte Advnced Alger & Trigonometry Midterm Review Pcket The Advnced Alger & Trigonometry midterm em will test your generl knowledge of the mteril we hve covered since the eginning of the school yer.
More informationDistance And Velocity
Unit #8 - The Integrl Some problems nd solutions selected or dpted from Hughes-Hllett Clculus. Distnce And Velocity. The grph below shows the velocity, v, of n object (in meters/sec). Estimte the totl
More informationA New Statistic Feature of the Short-Time Amplitude Spectrum Values for Human s Unvoiced Pronunciation
Xiodong Zhung A ew Sttistic Feture of the Short-Time Amplitude Spectrum Vlues for Humn s Unvoiced Pronuncition IAODOG ZHUAG 1 1. Qingdo University, Electronics & Informtion College, Qingdo, 6671 CHIA Abstrct:
More informationTechnical Note: Analytical sensitivity analysis of a two parameter recursive digital baseflow separation filter
Hydrol. Erth Syst. Sci., 16, 451 455, 2012 www.hydrol-erth-syst-sci.net/16/451/2012/ doi:10.5194/hess-16-451-2012 Author(s) 2012. CC Attriution 3.0 License. Hydrology nd Erth System Sciences Technicl Note:
More informationThe Properties of Stars
10/11/010 The Properties of Strs sses Using Newton s Lw of Grvity to Determine the ss of Celestil ody ny two prticles in the universe ttrct ech other with force tht is directly proportionl to the product
More informationPhysics 201 Lab 3: Measurement of Earth s local gravitational field I Data Acquisition and Preliminary Analysis Dr. Timothy C. Black Summer I, 2018
Physics 201 Lb 3: Mesurement of Erth s locl grvittionl field I Dt Acquisition nd Preliminry Anlysis Dr. Timothy C. Blck Summer I, 2018 Theoreticl Discussion Grvity is one of the four known fundmentl forces.
More informationResources. Introduction: Binding. Resource Types. Resource Sharing. The type of a resource denotes its ability to perform different operations
Introduction: Binding Prt of 4-lecture introduction Scheduling Resource inding Are nd performnce estimtion Control unit synthesis This lecture covers Resources nd resource types Resource shring nd inding
More informationStructural Effect of Thioureas on the Detection of Chemical Warfare Agent Simulants
Structurl Effect of Thioures on the Detection of Chemicl Wrfre Agent Simulnts Seonggyun H, Minhe Lee, Hyun Ook Seo, b Sun Gu Song, Kyung-su Kim, Chn Heum Prk, Il Hee Kim, Young Dok Kim nd Chngsik Song*
More information4.6 Numerical Integration
.6 Numericl Integrtion 5.6 Numericl Integrtion Approimte definite integrl using the Trpezoidl Rule. Approimte definite integrl using Simpson s Rule. Anlze the pproimte errors in the Trpezoidl Rule nd Simpson
More informationSection 11.5 Estimation of difference of two proportions
ection.5 Estimtion of difference of two proportions As seen in estimtion of difference of two mens for nonnorml popultion bsed on lrge smple sizes, one cn use CLT in the pproximtion of the distribution
More informationThings to Memorize: A Partial List. January 27, 2017
Things to Memorize: A Prtil List Jnury 27, 2017 Chpter 2 Vectors - Bsic Fcts A vector hs mgnitude (lso clled size/length/norm) nd direction. It does not hve fixed position, so the sme vector cn e moved
More informationBridging the gap: GCSE AS Level
Bridging the gp: GCSE AS Level CONTENTS Chpter Removing rckets pge Chpter Liner equtions Chpter Simultneous equtions 8 Chpter Fctors 0 Chpter Chnge the suject of the formul Chpter 6 Solving qudrtic equtions
More informationLecture INF4350 October 12008
Biosttistics ti ti Lecture INF4350 October 12008 Anj Bråthen Kristoffersen Biomedicl Reserch Group Deprtment of informtics, UiO Gol Presenttion of dt descriptive tbles nd grphs Sensitivity, specificity,
More informationTests for the Ratio of Two Poisson Rates
Chpter 437 Tests for the Rtio of Two Poisson Rtes Introduction The Poisson probbility lw gives the probbility distribution of the number of events occurring in specified intervl of time or spce. The Poisson
More informationSudden death testing versus traditional censored life testing. A Monte-Carlo study
Control nd Cyernetics vol. 6 (7) No. Sudden deth testing versus trditionl censored life testing. A Monte-Crlo study y Ryszrd Motyk Pomernin Pedgogicl Acdemy, Chir of Computer Science nd Sttistics Arciszewskiego,
More informationLab 11 Approximate Integration
Nme Student ID # Instructor L Period Dte Due L 11 Approximte Integrtion Ojectives 1. To ecome fmilir with the right endpoint rule, the trpezoidl rule, nd Simpson's rule. 2. To compre nd contrst the properties
More information1 ELEMENTARY ALGEBRA and GEOMETRY READINESS DIAGNOSTIC TEST PRACTICE
ELEMENTARY ALGEBRA nd GEOMETRY READINESS DIAGNOSTIC TEST PRACTICE Directions: Study the exmples, work the prolems, then check your nswers t the end of ech topic. If you don t get the nswer given, check
More informationRadiation Measurements
Rdition Mesurements 43 (28) 12 131 Contents lists ville t ScienceDirect Rdition Mesurements journl homepge: www.elsevier.com/locte/rdmes Performnce of GEANT4 in dosimetry pplictions: Clcultion of X-ry
More information38 Riemann sums and existence of the definite integral.
38 Riemnn sums nd existence of the definite integrl. In the clcultion of the re of the region X bounded by the grph of g(x) = x 2, the x-xis nd 0 x b, two sums ppered: ( n (k 1) 2) b 3 n 3 re(x) ( n These
More informationChapter 6 Continuous Random Variables and Distributions
Chpter 6 Continuous Rndom Vriles nd Distriutions Mny economic nd usiness mesures such s sles investment consumption nd cost cn hve the continuous numericl vlues so tht they cn not e represented y discrete
More informationSatellite Retrieval Data Assimilation
tellite etrievl Dt Assimiltion odgers C. D. Inverse Methods for Atmospheric ounding: Theor nd Prctice World cientific Pu. Co. Hckensck N.J. 2000 Chpter 3 nd Chpter 8 Dve uhl Artist depiction of NAA terr
More informationIndustrial Electrical Engineering and Automation
CODEN:LUTEDX/(TEIE-719)/1-7/(7) Industril Electricl Engineering nd Automtion Estimtion of the Zero Sequence oltge on the D- side of Dy Trnsformer y Using One oltge Trnsformer on the D-side Frncesco Sull
More informationk ) and directrix x = h p is A focal chord is a line segment which passes through the focus of a parabola and has endpoints on the parabola.
Stndrd Eqution of Prol with vertex ( h, k ) nd directrix y = k p is ( x h) p ( y k ) = 4. Verticl xis of symmetry Stndrd Eqution of Prol with vertex ( h, k ) nd directrix x = h p is ( y k ) p( x h) = 4.
More information99/105 Comparison of OrcaFlex with standard theoretical results
99/105 Comprison of OrcFlex ith stndrd theoreticl results 1. Introduction A number of stndrd theoreticl results from literture cn be modelled in OrcFlex. Such cses re, by virtue of being theoreticlly solvble,
More informationDOI:.8/nc5 Cpilities of MCAK Sidesliding, endctching on microtuules MCAKdecorted ed Functions in mitotic spindle Prometphse Slides on the microtuule surfce + Redily slides long the microtuule surfce Strongly
More informationIntroduction to Determinants. Remarks. Remarks. The determinant applies in the case of square matrices
Introduction to Determinnts Remrks The determinnt pplies in the cse of squre mtrices squre mtrix is nonsingulr if nd only if its determinnt not zero, hence the term determinnt Nonsingulr mtrices re sometimes
More informationQuadratic Forms. Quadratic Forms
Qudrtic Forms Recll the Simon & Blume excerpt from n erlier lecture which sid tht the min tsk of clculus is to pproximte nonliner functions with liner functions. It s ctully more ccurte to sy tht we pproximte
More informationThe Minimum Label Spanning Tree Problem: Illustrating the Utility of Genetic Algorithms
The Minimum Lel Spnning Tree Prolem: Illustrting the Utility of Genetic Algorithms Yupei Xiong, Univ. of Mrylnd Bruce Golden, Univ. of Mrylnd Edwrd Wsil, Americn Univ. Presented t BAE Systems Distinguished
More informationP 1 (x 1, y 1 ) is given by,.
MA00 Clculus nd Bsic Liner Alger I Chpter Coordinte Geometr nd Conic Sections Review In the rectngulr/crtesin coordintes sstem, we descrie the loction of points using coordintes. P (, ) P(, ) O The distnce
More information