On the Inter-Generic Hybrid Sasaella ramosa. Yoshiyuki HOSOYAMA, Kazuko HOSHIDA, Sonoe TAKEOKA and Shohei MIYATA. (Received November 30, 2001)

Transcription

1 No.37 (2002) pp Sasaella ramosa On the Inter-Generic Hybrid Sasaella ramosa Yoshiyuki HOSOYAMA, Kazuko HOSHIDA, Sonoe TAKEOKA and Shohei MIYATA (Received November 30, 2001) Until several ten years ago, the genus Sasaella consisted of about 140 species. Sasaella has been believed to be an inter-generic hybrid of Sasa and Pleioblastus. Recently a taxonomist rearranged these species into ten. One of them is Sasaella ramosa. In the neighborhood of Tokyo, we have two groups growing wild in this species, named before Sasaella hannouensis and S. Sawadai. Sequencing parts of chloroplast DNA of these two groups revealed the maternal genus of the former Sasa and the latter Pleioblastus. 1. Sasa 10 Sasaella 1 SasaellaSasa Pleioblastus Sasaella Sasa megalophylla Nobilis Pleioblastus disticus Pleioblastus Simonii Heterophyllus 5 DNA Department of Chemistry, College of Humanities and Sciences, Nihon University: , Sakurajousui, Setagaya-ku Tokyo Japan 209 1

2 1 83 Sasaella Sasa Pleioblastus 3 Sasaella ramosa Sasa veitchii Pleioblastus chino Sasaella Sawadai Sasa Tokugawana Pleioblastus Chino var. vaginatus Sasa nipponica 2. 2 CTAB 6 DNA 2 Polymerase Chain Reaction PCR 1 trnl UAA 3 trnf GAA2 atp rbcl IGS PCR PCR EX Taq TaKaRa PCR QIAquick PCR Purification kit QIAGEN DNA ABI 3100 American Biochemical Instruments kbp 2 DNA 100 ORF DNA 11 2 ORF 2 Intergenic spacer, IGS trna trnl UAA 3 trnf GAA IGS

3 Sasaella ramosa Oryza sativa Sasaella Section , 2, Sasaella 2 IGS Sasaella Sasa 1km Sasa 1 2 trnl3 trnf IGS 1 atp rbcl IGS 2 IGS trnl3 trnf IGS 3 AtprbcL IGS 3 Sasa Pleioblastus 18 atprbcl IGS 4 IGS Sasaella DNA Pleioblastus,, Sasa,,,, 19 Sasaella Sasa Pleioblastus Sasa Pleioblastus 211 3

4 Sasaella 1 Makino, T (1929) : A contribution to the knowledge of the flora of Japan; Sasaella. J. Japan. Bot. 6, , , Doyle, J. J. & Doyle, J. L. (1990) : Isolation of plant DNA from fresh tissue. Focus, 12, Taberlet, P. Gielly, L. Pautou, J. & Bouvet, J. (1991) : Universal primers for amplication of three non-coding regions of chloroplast DNA. Plant Mol. Biol., 17, Shinozaki, K. & Sugiura, M. (1982) : Sequence of the intercistronic region between the riburose 1, 5-bisphosphate carboxylase/oxygenase large subunit and the coupling factor subunit gene. Nucleic Acids Res., 10, Shinozaki, K. & Sugiura, M. (1986) : Organization of chloroplast genomes. Adv. Biophys., 21, Moon, E., Kao, T.-H. & Wu, R. (1987) : Rice chloroplast DNA molecules are heterogeneous as revealed by DNA sequences of a cluster genes. Nucleic Acids Res., 15, Zurawski, G. & Clegg, M.T. (1987) : Evolution of higher plant chloroplast DNA-enclosed genes : Implications for structure-function and phylogenetic studies. Ann. Rev. Plant Physiol., 38, Fujii, N., Ueda, K., Watano, Y. & Shimizu, T. (1997) : Intraspecific sequence variation of chloroplast DNA in Peducularis chamissonis Steven Scrophulariaceae and geographic structuring of the Japanese alpine plants. J. Plant Res., 110, Fujii, N., Ueda, K., Watano, Y. & Shimizu, T. (1999) : Further analysis of intraspecific sequence variation of chloroplast DNA in Primula cuneifolia Ledeb. (Primulaceae) : Implication for biogeography of the Japanese alpine flora. J. Plant Res., 112, , Hiratsuka, J., Shimada, H., Wittier, R., Ishibashi, T., Sakamoto, M., Mori, M., Kondo, C., Honji, Y., Sun, C. R., Meng, B. Y., Li, Y. Q., Kanno, A., Nishizawa, Y., Hirai, A., Shinozaki, K. & Sugiura, M. (1989) : The complete sequence of the rice (Oryza sativa) chloroplast genome; intermolecular recombination between distinct trna genes accounts for a major plastid DNA inversion during the evolution of cereals. Mol. Gen. Genet., 217, Suzuki, S (1987) : New or noteworthy plants of Japanese Bambusaceae (5). J. Jpn. Bot., 62, Tashiro,Y., Oyama,T., Iwamoto, Y., Noda,R. & Miyazaki,S. (1995) : Identification of maternal and paternal plants of Allium wakegi Arai by RFLP analysis of chloroplast DNA. J. Jpn. Soc. Hort. Sci., 63,

5 Sasaella ramosa 1 trnl3 trnf

6 trnf 6 214

7 Sasaella ramosa 2 Atp rbcl atp rbcl 50 agtagtaggattggttctcat

8 atgtca ccacaaacag aaacta