Clustering and Network

Size: px
Start display at page:

Download "Clustering and Network"

Transcription

1 Clustering and Network Jing-Dong Jackie Han Copy Right: Jing-Dong Jackie Han

2 What is clustering? A way of grouping together data samples that are similar in some way - according to some criteria that you pick A form of unsupervised learning you don t know before hand how the data should be grouped together So, it is a method of data exploration a way of looking for patterns or structure in the data that are of interest

3 Clustering Choosing (dis)similarity measures a critical step in clustering Euclidean distance Pearson Linear Correlation Clustering algorithms Hierarchical agglomerative clustering K-means clustering and quality measures

4 Pediatric ALL classifier Clustering 535 Caucasian gene expression profiles based on our predicted marker genes Li et al. Blood, 2009 Collaborators: Huyong Zheng. Shilai Bao

5 How do we define similarity? The similarity measure is often more important than the clustering algorithm used don t overlook this choice!

6 Euclidean distance d euc ( x, y) = n i= 1 ( x i y i 2 ) Here n is the number of dimensions in the data vector. For instance: Number of time-points/conditions (when clustering genes) Number of genes (when clustering samples)

7 d euc = d euc = d euc = These examples of Euclidean distance match our intuition of dissimilarity pretty well

8 d euc =1.41 d euc =1.22 But what about these? Magnitude vs shape

9 Correlation We might care more about the overall shape of expression profiles rather than the actual magnitudes That is, we might want to consider genes similar when they are up and down together When might we want this kind of measure? What experimental issues might make this appropriate?

10 Pearson Linear Correlation We re shifting the expression profiles down (subtracting the means) and scaling by the standard deviations (i.e., making the data have mean = 0 and std = 1) = = = = = = n i i n i i n i i n i i i n i i y n y x n x y y x x y y x x 1 1 ) ( ) ( ) )( ( ), ( y x ρ

11 Pearson Linear Correlation Pearson linear correlation (PLC) is a measure of shape similarity Always between 1 and +1 (perfectly anti-correlated and perfectly correlated) This is a similarity measure, but we can easily make it into a dissimilarity measure: d p = 1 ρ( x, y) 2

12 Hierarchical Agglomerative Clustering We start with every data point in a separate cluster We keep merging the most similar pairs of data points/clusters until we have one big cluster left This is called a bottom-up or agglomerative method

13 Hierarchical Clustering (cont.) This produces a binary tree or dendrogram The final cluster is the root and each data item is a leaf The height of the bars indicate how close the items are

14 Hierarchical Clustering Demo

15 Hierarchical Clustering Issues Distinct clusters are not produced sometimes this can be good, if the data has a hierarchical structure w/o clear boundaries There are methods for producing distinct clusters, but these usually involve specifying somewhat arbitrary cutoff values What if data doesn t have a hierarchical structure?

16 K-means Clustering Choose a number of clusters k Initialize cluster centers µ 1, µ k Could pick k data points and set cluster centers to these points Or could randomly assign points to clusters and take means of clusters For each data point, compute the cluster center it is closest to (using some distance measure) and assign the data point to this cluster Re-compute cluster centers (mean of data points in cluster) Stop when there are no new re-assignments

17 K-means Clustering (cont.) How many clusters do you think there are in this data? How might it have been generated?

18 K-means Clustering Demo

19 K-means Clustering Issues Random initialization means that you may get different clusters each time; Completely random initialization of cluster centers is not optimal. (Not taken into account the spatial distribution of data points) Implicit assumptions about the shapes of clusters; You have to pick the number of clusters

20 Super k-means choosing initial centers based on data distribution Choose first center uniformly at random Repeat until k centers: Add a new center Choose x 0 with probability D( x ) D( x) x X D( x 2 0) D(x) = distance between x and closest center

21 k-means++ Example: (k=3)

22 Example: (k=3) Choose 1 st center uniformly at random

23 k-means++ Example: D 2 = D 2 = D 2 = D 2 = (k=3) Choose 2 nd center probability proportional to D 2

24 k-means++ Example: D 2 = D 2 = D 2 = (k=3) Choose 3 rd center probability proportional to D 2

25 k-means++ Example: (k=3) Now run k- means as normal

26 Sum of squared distances (SSD) k SSD d ( X, µ ) =," " i= 1 X C i 2 i where"d"is"the"euclidean"distance"in"k2means"clustering.

27 Super k-means is better than k-means in Cluster 3.0 More compact Loose Distributions of the sum of squared Euclidean distances (SSD) from data to cluster center in 20 runs Liu et al. Cell Res, 2013.

28 De novo discovery of ovarian cancer subtypes by adaptive clustering log- rank test P = 2.96e- 07 Zhang et al. Cell Reports, 2013.

29 Networks What is a network? Why network? High-throughput component identification by comparative genomics, functional genomics and proteomics Network prediction/inference/reverse engineering Network properties and their biological relevance Network simulations

30 I. What is a network?

31 Elements of a Network Degree (k): number of edges a node has. Node Hub: a node with high degree Edge Cliquishness: clustering, triangle Characteristic path length (CPL) of a network: the average shortest path length (smallest number of hops) between any two connected nodes.

32 II. Why network?

33 Complex phenotypes are formed through molecular networks Aging, Stem cell differentiation Han, Cell Res., 2008

34 Pathways to Networks Xia et al. Unpublished Data

35 Temporal parameters of the networks Souchelnytskyi Proteomics 2005

36 Spatial parameters of the networks Tissue localizations Subcellular localizations

37 III. Construction of networks

38 High-throughput interaction identifications Protein-protein interactions post-translation Undirected:Y2H, AP-MS Directed biochemical protein modifications: 2D gels, MS and specific antibodies (α-ptypr) activating and inhibitory protein binding: protein activities, not possible for high-throughput yet Protein-DNA interactions ChIP-chip, ChIP-seq, Y1H (directed) ncrna/mirna-mrna interactions mirna array, mirna beads Genetic interactions Synthetic lethality no direction RNAi epistasis: activator, repressor -> signs Correlations between same type molecules co-expression, co-phenotype, co-localization, co-evolution

39 High-throughput omics Transcriptome Interactome Cis- trome Promoterome Integration Cell Localizome Phenome Tissue Localizome

40 Expression profiling compendium" 549 data point" ~20,000" predicted" genes" Gene 1 Parallel expression profiles: mrna increase and decrease at the same time PCC measures the level of co-expression or parallel -ness between two sets of expression profiles, it ranges from -1 to 1. Conditions Gene 2 Gene 3

41 Molecular machines in C. elegans early embryogenesis Gunsalus et al. Nature 2005

42 Data integration to generate Breast Cancer Network Pujana, Han et al. Nature Genetics, 2007

43 Breast Cancer Gene Network

44 Case study

45 Tightly regulated gene expression clusters

46 Function, gene set and transcription factor, epigenetic target enrichment GO, KEGG pathway enrichment: DAVID Gene set enrichment: GSEA Co-citation enrichment: CoCiter (can be used for your customized terms) Transcription factor target enrichment: MEME, JASPAR, HOMER, FactorBook Epigenetic factor target enrichment: HOMER

47 Transcriptionally regulated modules

48 References All of my papers are freely downloadable from my lab website

Clustering. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein. Some slides adapted from Jacques van Helden

Clustering. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein. Some slides adapted from Jacques van Helden Clustering Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Some slides adapted from Jacques van Helden Gene expression profiling A quick review Which molecular processes/functions

More information

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering

Proteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing

More information

Evidence for dynamically organized modularity in the yeast protein-protein interaction network

Evidence for dynamically organized modularity in the yeast protein-protein interaction network Evidence for dynamically organized modularity in the yeast protein-protein interaction network Sari Bombino Helsinki 27.3.2007 UNIVERSITY OF HELSINKI Department of Computer Science Seminar on Computational

More information

Clustering. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein. Some slides adapted from Jacques van Helden

Clustering. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein. Some slides adapted from Jacques van Helden Clustering Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Some slides adapted from Jacques van Helden Gene expression profiling A quick review Which molecular processes/functions

More information

Clustering. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein. Some slides adapted from Jacques van Helden

Clustering. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein. Some slides adapted from Jacques van Helden Clustering Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Some slides adapted from Jacques van Helden Small vs. large parsimony A quick review Fitch s algorithm:

More information

Introduction to Bioinformatics

Introduction to Bioinformatics CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics

More information

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

Chapter 15 Active Reading Guide Regulation of Gene Expression

Chapter 15 Active Reading Guide Regulation of Gene Expression Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,

More information

Network Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai

Network Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai Network Biology: Understanding the cell s functional organization Albert-László Barabási Zoltán N. Oltvai Outline: Evolutionary origin of scale-free networks Motifs, modules and hierarchical networks Network

More information

The geneticist s questions

The geneticist s questions The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does

More information

Network Biology-part II

Network Biology-part II Network Biology-part II Jun Zhu, Ph. D. Professor of Genomics and Genetic Sciences Icahn Institute of Genomics and Multi-scale Biology The Tisch Cancer Institute Icahn Medical School at Mount Sinai New

More information

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

BMD645. Integration of Omics

BMD645. Integration of Omics BMD645 Integration of Omics Shu-Jen Chen, Chang Gung University Dec. 11, 2009 1 Traditional Biology vs. Systems Biology Traditional biology : Single genes or proteins Systems biology: Simultaneously study

More information

Proteomics Systems Biology

Proteomics Systems Biology Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular

More information

Causal Discovery by Computer

Causal Discovery by Computer Causal Discovery by Computer Clark Glymour Carnegie Mellon University 1 Outline 1. A century of mistakes about causation and discovery: 1. Fisher 2. Yule 3. Spearman/Thurstone 2. Search for causes is statistical

More information

Clustering. Genome 373 Genomic Informatics Elhanan Borenstein. Some slides adapted from Jacques van Helden

Clustering. Genome 373 Genomic Informatics Elhanan Borenstein. Some slides adapted from Jacques van Helden Clustering Genome 373 Genomic Informatics Elhanan Borenstein Some slides adapted from Jacques van Helden The clustering problem The goal of gene clustering process is to partition the genes into distinct

More information

Clustering & microarray technology

Clustering & microarray technology Clustering & microarray technology A large scale way to measure gene expression levels. Thanks to Kevin Wayne, Matt Hibbs, & SMD for a few of the slides 1 Why is expression important? Proteins Gene Expression

More information

CONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry

CONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna

More information

Computational Genomics. Systems biology. Putting it together: Data integration using graphical models

Computational Genomics. Systems biology. Putting it together: Data integration using graphical models 02-710 Computational Genomics Systems biology Putting it together: Data integration using graphical models High throughput data So far in this class we discussed several different types of high throughput

More information

Bioinformatics 2. Yeast two hybrid. Proteomics. Proteomics

Bioinformatics 2. Yeast two hybrid. Proteomics. Proteomics GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein

More information

Biological Networks. Gavin Conant 163B ASRC

Biological Networks. Gavin Conant 163B ASRC Biological Networks Gavin Conant 163B ASRC conantg@missouri.edu 882-2931 Types of Network Regulatory Protein-interaction Metabolic Signaling Co-expressing General principle Relationship between genes Gene/protein/enzyme

More information

Multi Omics Clustering. ABDBM Ron Shamir

Multi Omics Clustering. ABDBM Ron Shamir Multi Omics Clustering ABDBM Ron Shamir 1 Outline Introduction Cluster of Clusters (COCA) icluster Nonnegative Matrix Factorization (NMF) Similarity Network Fusion (SNF) Multiple Kernel Learning (MKL)

More information

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest

More information

Inferring Transcriptional Regulatory Networks from High-throughput Data

Inferring Transcriptional Regulatory Networks from High-throughput Data Inferring Transcriptional Regulatory Networks from High-throughput Data Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20

More information

Data Exploration and Unsupervised Learning with Clustering

Data Exploration and Unsupervised Learning with Clustering Data Exploration and Unsupervised Learning with Clustering Paul F Rodriguez,PhD San Diego Supercomputer Center Predictive Analytic Center of Excellence Clustering Idea Given a set of data can we find a

More information

Written Exam 15 December Course name: Introduction to Systems Biology Course no

Written Exam 15 December Course name: Introduction to Systems Biology Course no Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate

More information

Unsupervised machine learning

Unsupervised machine learning Chapter 9 Unsupervised machine learning Unsupervised machine learning (a.k.a. cluster analysis) is a set of methods to assign objects into clusters under a predefined distance measure when class labels

More information

Identifying Signaling Pathways

Identifying Signaling Pathways These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony Gitter, Mark Craven, Colin Dewey Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018

More information

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008 MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

Measuring TF-DNA interactions

Measuring TF-DNA interactions Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF

More information

Computational Biology From The Perspective Of A Physical Scientist

Computational Biology From The Perspective Of A Physical Scientist Computational Biology From The Perspective Of A Physical Scientist Dr. Arthur Dong PP1@TUM 26 November 2013 Bioinformatics Education Curriculum Math, Physics, Computer Science (Statistics and Programming)

More information

Biological Concepts and Information Technology (Systems Biology)

Biological Concepts and Information Technology (Systems Biology) Biological Concepts and Information Technology (Systems Biology) Janaina de Andréa Dernowsek Postdoctoral at Center for Information Technology Renato Archer Janaina.dernowsek@cti.gov.br Division of 3D

More information

Honors Biology Reading Guide Chapter 11

Honors Biology Reading Guide Chapter 11 Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins

More information

Lesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression

Lesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression 13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium

More information

Data Preprocessing. Cluster Similarity

Data Preprocessing. Cluster Similarity 1 Cluster Similarity Similarity is most often measured with the help of a distance function. The smaller the distance, the more similar the data objects (points). A function d: M M R is a distance on M

More information

Proteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?

Proteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it? Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains

More information

Discovering MultipleLevels of Regulatory Networks

Discovering MultipleLevels of Regulatory Networks Discovering MultipleLevels of Regulatory Networks IAS EXTENDED WORKSHOP ON GENOMES, CELLS, AND MATHEMATICS Hong Kong, July 25, 2018 Gary D. Stormo Department of Genetics Outline of the talk 1. Transcriptional

More information

What is Systems Biology

What is Systems Biology What is Systems Biology 2 CBS, Department of Systems Biology 3 CBS, Department of Systems Biology Data integration In the Big Data era Combine different types of data, describing different things or the

More information

Introduction to clustering methods for gene expression data analysis

Introduction to clustering methods for gene expression data analysis Introduction to clustering methods for gene expression data analysis Giorgio Valentini e-mail: valentini@dsi.unimi.it Outline Levels of analysis of DNA microarray data Clustering methods for functional

More information

hsnim: Hyper Scalable Network Inference Machine for Scale-Free Protein-Protein Interaction Networks Inference

hsnim: Hyper Scalable Network Inference Machine for Scale-Free Protein-Protein Interaction Networks Inference CS 229 Project Report (TR# MSB2010) Submitted 12/10/2010 hsnim: Hyper Scalable Network Inference Machine for Scale-Free Protein-Protein Interaction Networks Inference Muhammad Shoaib Sehgal Computer Science

More information

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get

More information

The Research Plan. Functional Genomics Research Stream. Transcription Factors. Tuning In Is A Good Idea

The Research Plan. Functional Genomics Research Stream. Transcription Factors. Tuning In Is A Good Idea Functional Genomics Research Stream The Research Plan Tuning In Is A Good Idea Research Meeting: March 23, 2010 The Road to Publication Transcription Factors Protein that binds specific DNA sequences controlling

More information

The Role of Network Science in Biology and Medicine. Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs

The Role of Network Science in Biology and Medicine. Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs The Role of Network Science in Biology and Medicine Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs Network Analysis Working Group 09.28.2017 Network-Enabled Wisdom (NEW) empirically

More information

Introduction to clustering methods for gene expression data analysis

Introduction to clustering methods for gene expression data analysis Introduction to clustering methods for gene expression data analysis Giorgio Valentini e-mail: valentini@dsi.unimi.it Outline Levels of analysis of DNA microarray data Clustering methods for functional

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

The geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia

The geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects)

More information

Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007

Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007 Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.

More information

Bioinformatics. Dept. of Computational Biology & Bioinformatics

Bioinformatics. Dept. of Computational Biology & Bioinformatics Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS

More information

Approximate inference for stochastic dynamics in large biological networks

Approximate inference for stochastic dynamics in large biological networks MID-TERM REVIEW Institut Henri Poincaré, Paris 23-24 January 2014 Approximate inference for stochastic dynamics in large biological networks Ludovica Bachschmid Romano Supervisor: Prof. Manfred Opper Artificial

More information

Computational Genomics. Reconstructing dynamic regulatory networks in multiple species

Computational Genomics. Reconstructing dynamic regulatory networks in multiple species 02-710 Computational Genomics Reconstructing dynamic regulatory networks in multiple species Methods for reconstructing networks in cells CRH1 SLT2 SLR3 YPS3 YPS1 Amit et al Science 2009 Pe er et al Recomb

More information

Bi 1x Spring 2014: LacI Titration

Bi 1x Spring 2014: LacI Titration Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a

More information

Gene Regulation and Expression

Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression Mechanisms of Gene Control Gene Control in Eukaryotes Master Genes Gene Control In Prokaryotes Epigenetics Gene Expression The overall process by which information flows from

More information

Analysis of Biological Networks: Network Integration

Analysis of Biological Networks: Network Integration Analysis of Biological Networks: Network Integration Lecturer: Roded Sharan Scribe: Yael Silberberg and Renana Miller Lecture 10. May 27, 2009 Introduction The integration of different types of networks

More information

Lecture Notes for Fall Network Modeling. Ernest Fraenkel

Lecture Notes for Fall Network Modeling. Ernest Fraenkel Lecture Notes for 20.320 Fall 2012 Network Modeling Ernest Fraenkel In this lecture we will explore ways in which network models can help us to understand better biological data. We will explore how networks

More information

Name: SBI 4U. Gene Expression Quiz. Overall Expectation:

Name: SBI 4U. Gene Expression Quiz. Overall Expectation: Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Discussion Rationale for using maternal ythdf2 -/- mutants as study subject To study the genetic basis of the embryonic developmental delay that we observed, we crossed fish with different

More information

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison 10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:

More information

Self Similar (Scale Free, Power Law) Networks (I)

Self Similar (Scale Free, Power Law) Networks (I) Self Similar (Scale Free, Power Law) Networks (I) E6083: lecture 4 Prof. Predrag R. Jelenković Dept. of Electrical Engineering Columbia University, NY 10027, USA {predrag}@ee.columbia.edu February 7, 2007

More information

CLUe Training An Introduction to Machine Learning in R with an example from handwritten digit recognition

CLUe Training An Introduction to Machine Learning in R with an example from handwritten digit recognition CLUe Training An Introduction to Machine Learning in R with an example from handwritten digit recognition Ad Feelders Universiteit Utrecht Department of Information and Computing Sciences Algorithmic Data

More information

Erzsébet Ravasz Advisor: Albert-László Barabási

Erzsébet Ravasz Advisor: Albert-László Barabási Hierarchical Networks Erzsébet Ravasz Advisor: Albert-László Barabási Introduction to networks How to model complex networks? Clustering and hierarchy Hierarchical organization of cellular metabolism The

More information

Predicting Protein Functions and Domain Interactions from Protein Interactions

Predicting Protein Functions and Domain Interactions from Protein Interactions Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput

More information

Prokaryotic Gene Expression (Learning Objectives)

Prokaryotic Gene Expression (Learning Objectives) Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control

More information

Weighted gene co-expression analysis. Yuehua Cui June 7, 2013

Weighted gene co-expression analysis. Yuehua Cui June 7, 2013 Weighted gene co-expression analysis Yuehua Cui June 7, 2013 Weighted gene co-expression network (WGCNA) A type of scale-free network: A scale-free network is a network whose degree distribution follows

More information

Network motifs in the transcriptional regulation network (of Escherichia coli):

Network motifs in the transcriptional regulation network (of Escherichia coli): Network motifs in the transcriptional regulation network (of Escherichia coli): Janne.Ravantti@Helsinki.Fi (disclaimer: IANASB) Contents: Transcription Networks (aka. The Very Boring Biology Part ) Network

More information

CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON

CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter

More information

Biological Systems: Open Access

Biological Systems: Open Access Biological Systems: Open Access Biological Systems: Open Access Liu and Zheng, 2016, 5:1 http://dx.doi.org/10.4172/2329-6577.1000153 ISSN: 2329-6577 Research Article ariant Maps to Identify Coding and

More information

networks in molecular biology Wolfgang Huber

networks in molecular biology Wolfgang Huber networks in molecular biology Wolfgang Huber networks in molecular biology Regulatory networks: components = gene products interactions = regulation of transcription, translation, phosphorylation... Metabolic

More information

Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall

Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall Coding sequence array Office hours Wednesday 3-4pm 304A Stanley Hall Review session 5pm Thursday, Dec. 11 GPB100 Fig. 1.13 RNA-seq Expression effects of cancer AAAAA AAAAA AAAAA Solexa sequencing counts

More information

BIOLOGY 111. CHAPTER 1: An Introduction to the Science of Life

BIOLOGY 111. CHAPTER 1: An Introduction to the Science of Life BIOLOGY 111 CHAPTER 1: An Introduction to the Science of Life An Introduction to the Science of Life: Chapter Learning Outcomes 1.1) Describe the properties of life common to all living things. (Module

More information

Clustering. Stephen Scott. CSCE 478/878 Lecture 8: Clustering. Stephen Scott. Introduction. Outline. Clustering.

Clustering. Stephen Scott. CSCE 478/878 Lecture 8: Clustering. Stephen Scott. Introduction. Outline. Clustering. 1 / 19 sscott@cse.unl.edu x1 If no label information is available, can still perform unsupervised learning Looking for structural information about instance space instead of label prediction function Approaches:

More information

A transcriptome meta-analysis identifies the response of plant to stresses. Etienne Delannoy, Rim Zaag, Guillem Rigaill, Marie-Laure Martin-Magniette

A transcriptome meta-analysis identifies the response of plant to stresses. Etienne Delannoy, Rim Zaag, Guillem Rigaill, Marie-Laure Martin-Magniette A transcriptome meta-analysis identifies the response of plant to es Etienne Delannoy, Rim Zaag, Guillem Rigaill, Marie-Laure Martin-Magniette Biological context Multiple biotic and abiotic es impacting

More information

Types of biological networks. I. Intra-cellurar networks

Types of biological networks. I. Intra-cellurar networks Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction

More information

MSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination.

MSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination. Module Structure: (15 credits each) Lectures and Assessment: 50% coursework, 50% unseen examination. Module Title Module 1: Bioinformatics and structural biology as applied to drug design MEDC0075 In the

More information

A general co-expression network-based approach to gene expression analysis: comparison and applications

A general co-expression network-based approach to gene expression analysis: comparison and applications BMC Systems Biology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. A general co-expression

More information

Genome-wide multilevel spatial interactome model of rice

Genome-wide multilevel spatial interactome model of rice Sino-German Workshop on Multiscale Spatial Computational Systems Biology, Beijing, Oct 8-12, 2015 Genome-wide multilevel spatial interactome model of rice Ming CHEN ( 陈铭 ) mchen@zju.edu.cn College of Life

More information

Lecture 18 June 2 nd, Gene Expression Regulation Mutations

Lecture 18 June 2 nd, Gene Expression Regulation Mutations Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase

More information

Gene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji

Gene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC

More information

Computational approaches for functional genomics

Computational approaches for functional genomics Computational approaches for functional genomics Kalin Vetsigian October 31, 2001 The rapidly increasing number of completely sequenced genomes have stimulated the development of new methods for finding

More information

BIOINFORMATICS LAB AP BIOLOGY

BIOINFORMATICS LAB AP BIOLOGY BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to

More information

#33 - Genomics 11/09/07

#33 - Genomics 11/09/07 BCB 444/544 Required Reading (before lecture) Lecture 33 Mon Nov 5 - Lecture 31 Phylogenetics Parsimony and ML Chp 11 - pp 142 169 Genomics Wed Nov 7 - Lecture 32 Machine Learning Fri Nov 9 - Lecture 33

More information

BioControl - Week 6, Lecture 1

BioControl - Week 6, Lecture 1 BioControl - Week 6, Lecture 1 Goals of this lecture Large metabolic networks organization Design principles for small genetic modules - Rules based on gene demand - Rules based on error minimization Suggested

More information

APGRU6L2. Control of Prokaryotic (Bacterial) Genes

APGRU6L2. Control of Prokaryotic (Bacterial) Genes APGRU6L2 Control of Prokaryotic (Bacterial) Genes 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP u if they have enough of a product, need to stop production

More information

Proteomics. Areas of Interest

Proteomics. Areas of Interest Introduction to BioMEMS & Medical Microdevices Proteomics and Protein Microarrays Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E

REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,

More information

Advanced Statistical Methods: Beyond Linear Regression

Advanced Statistical Methods: Beyond Linear Regression Advanced Statistical Methods: Beyond Linear Regression John R. Stevens Utah State University Notes 3. Statistical Methods II Mathematics Educators Worshop 28 March 2009 1 http://www.stat.usu.edu/~jrstevens/pcmi

More information

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail

More information

Systems biology and biological networks

Systems biology and biological networks Systems Biology Workshop Systems biology and biological networks Center for Biological Sequence Analysis Networks in electronics Radio kindly provided by Lazebnik, Cancer Cell, 2002 Systems Biology Workshop,

More information

Cell biology traditionally identifies proteins based on their individual actions as catalysts, signaling

Cell biology traditionally identifies proteins based on their individual actions as catalysts, signaling Lethality and centrality in protein networks Cell biology traditionally identifies proteins based on their individual actions as catalysts, signaling molecules, or building blocks of cells and microorganisms.

More information

Regulation of gene Expression in Prokaryotes & Eukaryotes

Regulation of gene Expression in Prokaryotes & Eukaryotes Regulation of gene Expression in Prokaryotes & Eukaryotes 1 The trp Operon Contains 5 genes coding for proteins (enzymes) required for the synthesis of the amino acid tryptophan. Also contains a promoter

More information

Fine-scale dissection of functional protein network. organization by dynamic neighborhood analysis

Fine-scale dissection of functional protein network. organization by dynamic neighborhood analysis Fine-scale dissection of functional protein network organization by dynamic neighborhood analysis Kakajan Komurov 1, Mehmet H. Gunes 2, Michael A. White 1 1 Department of Cell Biology, University of Texas

More information

Functional Genomics Research Stream. Lecture: May 5, 2009 The Road to Publication

Functional Genomics Research Stream. Lecture: May 5, 2009 The Road to Publication Functional Genomics Research Stream Lecture: May 5, 2009 The Road to Publication Final Lab Issues Lab Hours this Week: Wednesday 10 AM - 6 PM Thursday 10 AM - 6 PM One Hour Required (sign in, sign out)

More information

*Equal contribution Contact: (TT) 1 Department of Biomedical Engineering, the Engineering Faculty, Tel Aviv

*Equal contribution Contact: (TT) 1 Department of Biomedical Engineering, the Engineering Faculty, Tel Aviv Supplementary of Complementary Post Transcriptional Regulatory Information is Detected by PUNCH-P and Ribosome Profiling Hadas Zur*,1, Ranen Aviner*,2, Tamir Tuller 1,3 1 Department of Biomedical Engineering,

More information

Regulation of Transcription in Eukaryotes. Nelson Saibo

Regulation of Transcription in Eukaryotes. Nelson Saibo Regulation of Transcription in Eukaryotes Nelson Saibo saibo@itqb.unl.pt In eukaryotes gene expression is regulated at different levels 1 - Transcription 2 Post-transcriptional modifications 3 RNA transport

More information

Controlling Gene Expression

Controlling Gene Expression Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping

More information

Bioinformatics and Computerscience

Bioinformatics and Computerscience Bioinformatics and Computerscience Systems Biology Data collection Network Inference Network-based dataintegration 1. ARRAY BASED 2. NEXT-GEN SEQUENCING RNA-Seq analysis ChIP-seq Bulked segregant analysis

More information

OMICS Journals are welcoming Submissions

OMICS Journals are welcoming Submissions OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible

More information

Inferring Transcriptional Regulatory Networks from Gene Expression Data II

Inferring Transcriptional Regulatory Networks from Gene Expression Data II Inferring Transcriptional Regulatory Networks from Gene Expression Data II Lectures 9 Oct 26, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/5/e1602426/dc1 Supplementary Materials for In vivo mapping of tissue- and subcellular-specific proteomes in Caenorhabditis elegans The PDF file includes: Aaron

More information