Proteomics Systems Biology
|
|
- Scarlett Foster
- 5 years ago
- Views:
Transcription
1 Dr. Sanjeeva Srivastava IIT Bombay Proteomics Systems Biology IIT Bombay 2 1
2 DNA Genomics RNA Transcriptomics Global Cellular Protein Proteomics Global Cellular Metabolite Metabolomics Global Cellular IIT Bombay 3 IIT Bombay 4 2
3 Proteome: set of all the PROTEins expressed by a genome Proteomics: study of full set of proteins encoded by a genome for their expression, localization, interaction and post-translational modifications IIT Bombay 5 IIT Bombay 6 3
4 Gel- based methods Gel- free MS Mass Spectrometry Interactomics Structural Proteomics IIT Bombay 7 Mass Spectrometry Tissue Biopsy Blood Sample Cell P P P P P P 2DE P P P P Microarray Chip Pattern Recognition, Learning Algorithm Proteomic Image Monitor therapy Early disease diagnosis IIT Bombay 8 4
5 IIT Bombay 9 Examination of a biological entity as an integrated system, rather than study of its individual characteristic reactions and components IIT Bombay 10 5
6 System level understanding of biological networks Common elements of systems biology Networks Modeling Computation Dynamic properties DNA Protein Systems Human RNA IIT Bombay 11 DNA RNA Other Biomolecules Proteins Networks Cells IIT Bombay 12 6
7 Protein-protein interaction networks Gene regulatory networks Protein-DNA interaction networks Protein-lipid interactions Metabolic networks IIT Bombay 13 Cell Genome Protein Profile & mrna profile Transcriptional Network Signalling Networks Metabolic Networks Protein Localisation IIT Bombay 14 7
8 Respiratory Intercellular Intracellular Molecular Nervous Intercellular Intracellular Molecular Gastrointestinal Intercellular Intracellular Molecular Cardiovascular Intercellular Intracellular Molecular Molecular Intercellular Intracellular Reproductive Development Immune Intercellular Intracellular Molecular IIT Bombay 15 IPG strip Intracellular signalling Transcrip;on Factors Nucleus Gene4c Regulatory Network Cis sites mrna Receptors Transla;on + Processing Cytoplasm Ligands Ion Channels Electrophysiology Extracellular Space IIT Bombay 16 8
9 Understanding biology in holistic rather than the reductionist approach Quantitate the qualitative biological data To make biology a predictive science IIT Bombay 17 Systems biology involves: Experimental data set collection Mathematical models IIT Bombay 18 9
10 IPG strip Model Analysis Experiment Model Construction IIT Bombay 19 IIT Bombay 20 10
11 Systems Biology Model-based Prior information implemented Computation modeling and simulation tools Data-based Finding new phenomena Datasets ( omic ) IIT Bombay 21 IPG strip DNA Protein Product DNA binding protein Lipoprotein IIT Bombay 22 11
12 Reductionist Approach: Disintegrating the system into its component parts and studying them SYSTEMS PARTS Reductionist Approach IIT Bombay 23 Integrative Approach: Integrating the study of individual components to form conclusions about system SYSTEMS Integrative Approach PARTS IIT Bombay 24 12
13 IIT Bombay 25 IPG strip Large Scale Organization Functional Modules Regulatory Motifs Metabolic Pathways Genes mrna Proteins Metabolites Information Storage Processing Execution IIT Bombay 26 13
14 IPG strip Genomic Sequences Cytosol Nucleus Intracellular signals TFs RNA Proteins Cellular processes Cis Binding Activities Expression Profiles IIT Bombay 27 Extraction and mining of complex & quantitative biological data Integration and analysis of data for development of mechanistic, mathematical & computational models Validation of models by refining and re-testing IIT Bombay 28 14
15 EXPERIMENT COMPUTATIONAL MODELLING a12 a23 TECHNOLOGY x1 x2 x3 y1 a21 y2 y3 THEORY IIT Bombay 29 Wet-lab experiments or bioinformatics Propose a model Model Validation a12 a23 x1 x2 x3 y1 a21 y2 y3 a12 a23 x1 x2 x3 y1 a21 y2 y3 IIT Bombay 30 15
16 IPG strip IIT Bombay 31 Systems Sciences Systems Study Life Sciences Information Sciences IIT Bombay 32 16
17 IIT Bombay 33 HT-DNA sequencing, SNPs Microarrays, SAGE, RNA-Seq MS, 2D-PAGE, Protein chips, Yeast-2-hybrid NMR, X-ray IIT Bombay 34 17
18 IPG strip Phenome Metabolome Proteome Transcriptome Genome IIT Bombay 35 IIT Bombay 36 18
19 REAL SYSTEM BIOINFORMATICS PARTS LIST SYSTEMS BIOLOGY SYSTEM/SUBSYSTEM MODEL SYSTEMS BIOLOGY Closing the Loop SYSTEM MODEL ANALYSIS IIT Bombay 37 Level 1 Level 4 Nucleus Gene DNA RNA Metabolism Protein Level 2 Level
20 Curation of InterPro & Member Databases Recursive database search Initial Alignment Expanded Alignment Predictive Model a12 a23 x1 x2 x3 Protein sequence Method Scan Protein Domain Classification Ran BP1 InterProScan Annotation Look-Up EVH1 Literature Curation GO terms User Query Cached Results y1 a21 y2 y3 InterPro entry IIT Bombay 39 Quantitative Models Systematic Experiments Model Reaction Models Mechanistic Models Statistical Models Stochastic Models Modify Molecular Genetics Chemical Genetics Cell Engineering Mine BioInformatics Databases Data Semantics Measure Arrays Spectroscopy Imaging Microfluidics IIT Bombay 40 20
21 Biological System Model Experiment Simulation Experimental data Simulated data Experimental data intermediate statistics Simulated data intermediate statistics COMPARISON IIT Bombay 41 Ordinary Differential Equations (ODE): mathematical relation that can be used for modeling biological systems Stochiometric model: modeling a biological network based on its stochiometric coefficients, reaction rates and metabolite concentrations IIT Bombay 42 21
22 Dr. Sarath Chandra Janga Indiana University & Purdue University Indianapolis (IUPUI) IIT Bombay 43 An example Central Dogma of Molecular Biology Transcription is regulated by a class of proteins called transcription factors that bind DNA and affect expression of the nearby genes arac AraC AraC AraC CRP AraC AraC σs arabad melr MelR MelR MelR CRP MelR MelR σs melab 22
23 Networks in Biology Network Protein Interaction Metabolic Transcriptional Nodes Proteins Metabolites Transcription factor Target genes Links Physical Interaction Enzymatic conversion Transcriptional Interaction Interaction Protein-Protein Protein-Metabolite Protein-DNA A A A A B B B B Graphs are objects, which are made of nodes and edges Graph a collection of nodes and links Nodes represent entities Links represent interactions between entities Graphs can be directed or undirected Undirected Directed 23
24 Graph Parameters Degree or connectivity Path length Clustering coefficient Degree of a node in a graph Undirected Degree or connectivity Degree = 2 Directed Degree of a node tells us how many links the node has to other nodes in a graph In-degree = 1 Out-degree = 3 24
25 Path length between two nodes in a graph Path length Undirected Path length = 1 Directed Path length is the shortest number of links needed to connect two nodes in a graph Path length = 2 Clustering coefficient of a node in a graph Clustering coefficient CC = 2 x M N x (N 1) N, neighbors of a node M, links between neighbors of a node CC = Clustering coefficient tells us how interconnected are the neighbors of a give node # links among neighbors # all possible links among neighbors N=3, M=0 CC=0 N=3, M=2 CC=0.66 N=3, M=3 CC=1 25
26 Transcriptional networks are scale-free Scale-free structure Presence of few nodes with many links and many nodes with few links Power law distribution N (k) α 1 k γ Scale free structure provides robustness to the system Scale-free networks exhibit robustness Robustness The ability of complex systems to maintain their function even when the structure of the system changes significantly Tolerant to random removal of nodes (mutations) Vulnerable to targeted attack of hubs (mutations) Drug targets Hubs are crucial components in such networks 26
27 INPUT signal A Genomic View- Gene Regulatory Network INPUT signal B Sensor proteins Sensor proteins Inactive TF A active TF A Inactive TF B Confirmational change active TF B Feedback OUTPUT OUTPUT mrna protein DNA gene B Legend, Transcription Factors (TFs) RNA polymerase, TF binding sites Transcription Start Site +1 Cis-regulatory DNA sequence elements target gene A Janga & Collado-Vides 2007, Res. in Microbiology Structure of the transcriptional regulatory network Transcription factor Target gene Basic unit (Components) transcriptional interaction Motifs (Local level) patterns of Interconnections Scale free hierarchical network (Global level) all transcriptional interactions in a cell Janga & Collado-Vides 2007, Res. in Microbiology 27
28 Gene regulation beyond transcription Gene regula4on is a highly regulated and complex process Gene regula4on takes place at several steps Transcrip;onal Post- transcrip;onal Diverse functions of RNA-Binding Proteins (RBPs) 4 40S 60S RNA stability RBP RBP Transla;onal control 5 Degrada;on Protein 2 Cytoplasm Transport 3 Localiza;on RBP 1 RBP Splicing Gene Transcrip;on RBP Nucleus Pre mrna Intron mrna Mitochondria Mittal et al., 2009 PNAS 28
29 A network of RBPs in human diseases Change in the expression dynamics of RBPs is associated with several diseases Networks in drug discovery settings Healthy state Disease state Drug space Network Pharmacology Magic Bullet LeChatelier s Principle in Network Pharmacology Cellular Interactome Janga SC. & Tzakos A. Molecular Biosystems
30 Integration of data for understanding system-wide perturbations Janga SC. & Tzakos A. Molecular Biosystems 2009 What network pharmacology offers? Target protein Drug molecule Drugs sharing targets are linked Targets sharing drugs are linked Diseases sharing drugs are linked Diseases sharing targets are linked Disease Janga SC. & Tzakos A. Molecular Biosystems
31 Conclusion Network-based approaches are essential for dissecting the design principles of biological systems They play an important role in biomarker identification and elucidation of key players responsible for the disease phenotype. Systems medicine can lead to the development of personalized medical treatment options in years to come with developments in highthroughput sequencing and other technologies. IIT Bombay 62 31
32 Genomics Proteomics Systems Biology IIT Bombay 63 Genome- wide data sets Expression Protein Interac;on Validated Networks, Therapeu;c Targets Experimental Valida;on IIT Bombay 64 32
33 IPG strip Biology Medicine SYSTEMS BIOLOGY Engineering Computer Science IIT Bombay 65 IPG strip Systems Biology Physiology and medicine IIT Bombay 66 33
34 Systems biology is extremely challenging Understanding dynamics of biological networks requires modeling, simulation and understanding of biology Requires mathematical & statistical approaches IIT Bombay 67 Proteomics is useful to understand complex signaling networks in biological systems Proteomics is indispensable for systems biology IIT Bombay 68 34
35 Proteomics Systems biology IIT Bombay 69 Systems Biology: A Brief Overview, Hiroaki Kitano,, 1662 (2002); 295 Science Simpson R. J. Proteins and Proteomics: a laboratory manual ed., Cold Spring Harbor laboratory press, ISBN: Trey Ideker, L. Raimond Winslow, A. Douglas Lauffenburger. Bioengineering and Systems Biology. Annals of Biomedical Engineering. February 2006, Volume 34, Issue 2, pp Trey Ideker, et al., Integrated Genomic and Proteomic Analyses of a systematically Perturbed Metabolic Network, Science, Sarath Chandra Janga and Julio Collado-Vides. Structure and evolution of gene regulatory networks in microbial genomes. Research in Microbiology, (10): IIT Bombay 35
36 Mittal N, Roy N, Babu MM, Janga SC. Dissecting the expression dynamics of RNA-binding proteins in posttranscriptional regulatory networks. Proc Natl Acad Sci U S A Dec 1;106(48): Sarath Chandra Janga and Andreas Tzakos. Structure and organization of drug-target networks : Insights from genomic approaches for drug discovery. Molecular Biosystems, 2009, 5 (12): Ernesto Perez-Rueda, Sarath Chandra Janga * and Agustino- Martinez-Antonio. Scaling relationship in the gene content of transcriptional machinery in bacteria. Molecular Biosystems, 2009, 5(12): IIT Bombay Dr. Sarath Chandra Janga for stimulating discussion and presentation on Systems approaches for studying biological networks: from post-transcriptional control to drug discovery. IIT Bombay 72 36
Introduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
More informationL3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus
L3.1: Circuits: Introduction to Transcription Networks Cellular Design Principles Prof. Jenna Rickus In this lecture Cognitive problem of the Cell Introduce transcription networks Key processing network
More informationAn introduction to SYSTEMS BIOLOGY
An introduction to SYSTEMS BIOLOGY Paolo Tieri CNR Consiglio Nazionale delle Ricerche, Rome, Italy 10 February 2015 Universidade Federal de Minas Gerais, Belo Horizonte, Brasil Course outline Day 1: intro
More informationProteomics. 2 nd semester, Department of Biotechnology and Bioinformatics Laboratory of Nano-Biotechnology and Artificial Bioengineering
Proteomics 2 nd semester, 2013 1 Text book Principles of Proteomics by R. M. Twyman, BIOS Scientific Publications Other Reference books 1) Proteomics by C. David O Connor and B. David Hames, Scion Publishing
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationBiological Concepts and Information Technology (Systems Biology)
Biological Concepts and Information Technology (Systems Biology) Janaina de Andréa Dernowsek Postdoctoral at Center for Information Technology Renato Archer Janaina.dernowsek@cti.gov.br Division of 3D
More informationSYSTEMS BIOLOGY 1: NETWORKS
SYSTEMS BIOLOGY 1: NETWORKS SYSTEMS BIOLOGY Starting around 2000 a number of biologists started adopting the term systems biology for an approach to biology that emphasized the systems-character of biology:
More informationUnderstanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007
Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.
More informationProteomics. Yeast two hybrid. Proteomics - PAGE techniques. Data obtained. What is it?
Proteomics What is it? Reveal protein interactions Protein profiling in a sample Yeast two hybrid screening High throughput 2D PAGE Automatic analysis of 2D Page Yeast two hybrid Use two mating strains
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationClustering and Network
Clustering and Network Jing-Dong Jackie Han jdhan@picb.ac.cn http://www.picb.ac.cn/~jdhan Copy Right: Jing-Dong Jackie Han What is clustering? A way of grouping together data samples that are similar in
More informationIntroduction to Bioinformatics
Systems biology Introduction to Bioinformatics Systems biology: modeling biological p Study of whole biological systems p Wholeness : Organization of dynamic interactions Different behaviour of the individual
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationBioinformatics 2. Yeast two hybrid. Proteomics. Proteomics
GENOME Bioinformatics 2 Proteomics protein-gene PROTEOME protein-protein METABOLISM Slide from http://www.nd.edu/~networks/ Citrate Cycle Bio-chemical reactions What is it? Proteomics Reveal protein Protein
More informationIntroduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA.
Systems Biology-Models and Approaches Introduction Biology before Systems Biology: Reductionism Reduce the study from the whole organism to inner most details like protein or the DNA. Taxonomy Study external
More informationnetworks in molecular biology Wolfgang Huber
networks in molecular biology Wolfgang Huber networks in molecular biology Regulatory networks: components = gene products interactions = regulation of transcription, translation, phosphorylation... Metabolic
More informationGene Control Mechanisms at Transcription and Translation Levels
Gene Control Mechanisms at Transcription and Translation Levels Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9
More informationWritten Exam 15 December Course name: Introduction to Systems Biology Course no
Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate
More informationWhat is Systems Biology?
What is Systems Biology? 1 ICBS 2008 - More than 1000 participants!! 2 Outline 1. What is Systems Biology? 2. Why a need for Systems Biology (motivation)? 3. Biological data suitable for conducting Systems
More informationComparative Network Analysis
Comparative Network Analysis BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by
More informationNetwork Biology: Understanding the cell s functional organization. Albert-László Barabási Zoltán N. Oltvai
Network Biology: Understanding the cell s functional organization Albert-László Barabási Zoltán N. Oltvai Outline: Evolutionary origin of scale-free networks Motifs, modules and hierarchical networks Network
More informationRegulation and signaling. Overview. Control of gene expression. Cells need to regulate the amounts of different proteins they express, depending on
Regulation and signaling Overview Cells need to regulate the amounts of different proteins they express, depending on cell development (skin vs liver cell) cell stage environmental conditions (food, temperature,
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationGLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data
GLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data 1 Gene Networks Definition: A gene network is a set of molecular components, such as genes and proteins, and interactions between
More informationPredicting Protein Functions and Domain Interactions from Protein Interactions
Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput
More informationComputational Systems Biology
Computational Systems Biology Vasant Honavar Artificial Intelligence Research Laboratory Bioinformatics and Computational Biology Graduate Program Center for Computational Intelligence, Learning, & Discovery
More informationComplete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
More informationThe geneticist s questions
The geneticist s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion, RNAi) b) What is the consequence of increased gene function? 2) gene overexpression c) What does
More informationBioinformatics and Computerscience
Bioinformatics and Computerscience Systems Biology Data collection Network Inference Network-based dataintegration 1. ARRAY BASED 2. NEXT-GEN SEQUENCING RNA-Seq analysis ChIP-seq Bulked segregant analysis
More informationLecture 4: Yeast as a model organism for functional and evolutionary genomics. Part II
Lecture 4: Yeast as a model organism for functional and evolutionary genomics Part II A brief review What have we discussed: Yeast genome in a glance Gene expression can tell us about yeast functions Transcriptional
More information11/24/13. Science, then, and now. Computational Structural Bioinformatics. Learning curve. ECS129 Instructor: Patrice Koehl
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://www.cs.ucdavis.edu/~koehl/teaching/ecs129/index.html koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite
More informationAP Biology Gene Regulation and Development Review
AP Biology Gene Regulation and Development Review 1. What does the regulatory gene code for? 2. Is the repressor by default active/inactive? 3. What changes the repressor activity? 4. What does repressor
More informationNetworks & pathways. Hedi Peterson MTAT Bioinformatics
Networks & pathways Hedi Peterson (peterson@quretec.com) MTAT.03.239 Bioinformatics 03.11.2010 Networks are graphs Nodes Edges Edges Directed, undirected, weighted Nodes Genes Proteins Metabolites Enzymes
More informationIdentifying Signaling Pathways
These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony Gitter, Mark Craven, Colin Dewey Identifying Signaling Pathways BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018
More informationComputational Genomics. Systems biology. Putting it together: Data integration using graphical models
02-710 Computational Genomics Systems biology Putting it together: Data integration using graphical models High throughput data So far in this class we discussed several different types of high throughput
More informationWelcome to Class 21!
Welcome to Class 21! Introductory Biochemistry! Lecture 21: Outline and Objectives l Regulation of Gene Expression in Prokaryotes! l transcriptional regulation! l principles! l lac operon! l trp attenuation!
More informationProteomics. Areas of Interest
Introduction to BioMEMS & Medical Microdevices Proteomics and Protein Microarrays Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More informationGenome-wide multilevel spatial interactome model of rice
Sino-German Workshop on Multiscale Spatial Computational Systems Biology, Beijing, Oct 8-12, 2015 Genome-wide multilevel spatial interactome model of rice Ming CHEN ( 陈铭 ) mchen@zju.edu.cn College of Life
More informationThe Role of Network Science in Biology and Medicine. Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs
The Role of Network Science in Biology and Medicine Tiffany J. Callahan Computational Bioscience Program Hunter/Kahn Labs Network Analysis Working Group 09.28.2017 Network-Enabled Wisdom (NEW) empirically
More informationTypes of biological networks. I. Intra-cellurar networks
Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationThe Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11
The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding
More informationCONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry
CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna
More informationBiological networks CS449 BIOINFORMATICS
CS449 BIOINFORMATICS Biological networks Programming today is a race between software engineers striving to build bigger and better idiot-proof programs, and the Universe trying to produce bigger and better
More informationBMD645. Integration of Omics
BMD645 Integration of Omics Shu-Jen Chen, Chang Gung University Dec. 11, 2009 1 Traditional Biology vs. Systems Biology Traditional biology : Single genes or proteins Systems biology: Simultaneously study
More informationPREREQUISITE CHECKLIST
PREREQUISITE CHECKLIST UNIVERSITY OF CALIFORNIA, BERKELEY SCHOOL OF OPTOMETRY ADMISSIONS AND STUDENT AFFAIRS OFFICE Name: Date: Email: Status (complete, in progress, or planned) Prerequisite Course Requirements
More informationChemistry Chapter 26
Chemistry 2100 Chapter 26 The Central Dogma! The central dogma of molecular biology: Information contained in DNA molecules is expressed in the structure of proteins. Gene expression is the turning on
More informationCourse Descriptions Biology
Course Descriptions Biology BIOL 1010 (F/S) Human Anatomy and Physiology I. An introductory study of the structure and function of the human organ systems including the nervous, sensory, muscular, skeletal,
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationCellular Biophysics SS Prof. Manfred Radmacher
SS 20007 Manfred Radmacher Ch. 12 Systems Biology Let's recall chemotaxis in Dictiostelium synthesis of camp excretion of camp external camp gradient detection cell polarity cell migration 2 Single cells
More informationNetwork Biology-part II
Network Biology-part II Jun Zhu, Ph. D. Professor of Genomics and Genetic Sciences Icahn Institute of Genomics and Multi-scale Biology The Tisch Cancer Institute Icahn Medical School at Mount Sinai New
More informationThe EcoCyc Database. January 25, de Nitrógeno, UNAM,Cuernavaca, A.P. 565-A, Morelos, 62100, Mexico;
The EcoCyc Database Peter D. Karp, Monica Riley, Milton Saier,IanT.Paulsen +, Julio Collado-Vides + Suzanne M. Paley, Alida Pellegrini-Toole,César Bonavides ++, and Socorro Gama-Castro ++ January 25, 2002
More informationClustering of Pathogenic Genes in Human Co-regulatory Network. Michael Colavita Mentor: Soheil Feizi Fifth Annual MIT PRIMES Conference May 17, 2015
Clustering of Pathogenic Genes in Human Co-regulatory Network Michael Colavita Mentor: Soheil Feizi Fifth Annual MIT PRIMES Conference May 17, 2015 Topics Background Genetic Background Regulatory Networks
More informationDynamical Modeling in Biology: a semiotic perspective. Junior Barrera BIOINFO-USP
Dynamical Modeling in Biology: a semiotic perspective Junior Barrera BIOINFO-USP Layout Introduction Dynamical Systems System Families System Identification Genetic networks design Cell Cycle Modeling
More informationFrom genes to func.on Gene regula.on and transcrip.on
From genes to func.on Gene regula.on and transcrip.on Systems biology for system engineers Part 2 Sofia Pe(ersson Informa.on Coding Dept. of Electrical Engineering Linköping University The eukaryo.c cell
More informationBig Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Tuesday, December 27, 16
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Enduring understanding 3.B: Expression of genetic information involves cellular and molecular
More informationIntroduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationReading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationBasic modeling approaches for biological systems. Mahesh Bule
Basic modeling approaches for biological systems Mahesh Bule The hierarchy of life from atoms to living organisms Modeling biological processes often requires accounting for action and feedback involving
More informationBioinformatics 2 - Lecture 4
Bioinformatics 2 - Lecture 4 Guido Sanguinetti School of Informatics University of Edinburgh February 14, 2011 Sequences Many data types are ordered, i.e. you can naturally say what is before and what
More informationBioinformatics Chapter 1. Introduction
Bioinformatics Chapter 1. Introduction Outline! Biological Data in Digital Symbol Sequences! Genomes Diversity, Size, and Structure! Proteins and Proteomes! On the Information Content of Biological Sequences!
More informationIdentify stages of plant life cycle Botany Oral/written pres, exams
DPI Standards Biology Education (for students) 1. Characteristics of organisms Know Properties of living organisms, including: Acquire and use energy and materials Sense and respond to stimuli Reproduce
More informationEvolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites
Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed
More informationProkaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
More informationVirginia Western Community College BIO 101 General Biology I
BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental
More informationWhat is Systems Biology
What is Systems Biology 2 CBS, Department of Systems Biology 3 CBS, Department of Systems Biology Data integration In the Big Data era Combine different types of data, describing different things or the
More informationBio 101 General Biology 1
Revised: Fall 2016 Bio 101 General Biology 1 COURSE OUTLINE Prerequisites: Prerequisite: Successful completion of MTE 1, 2, 3, 4, and 5, and a placement recommendation for ENG 111, co-enrollment in ENF
More informationYear: Subject Area: Biochemistry, Genetics and Molecular Biology. Subject Category: Aging.
Year: 2011. Subject Category: Aging. 1 Aging Cell 2 Ageing Research Reviews 3 Psychology and Aging 4 Journals of Gerontology - Series A Biological Sciences and Medical Sciences 5 Mechanisms of Ageing and
More informationSystems Biology. Edda Klipp, Wolfram Liebermeister, Christoph Wierling, Axel Kowald, Hans Lehrach, and Ralf Herwig. A Textbook
Edda Klipp, Wolfram Liebermeister, Christoph Wierling, Axel Kowald, Hans Lehrach, and Ralf Herwig Systems Biology A Textbook WILEY- VCH WILEY-VCH Verlag GmbH & Co. KGaA v Contents Preface XVII Part One
More informationBiological Networks. Gavin Conant 163B ASRC
Biological Networks Gavin Conant 163B ASRC conantg@missouri.edu 882-2931 Types of Network Regulatory Protein-interaction Metabolic Signaling Co-expressing General principle Relationship between genes Gene/protein/enzyme
More informationCell biology traditionally identifies proteins based on their individual actions as catalysts, signaling
Lethality and centrality in protein networks Cell biology traditionally identifies proteins based on their individual actions as catalysts, signaling molecules, or building blocks of cells and microorganisms.
More informationSelf Similar (Scale Free, Power Law) Networks (I)
Self Similar (Scale Free, Power Law) Networks (I) E6083: lecture 4 Prof. Predrag R. Jelenković Dept. of Electrical Engineering Columbia University, NY 10027, USA {predrag}@ee.columbia.edu February 7, 2007
More informationSupplementary information. A proposal for a novel impact factor as an alternative to the JCR impact factor
Supplementary information A proposal for a novel impact factor as an alternative to the JCR impact factor Zu-Guo Yang a and Chun-Ting Zhang b, * a Library, Tianjin University, Tianjin 300072, China b Department
More informationGene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji
Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC
More informationComparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis
Title Comparative RNA-seq analysis of transcriptome dynamics during petal development in Rosa chinensis Author list Yu Han 1, Huihua Wan 1, Tangren Cheng 1, Jia Wang 1, Weiru Yang 1, Huitang Pan 1* & Qixiang
More informationEukaryotic Gene Expression
Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes
More informationJordan University of Science & Technology. Faculty of Arts and Sciences. Department of Applied Biological Sciences
Jordan University of Science & Technology Faculty of Arts and Sciences Department of Applied Biological Sciences Course Title Title & Instructor General Biology Course Number BIO 104 Instructor Office
More informationFunctional Characterization and Topological Modularity of Molecular Interaction Networks
Functional Characterization and Topological Modularity of Molecular Interaction Networks Jayesh Pandey 1 Mehmet Koyutürk 2 Ananth Grama 1 1 Department of Computer Science Purdue University 2 Department
More informationSTAAR Biology Assessment
STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules as building blocks of cells, and that cells are the basic unit of
More informationSCOTCAT Credits: 20 SCQF Level 7 Semester 1 Academic year: 2018/ am, Practical classes one per week pm Mon, Tue, or Wed
Biology (BL) modules BL1101 Biology 1 SCOTCAT Credits: 20 SCQF Level 7 Semester 1 10.00 am; Practical classes one per week 2.00-5.00 pm Mon, Tue, or Wed This module is an introduction to molecular and
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationMSc Drug Design. Module Structure: (15 credits each) Lectures and Tutorials Assessment: 50% coursework, 50% unseen examination.
Module Structure: (15 credits each) Lectures and Assessment: 50% coursework, 50% unseen examination. Module Title Module 1: Bioinformatics and structural biology as applied to drug design MEDC0075 In the
More informationHow much non-coding DNA do eukaryotes require?
How much non-coding DNA do eukaryotes require? Andrei Zinovyev UMR U900 Computational Systems Biology of Cancer Institute Curie/INSERM/Ecole de Mine Paritech Dr. Sebastian Ahnert Dr. Thomas Fink Bioinformatics
More informationSystems biology and biological networks
Systems Biology Workshop Systems biology and biological networks Center for Biological Sequence Analysis Networks in electronics Radio kindly provided by Lazebnik, Cancer Cell, 2002 Systems Biology Workshop,
More informationSupplementary Information 16
Supplementary Information 16 Cellular Component % of Genes 50 45 40 35 30 25 20 15 10 5 0 human mouse extracellular other membranes plasma membrane cytosol cytoskeleton mitochondrion ER/Golgi translational
More informationGrundlagen der Systembiologie und der Modellierung epigenetischer Prozesse
Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse Sonja J. Prohaska Bioinformatics Group Institute of Computer Science University of Leipzig October 25, 2010 Genome-scale in silico
More informationINTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA
INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA XIUFENG WAN xw6@cs.msstate.edu Department of Computer Science Box 9637 JOHN A. BOYLE jab@ra.msstate.edu Department of Biochemistry and Molecular Biology
More informationExploiting network-based approaches for understanding gene regulation and function
Exploiting network-based approaches for understanding gene regulation and function Sarath Chandra Janga A dissertation submitted to the University of Cambridge in candidature for the degree of Doctorate
More informationMeasuring TF-DNA interactions
Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF
More informationName: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More information3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
More informationPrinciples of Gene Expression
Principles of Gene Expression I. Introduc5on Genome : the en*re set of genes (transcrip*on units) of an organism Transcriptome : the en*re set of marns found in a cell at a given *me Proteome : the en*re
More informationBioControl - Week 6, Lecture 1
BioControl - Week 6, Lecture 1 Goals of this lecture Large metabolic networks organization Design principles for small genetic modules - Rules based on gene demand - Rules based on error minimization Suggested
More informationREVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E
REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,
More informationVCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
More informationMolecular and cellular biology is about studying cell structure and function
Chapter 1 Exploring the World of the Cell In This Chapter Discovering the microscopic world Getting matter and energy Reading the genetic code Molecular and cellular biology is about studying cell structure
More informationTranslation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
More information