Clustering and Network
|
|
- Garey Foster
- 5 years ago
- Views:
Transcription
1 Clustering and Network Jing-Dong Jackie Han Copy Right: Jing-Dong Jackie Han
2 What is clustering? A way of grouping together data samples that are similar in some way - according to some criteria that you pick A form of unsupervised learning you don t know before hand how the data should be grouped together So, it is a method of data exploration a way of looking for patterns or structure in the data that are of interest
3 Clustering Choosing (dis)similarity measures a critical step in clustering Euclidean distance Pearson Linear Correlation Clustering algorithms Hierarchical agglomerative clustering K-means clustering and quality measures
4 Pediatric ALL classifier Clustering 535 Caucasian gene expression profiles based on our predicted marker genes Li et al. Blood, 2009 Collaborators: Huyong Zheng. Shilai Bao
5 How do we define similarity? The similarity measure is often more important than the clustering algorithm used don t overlook this choice!
6 Euclidean distance d euc ( x, y) = n i= 1 ( x i y i 2 ) Here n is the number of dimensions in the data vector. For instance: Number of time-points/conditions (when clustering genes) Number of genes (when clustering samples)
7 d euc = d euc = d euc = These examples of Euclidean distance match our intuition of dissimilarity pretty well
8 d euc =1.41 d euc =1.22 But what about these? Magnitude vs shape
9 Correlation We might care more about the overall shape of expression profiles rather than the actual magnitudes That is, we might want to consider genes similar when they are up and down together When might we want this kind of measure? What experimental issues might make this appropriate?
10 Pearson Linear Correlation We re shifting the expression profiles down (subtracting the means) and scaling by the standard deviations (i.e., making the data have mean = 0 and std = 1) = = = = = = n i i n i i n i i n i i i n i i y n y x n x y y x x y y x x 1 1 ) ( ) ( ) )( ( ), ( y x ρ
11 Pearson Linear Correlation Pearson linear correlation (PLC) is a measure of shape similarity Always between 1 and +1 (perfectly anti-correlated and perfectly correlated) This is a similarity measure, but we can easily make it into a dissimilarity measure: d p = 1 ρ( x, y) 2
12 Hierarchical Agglomerative Clustering We start with every data point in a separate cluster We keep merging the most similar pairs of data points/clusters until we have one big cluster left This is called a bottom-up or agglomerative method
13 Hierarchical Clustering (cont.) This produces a binary tree or dendrogram The final cluster is the root and each data item is a leaf The height of the bars indicate how close the items are
14 Hierarchical Clustering Demo
15 Hierarchical Clustering Issues Distinct clusters are not produced sometimes this can be good, if the data has a hierarchical structure w/o clear boundaries There are methods for producing distinct clusters, but these usually involve specifying somewhat arbitrary cutoff values What if data doesn t have a hierarchical structure?
16 K-means Clustering Choose a number of clusters k Initialize cluster centers µ 1, µ k Could pick k data points and set cluster centers to these points Or could randomly assign points to clusters and take means of clusters For each data point, compute the cluster center it is closest to (using some distance measure) and assign the data point to this cluster Re-compute cluster centers (mean of data points in cluster) Stop when there are no new re-assignments
17 K-means Clustering (cont.) How many clusters do you think there are in this data? How might it have been generated?
18 K-means Clustering Demo
19 K-means Clustering Issues Random initialization means that you may get different clusters each time; Completely random initialization of cluster centers is not optimal. (Not taken into account the spatial distribution of data points) Implicit assumptions about the shapes of clusters; You have to pick the number of clusters
20 Super k-means choosing initial centers based on data distribution Choose first center uniformly at random Repeat until k centers: Add a new center Choose x 0 with probability D( x ) D( x) x X D( x 2 0) D(x) = distance between x and closest center
21 k-means++ Example: (k=3)
22 Example: (k=3) Choose 1 st center uniformly at random
23 k-means++ Example: D 2 = D 2 = D 2 = D 2 = (k=3) Choose 2 nd center probability proportional to D 2
24 k-means++ Example: D 2 = D 2 = D 2 = (k=3) Choose 3 rd center probability proportional to D 2
25 k-means++ Example: (k=3) Now run k- means as normal
26 Sum of squared distances (SSD) k SSD d ( X, µ ) =," " i= 1 X C i 2 i where"d"is"the"euclidean"distance"in"k2means"clustering.
27 Super k-means is better than k-means in Cluster 3.0 More compact Loose Distributions of the sum of squared Euclidean distances (SSD) from data to cluster center in 20 runs Liu et al. Cell Res, 2013.
28 De novo discovery of ovarian cancer subtypes by adaptive clustering log- rank test P = 2.96e- 07 Zhang et al. Cell Reports, 2013.
29 Networks What is a network? Why network? High-throughput component identification by comparative genomics, functional genomics and proteomics Network prediction/inference/reverse engineering Network properties and their biological relevance Network simulations
30 I. What is a network?
31 Elements of a Network Degree (k): number of edges a node has. Node Hub: a node with high degree Edge Cliquishness: clustering, triangle Characteristic path length (CPL) of a network: the average shortest path length (smallest number of hops) between any two connected nodes.
32 II. Why network?
33 Complex phenotypes are formed through molecular networks Aging, Stem cell differentiation Han, Cell Res., 2008
34 Pathways to Networks Xia et al. Unpublished Data
35 Temporal parameters of the networks Souchelnytskyi Proteomics 2005
36 Spatial parameters of the networks Tissue localizations Subcellular localizations
37 III. Construction of networks
38 High-throughput interaction identifications Protein-protein interactions post-translation Undirected:Y2H, AP-MS Directed biochemical protein modifications: 2D gels, MS and specific antibodies (α-ptypr) activating and inhibitory protein binding: protein activities, not possible for high-throughput yet Protein-DNA interactions ChIP-chip, ChIP-seq, Y1H (directed) ncrna/mirna-mrna interactions mirna array, mirna beads Genetic interactions Synthetic lethality no direction RNAi epistasis: activator, repressor -> signs Correlations between same type molecules co-expression, co-phenotype, co-localization, co-evolution
39 High-throughput omics Transcriptome Interactome Cis- trome Promoterome Integration Cell Localizome Phenome Tissue Localizome
40 Expression profiling compendium" 549 data point" ~20,000" predicted" genes" Gene 1 Parallel expression profiles: mrna increase and decrease at the same time PCC measures the level of co-expression or parallel -ness between two sets of expression profiles, it ranges from -1 to 1. Conditions Gene 2 Gene 3
41 Molecular machines in C. elegans early embryogenesis Gunsalus et al. Nature 2005
42 Data integration to generate Breast Cancer Network Pujana, Han et al. Nature Genetics, 2007
43 Breast Cancer Gene Network
44 Case study
45 Tightly regulated gene expression clusters
46 Function, gene set and transcription factor, epigenetic target enrichment GO, KEGG pathway enrichment: DAVID Gene set enrichment: GSEA Co-citation enrichment: CoCiter (can be used for your customized terms) Transcription factor target enrichment: MEME, JASPAR, HOMER, FactorBook Epigenetic factor target enrichment: HOMER
47 Transcriptionally regulated modules
48 References All of my papers are freely downloadable from my lab website
Clustering. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein. Some slides adapted from Jacques van Helden
Clustering Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Some slides adapted from Jacques van Helden Gene expression profiling A quick review Which molecular processes/functions
More informationProteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
More informationEvidence for dynamically organized modularity in the yeast protein-protein interaction network
Evidence for dynamically organized modularity in the yeast protein-protein interaction network Sari Bombino Helsinki 27.3.2007 UNIVERSITY OF HELSINKI Department of Computer Science Seminar on Computational
More informationClustering. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein. Some slides adapted from Jacques van Helden
Clustering Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Some slides adapted from Jacques van Helden Gene expression profiling A quick review Which molecular processes/functions
More informationClustering. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein. Some slides adapted from Jacques van Helden
Clustering Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Some slides adapted from Jacques van Helden Small vs. large parsimony A quick review Fitch s algorithm:
More informationIntroduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationNetwork Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai
Network Biology: Understanding the cell s functional organization Albert-László Barabási Zoltán N. Oltvai Outline: Evolutionary origin of scale-free networks Motifs, modules and hierarchical networks Network
More informationThe geneticist s questions
The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does
More informationNetwork Biology-part II
Network Biology-part II Jun Zhu, Ph. D. Professor of Genomics and Genetic Sciences Icahn Institute of Genomics and Multi-scale Biology The Tisch Cancer Institute Icahn Medical School at Mount Sinai New
More informationComplete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationBMD645. Integration of Omics
BMD645 Integration of Omics Shu-Jen Chen, Chang Gung University Dec. 11, 2009 1 Traditional Biology vs. Systems Biology Traditional biology : Single genes or proteins Systems biology: Simultaneously study
More informationProteomics Systems Biology
Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular
More informationCausal Discovery by Computer
Causal Discovery by Computer Clark Glymour Carnegie Mellon University 1 Outline 1. A century of mistakes about causation and discovery: 1. Fisher 2. Yule 3. Spearman/Thurstone 2. Search for causes is statistical
More informationClustering. Genome 373 Genomic Informatics Elhanan Borenstein. Some slides adapted from Jacques van Helden
Clustering Genome 373 Genomic Informatics Elhanan Borenstein Some slides adapted from Jacques van Helden The clustering problem The goal of gene clustering process is to partition the genes into distinct
More informationClustering & microarray technology
Clustering & microarray technology A large scale way to measure gene expression levels. Thanks to Kevin Wayne, Matt Hibbs, & SMD for a few of the slides 1 Why is expression important? Proteins Gene Expression
More informationCONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry
CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna
More informationComputational Genomics. Systems biology. Putting it together: Data integration using graphical models
02-710 Computational Genomics Systems biology Putting it together: Data integration using graphical models High throughput data So far in this class we discussed several different types of high throughput
More informationBioinformatics 2. Yeast two hybrid. Proteomics. Proteomics
GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein
More informationBiological Networks. Gavin Conant 163B ASRC
Biological Networks Gavin Conant 163B ASRC conantg@missouri.edu 882-2931 Types of Network Regulatory Protein-interaction Metabolic Signaling Co-expressing General principle Relationship between genes Gene/protein/enzyme
More informationMulti Omics Clustering. ABDBM Ron Shamir
Multi Omics Clustering ABDBM Ron Shamir 1 Outline Introduction Cluster of Clusters (COCA) icluster Nonnegative Matrix Factorization (NMF) Similarity Network Fusion (SNF) Multiple Kernel Learning (MKL)
More informationGene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein
Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest
More informationInferring Transcriptional Regulatory Networks from High-throughput Data
Inferring Transcriptional Regulatory Networks from High-throughput Data Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20
More informationData Exploration and Unsupervised Learning with Clustering
Data Exploration and Unsupervised Learning with Clustering Paul F Rodriguez,PhD San Diego Supercomputer Center Predictive Analytic Center of Excellence Clustering Idea Given a set of data can we find a
More informationWritten Exam 15 December Course name: Introduction to Systems Biology Course no
Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate
More informationUnsupervised machine learning
Chapter 9 Unsupervised machine learning Unsupervised machine learning (a.k.a. cluster analysis) is a set of methods to assign objects into clusters under a predefined distance measure when class labels
More informationIdentifying Signaling Pathways
These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony Gitter, Mark Craven, Colin Dewey Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018
More information6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008
MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationMeasuring TF-DNA interactions
Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF
More informationComputational Biology From The Perspective Of A Physical Scientist
Computational Biology From The Perspective Of A Physical Scientist Dr. Arthur Dong PP1@TUM 26 November 2013 Bioinformatics Education Curriculum Math, Physics, Computer Science (Statistics and Programming)
More informationBiological Concepts and Information Technology (Systems Biology)
Biological Concepts and Information Technology (Systems Biology) Janaina de Andréa Dernowsek Postdoctoral at Center for Information Technology Renato Archer Janaina.dernowsek@cti.gov.br Division of 3D
More informationHonors Biology Reading Guide Chapter 11
Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins
More informationLesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression
13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium
More informationData Preprocessing. Cluster Similarity
1 Cluster Similarity Similarity is most often measured with the help of a distance function. The smaller the distance, the more similar the data objects (points). A function d: M M R is a distance on M
More informationProteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?
Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains
More informationDiscovering MultipleLevels of Regulatory Networks
Discovering MultipleLevels of Regulatory Networks IAS EXTENDED WORKSHOP ON GENOMES, CELLS, AND MATHEMATICS Hong Kong, July 25, 2018 Gary D. Stormo Department of Genetics Outline of the talk 1. Transcriptional
More informationWhat is Systems Biology
What is Systems Biology 2 CBS, Department of Systems Biology 3 CBS, Department of Systems Biology Data integration In the Big Data era Combine different types of data, describing different things or the
More informationIntroduction to clustering methods for gene expression data analysis
Introduction to clustering methods for gene expression data analysis Giorgio Valentini e-mail: valentini@dsi.unimi.it Outline Levels of analysis of DNA microarray data Clustering methods for functional
More informationhsnim: Hyper Scalable Network Inference Machine for Scale-Free Protein-Protein Interaction Networks Inference
CS 229 Project Report (TR# MSB2010) Submitted 12/10/2010 hsnim: Hyper Scalable Network Inference Machine for Scale-Free Protein-Protein Interaction Networks Inference Muhammad Shoaib Sehgal Computer Science
More informationAP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide
Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get
More informationThe Research Plan. Functional Genomics Research Stream. Transcription Factors. Tuning In Is A Good Idea
Functional Genomics Research Stream The Research Plan Tuning In Is A Good Idea Research Meeting: March 23, 2010 The Road to Publication Transcription Factors Protein that binds specific DNA sequences controlling
More informationThe Role of Network Science in Biology and Medicine. Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs
The Role of Network Science in Biology and Medicine Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs Network Analysis Working Group 09.28.2017 Network-Enabled Wisdom (NEW) empirically
More informationIntroduction to clustering methods for gene expression data analysis
Introduction to clustering methods for gene expression data analysis Giorgio Valentini e-mail: valentini@dsi.unimi.it Outline Levels of analysis of DNA microarray data Clustering methods for functional
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationThe geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia
From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects)
More informationUnderstanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007
Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationApproximate inference for stochastic dynamics in large biological networks
MID-TERM REVIEW Institut Henri Poincaré, Paris 23-24 January 2014 Approximate inference for stochastic dynamics in large biological networks Ludovica Bachschmid Romano Supervisor: Prof. Manfred Opper Artificial
More informationComputational Genomics. Reconstructing dynamic regulatory networks in multiple species
02-710 Computational Genomics Reconstructing dynamic regulatory networks in multiple species Methods for reconstructing networks in cells CRH1 SLT2 SLR3 YPS3 YPS1 Amit et al Science 2009 Pe er et al Recomb
More informationBi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
More informationGene Regulation and Expression
THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.
More informationControl of Gene Expression
Control of Gene Expression Mechanisms of Gene Control Gene Control in Eukaryotes Master Genes Gene Control In Prokaryotes Epigenetics Gene Expression The overall process by which information flows from
More informationAnalysis of Biological Networks: Network Integration
Analysis of Biological Networks: Network Integration Lecturer: Roded Sharan Scribe: Yael Silberberg and Renana Miller Lecture 10. May 27, 2009 Introduction The integration of different types of networks
More informationLecture Notes for Fall Network Modeling. Ernest Fraenkel
Lecture Notes for 20.320 Fall 2012 Network Modeling Ernest Fraenkel In this lecture we will explore ways in which network models can help us to understand better biological data. We will explore how networks
More informationName: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion Rationale for using maternal ythdf2 -/- mutants as study subject To study the genetic basis of the embryonic developmental delay that we observed, we crossed fish with different
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationSelf Similar (Scale Free, Power Law) Networks (I)
Self Similar (Scale Free, Power Law) Networks (I) E6083: lecture 4 Prof. Predrag R. Jelenković Dept. of Electrical Engineering Columbia University, NY 10027, USA {predrag}@ee.columbia.edu February 7, 2007
More informationCLUe Training An Introduction to Machine Learning in R with an example from handwritten digit recognition
CLUe Training An Introduction to Machine Learning in R with an example from handwritten digit recognition Ad Feelders Universiteit Utrecht Department of Information and Computing Sciences Algorithmic Data
More informationErzsébet Ravasz Advisor: Albert-László Barabási
Hierarchical Networks Erzsébet Ravasz Advisor: Albert-László Barabási Introduction to networks How to model complex networks? Clustering and hierarchy Hierarchical organization of cellular metabolism The
More informationPredicting Protein Functions and Domain Interactions from Protein Interactions
Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput
More informationProkaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
More informationWeighted gene co-expression analysis. Yuehua Cui June 7, 2013
Weighted gene co-expression analysis Yuehua Cui June 7, 2013 Weighted gene co-expression network (WGCNA) A type of scale-free network: A scale-free network is a network whose degree distribution follows
More informationNetwork motifs in the transcriptional regulation network (of Escherichia coli):
Network motifs in the transcriptional regulation network (of Escherichia coli): Janne.Ravantti@Helsinki.Fi (disclaimer: IANASB) Contents: Transcription Networks (aka. The Very Boring Biology Part ) Network
More informationCHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
More informationBiological Systems: Open Access
Biological Systems: Open Access Biological Systems: Open Access Liu and Zheng, 2016, 5:1 http://dx.doi.org/10.4172/2329-6577.1000153 ISSN: 2329-6577 Research Article ariant Maps to Identify Coding and
More informationnetworks in molecular biology Wolfgang Huber
networks in molecular biology Wolfgang Huber networks in molecular biology Regulatory networks: components = gene products interactions = regulation of transcription, translation, phosphorylation... Metabolic
More informationCoding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall
Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall Review session 5pm Thursday, Dec. 11 GPB100 Fig. 1.13 RNA-seq Expression effects of cancer AAAAA AAAAA AAAAA Solexa sequencing counts
More informationBIOLOGY 111. CHAPTER 1: An Introduction to the Science of Life
BIOLOGY 111 CHAPTER 1: An Introduction to the Science of Life An Introduction to the Science of Life: Chapter Learning Outcomes 1.1) Describe the properties of life common to all living things. (Module
More informationClustering. Stephen Scott. CSCE 478/878 Lecture 8: Clustering. Stephen Scott. Introduction. Outline. Clustering.
1 / 19 sscott@cse.unl.edu x1 If no label information is available, can still perform unsupervised learning Looking for structural information about instance space instead of label prediction function Approaches:
More informationA transcriptome meta-analysis identifies the response of plant to stresses. Etienne Delannoy, Rim Zaag, Guillem Rigaill, Marie-Laure Martin-Magniette
A transcriptome meta-analysis identifies the response of plant to es Etienne Delannoy, Rim Zaag, Guillem Rigaill, Marie-Laure Martin-Magniette Biological context Multiple biotic and abiotic es impacting
More informationTypes of biological networks. I. Intra-cellurar networks
Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction
More informationMSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination.
Module Structure: (15 credits each) Lectures and Assessment: 50% coursework, 50% unseen examination. Module Title Module 1: Bioinformatics and structural biology as applied to drug design MEDC0075 In the
More informationA general co-expression network-based approach to gene expression analysis: comparison and applications
BMC Systems Biology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. A general co-expression
More informationGenome-wide multilevel spatial interactome model of rice
Sino-German Workshop on Multiscale Spatial Computational Systems Biology, Beijing, Oct 8-12, 2015 Genome-wide multilevel spatial interactome model of rice Ming CHEN ( 陈铭 ) mchen@zju.edu.cn College of Life
More informationLecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
More informationGene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji
Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC
More informationComputational approaches for functional genomics
Computational approaches for functional genomics Kalin Vetsigian October 31, 2001 The rapidly increasing number of completely sequenced genomes have stimulated the development of new methods for finding
More informationBIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
More information#33 - Genomics 11/09/07
BCB 444/544 Required Reading (before lecture) Lecture 33 Mon Nov 5 - Lecture 31 Phylogenetics Parsimony and ML Chp 11 - pp 142 169 Genomics Wed Nov 7 - Lecture 32 Machine Learning Fri Nov 9 - Lecture 33
More informationBioControl - Week 6, Lecture 1
BioControl - Week 6, Lecture 1 Goals of this lecture Large metabolic networks organization Design principles for small genetic modules - Rules based on gene demand - Rules based on error minimization Suggested
More informationAPGRU6L2. Control of Prokaryotic (Bacterial) Genes
APGRU6L2 Control of Prokaryotic (Bacterial) Genes 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP u if they have enough of a product, need to stop production
More informationProteomics. Areas of Interest
Introduction to BioMEMS & Medical Microdevices Proteomics and Protein Microarrays Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationREVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E
REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,
More informationAdvanced Statistical Methods: Beyond Linear Regression
Advanced Statistical Methods: Beyond Linear Regression John R. Stevens Utah State University Notes 3. Statistical Methods II Mathematics Educators Worshop 28 March 2009 1 http://www.stat.usu.edu/~jrstevens/pcmi
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationSystems biology and biological networks
Systems Biology Workshop Systems biology and biological networks Center for Biological Sequence Analysis Networks in electronics Radio kindly provided by Lazebnik, Cancer Cell, 2002 Systems Biology Workshop,
More informationCell biology traditionally identifies proteins based on their individual actions as catalysts, signaling
Lethality and centrality in protein networks Cell biology traditionally identifies proteins based on their individual actions as catalysts, signaling molecules, or building blocks of cells and microorganisms.
More informationRegulation of gene Expression in Prokaryotes & Eukaryotes
Regulation of gene Expression in Prokaryotes & Eukaryotes 1 The trp Operon Contains 5 genes coding for proteins (enzymes) required for the synthesis of the amino acid tryptophan. Also contains a promoter
More informationFine-scale dissection of functional protein network. organization by dynamic neighborhood analysis
Fine-scale dissection of functional protein network organization by dynamic neighborhood analysis Kakajan Komurov 1, Mehmet H. Gunes 2, Michael A. White 1 1 Department of Cell Biology, University of Texas
More informationFunctional Genomics Research Stream. Lecture: May 5, 2009 The Road to Publication
Functional Genomics Research Stream Lecture: May 5, 2009 The Road to Publication Final Lab Issues Lab Hours this Week: Wednesday 10 AM - 6 PM Thursday 10 AM - 6 PM One Hour Required (sign in, sign out)
More information*Equal contribution Contact: (TT) 1 Department of Biomedical Engineering, the Engineering Faculty, Tel Aviv
Supplementary of Complementary Post Transcriptional Regulatory Information is Detected by PUNCH-P and Ribosome Profiling Hadas Zur*,1, Ranen Aviner*,2, Tamir Tuller 1,3 1 Department of Biomedical Engineering,
More informationRegulation of Transcription in Eukaryotes. Nelson Saibo
Regulation of Transcription in Eukaryotes Nelson Saibo saibo@itqb.unl.pt In eukaryotes gene expression is regulated at different levels 1 - Transcription 2 Post-transcriptional modifications 3 RNA transport
More informationControlling Gene Expression
Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping
More informationBioinformatics and Computerscience
Bioinformatics and Computerscience Systems Biology Data collection Network Inference Network-based dataintegration 1. ARRAY BASED 2. NEXT-GEN SEQUENCING RNA-Seq analysis ChIP-seq Bulked segregant analysis
More informationOMICS Journals are welcoming Submissions
OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
More informationInferring Transcriptional Regulatory Networks from Gene Expression Data II
Inferring Transcriptional Regulatory Networks from Gene Expression Data II Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/5/e1602426/dc1 Supplementary Materials for In vivo mapping of tissue- and subcellular-specific proteomes in Caenorhabditis elegans The PDF file includes: Aaron
More information