RNA-protein interac/ons and the structure of the gene/c code

Size: px
Start display at page:

Download "RNA-protein interac/ons and the structure of the gene/c code"

Transcription

1 RNA-protein interac/ons and the structure of the gene/c code Bojan Zagrovic Department of Structural and Computa/onal Biology University of Vienna Evolu/on workshop, Salzburg,

2 Physicochemical complementarity one of the most powerful paradigms in biology PDB: 1QPH an#gen PDB: 1WBU Kraut et al. PLOSB, 4, 2006 enzyma/c catalysis an#body gene duplica/on immune response a novel complementarity?

3 messenger RNA-protein rela/onship: the cornerstone of molecular biology linked by the universal gene/c code S21 mrna physicochemical connec/on? ribosomal protein S21 (PDB: 4GD2)

4 What is the affinity of amino acids for pyrimidines? Carl Woese pyridine ASP in DMP:H 2 O pyrimidine LEU in DMP:H 2 O *DMP: 2,6-dimethylpyridine a. u. Woese CR et al., PNAS, 55: (1966) Mathew DC & Luthey-Schulten Z, J Mol Evol, 66: (2008)

5 THE CENTRAL FINDING * H. sapiens * Hlevnjak M, Polyansky AA & Zagrovic B, Nucleic Acids Research, 40, 2012 Polyansky AA, Hlevnjak M & Zagrovic B, RNA Biology, 10, 2013

6 A sta/s/cally robust finding of universal validity gene#c code shuffling different organisms Hlevnjak M, Polyansky AA & Zagrovic B, Nucleic Acids Research, 40, 2012 Polyansky AA, Hlevnjak M & Zagrovic B, RNA Biology, 10, 2013

7 What about natural bases and, in par/cular, purines? 3D structures of ~300 protein-rna complexes free energy proxies from contact sta#s#cs: *in units of k B T Polyansky AA & Zagrovic B, NAR, 18: (2013)

8 median R-values for profile matching distribuaons mrna PYR-density vs. protein PYR-affinity mrna PUR-density vs. protein G-affinity mrna PYR-density protein PYR-affinity (kt) mrna PUR-density protein G-affinity (kt)

9 An important excep/on: ADE-preferring amino acids tend to be encoded by PYR-rich stretches and vice versa Polyansky AA & Zagrovic B, NAR, 18: (2013)

10 Hypotheses mrna PYR-density protein PYR-affinity * 1. our findings support the possibility of a connecaon between nucleobase/amino-acid binding and geneac encoding (such as in the direct templa/ng mechanism of ancient translaaon) stereochemical hypothesis (Woese CR, 1965): coding from binding Hlevnjak, Polyansky & Zagrovic, NAR, 40, 2012; Polyansky & Zagrovic, NAR, 41, 2013; Polyansky AA, Hlevnjak M & Zagrovic B, RNA Biology, 10, 2013; Hajnic, Osorio & Zagrovic, NAR, 42, 2014; Hajnic, Osorio & Zagrovic, PCCP, 17, 2015; de Ruiter & Zagrovic, NAR, 43, 2015; Hlevnjak & Zagrovic, NAR, 43, 2015; Bartonek & Zagrovic, PLOS CB, 13, 2017

11 Hypotheses mrna PYR-density protein PYR-affinity * 1. our findings support the possibility of a connecaon between nucleobase/amino-acid binding and geneac encoding (such as in the direct templa/ng mechanism of ancient translaaon) 2. today s mrnas and cognate proteins may be complementary to each other and bind, especially if unstructured. Complementarity is negaavely regulated by mrna ADE content. Hlevnjak, Polyansky & Zagrovic, NAR, 40, 2012; Polyansky & Zagrovic, NAR, 41, 2013; Polyansky AA, Hlevnjak M & Zagrovic B, RNA Biology, 10, 2013; Hajnic, Osorio & Zagrovic, NAR, 42, 2014; Hajnic, Osorio & Zagrovic, PCCP, 17, 2015; de Ruiter & Zagrovic, NAR, 43, 2015; Hlevnjak & Zagrovic, NAR, 43, 2015; Bartonek & Zagrovic, PLOS CB, 13, 2017

12 mrna recoding vs. cognate matching mrna PYR-density protein polar requirement codon usage bias Woese pyridine scale Hlevnjak M & Zagrovic B, NAR, 43, (2015)

13 Func/onal significance Potenaally relevant in many areas of RNA/protein biology: translaaon regulaaon viral capsid assembly structure of non-membrane-bound cellular compartments protein interacaons with DNA, lncrna etc.? enrichment analysis PR/PYR matching Polyansky AA, Hlevnjak M & Zagrovic B, in prepara#on

14 A case study: assembly of the MS2 bacteriophage IDEA: genome %PYR profile coat protein PYR affinity profile CP CDS

15 Comparison against a 3.6 Å cryo EM structure of MS2 16 high-resoluaon RNA stem loops with capsid protein Dai et al. Nature, 541, 2017

16 Profile-based predic/ons match experimental loca/ons of stem loops R -0.6 A B C MS2 genome RNA PYR content A. coat protein CDS B. packaging signal C. replicase CDS coat protein PYR* affinity MS2 genome/cp sequence Poetsch F, Hlevnjak M, Polyansky AA & Zagrovic B, in preparaaon

17 mrna-protein COMPLEMENTARITY Origin of the gene/c code coding from binding? RNA-protein interac/ons a novel mechanisac perspecave New paradigms? translaaon regulaaon viral capsid assembly cellular networks OPEN CHALLENGES geometry; ΔGs; funcaonal significance; experimental tesang

18 Thanks Present members Anton A. Polyansky Lukas Bartonek Markus Fleck Florian Pötsch Daniel Braun Daniel Hoffmann Former members Matea Hajnic Anita de Ruiter Mario Hlevnjak Juan Osorio Iregui Theres Friesacher Gerald Platzer Antonija Kuzmanic Drazen Petrov Daniela Kruschel Chrisaan Margreiper Maaja Piskorec Mijo Simunovic Ruben Zubac Natalie Romanov Lily Chen Raphael Peer Thomas Malzac Bianca Mladek Maud Formanek Alexander Beribisky Mathias Kreuter Collaborators Robert Konrat, MFPL Renee Schroeder, MFPL Krisana Djinovic, MFPL Philippe H. Huenenberger, ETH Zurich Navraj S. Pannu, Leiden University Carrie Bernecky, ISTA Chris Oostenbrink, BOKU Vienna Funding

Department of Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, Vienna 1030, Austria

Department of Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, Vienna 1030, Austria 12984 12994 Nucleic Acids Research, 2014, Vol. 42, No. 21 Published online 31 October 2014 doi: 10.1093/nar/gku1035 Computational analysis of amino acids and their sidechain analogs in crowded solutions

More information

PCCP Accepted Manuscript

PCCP Accepted Manuscript PCCP Accepted Manuscript This is an Accepted Manuscript, which has been through the Royal Society of Chemistry peer review process and has been accepted for publication. Accepted Manuscripts are published

More information

BME 5742 Biosystems Modeling and Control

BME 5742 Biosystems Modeling and Control BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various

More information

Gene Regulatory Networks II Computa.onal Genomics Seyoung Kim

Gene Regulatory Networks II Computa.onal Genomics Seyoung Kim Gene Regulatory Networks II 02-710 Computa.onal Genomics Seyoung Kim Goal: Discover Structure and Func;on of Complex systems in the Cell Identify the different regulators and their target genes that are

More information

Translation Part 2 of Protein Synthesis

Translation Part 2 of Protein Synthesis Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation

More information

DNA/RNA structure and packing

DNA/RNA structure and packing DNA/RNA structure and packing Reminder: Nucleic acids one oxygen atom distinguishes RNA from DNA, increases reactivity (so DNA is more stable) base attaches at 1, phosphate at 5 purines pyrimidines Replace

More information

Evolu&on of Cellular Interac&on Networks. Pedro Beltrao Krogan and Lim UCSF

Evolu&on of Cellular Interac&on Networks. Pedro Beltrao Krogan and Lim UCSF Evolu&on of Cellular Interac&on Networks Pedro Beltrao Krogan and Lim Labs @ UCSF Point muta&ons Recombina&on Duplica&ons Mutants Mutants Point muta&ons Recombina&on Duplica&ons Changes in protein- protein,

More information

From genes to func.on Gene regula.on and transcrip.on

From genes to func.on Gene regula.on and transcrip.on From genes to func.on Gene regula.on and transcrip.on Systems biology for system engineers Part 2 Sofia Pe(ersson Informa.on Coding Dept. of Electrical Engineering Linköping University The eukaryo.c cell

More information

Introduction to Molecular and Cell Biology

Introduction to Molecular and Cell Biology Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What

More information

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology

2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology 2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the

More information

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

Organic Chemistry Option II: Chemical Biology

Organic Chemistry Option II: Chemical Biology Organic Chemistry Option II: Chemical Biology Recommended books: Dr Stuart Conway Department of Chemistry, Chemistry Research Laboratory, University of Oxford email: stuart.conway@chem.ox.ac.uk Teaching

More information

Part III - Bioinformatics Study of Aminoacyl trna Synthetases. VMD Multiseq Tutorial Web tools. Perth, Australia 2004 Computational Biology Workshop

Part III - Bioinformatics Study of Aminoacyl trna Synthetases. VMD Multiseq Tutorial Web tools. Perth, Australia 2004 Computational Biology Workshop Part III - Bioinformatics Study of Aminoacyl trna Synthetases VMD Multiseq Tutorial Web tools Perth, Australia 2004 Computational Biology Workshop Multiple Sequence Alignments The aminoacyl-trna synthetases,

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Lesson Overview. Ribosomes and Protein Synthesis 13.2

Lesson Overview. Ribosomes and Protein Synthesis 13.2 13.2 The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to mrna. This transcribed information contains a code for making proteins. The Genetic

More information

Translational Initiation

Translational Initiation Translational Initiation Lecture Outline 1. Process of Initiation. Alternative mechanisms of Initiation 3. Key Experiments on Initiation 4. Regulation of Initiation Translation is a process with three

More information

Warm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22)

Warm-Up. Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Warm-Up Explain how a secondary messenger is activated, and how this affects gene expression. (LO 3.22) Yesterday s Picture The first cell on Earth (approx. 3.5 billion years ago) was simple and prokaryotic,

More information

Molecular Biology of the Cell

Molecular Biology of the Cell Alberts Johnson Lewis Morgan Raff Roberts Walter Molecular Biology of the Cell Sixth Edition Chapter 6 (pp. 333-368) How Cells Read the Genome: From DNA to Protein Copyright Garland Science 2015 Genetic

More information

Introduction to Evolutionary Concepts

Introduction to Evolutionary Concepts Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq

More information

CSCI1950 Z Computa3onal Methods for Biology* (*Working Title) Lecture 1. Ben Raphael January 21, Course Par3culars

CSCI1950 Z Computa3onal Methods for Biology* (*Working Title) Lecture 1. Ben Raphael January 21, Course Par3culars CSCI1950 Z Computa3onal Methods for Biology* (*Working Title) Lecture 1 Ben Raphael January 21, 2009 Course Par3culars Three major topics 1. Phylogeny: ~50% lectures 2. Func3onal Genomics: ~25% lectures

More information

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.

Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu. Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The

More information

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison 10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:

More information

Chapter 17. From Gene to Protein. Biology Kevin Dees

Chapter 17. From Gene to Protein. Biology Kevin Dees Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting

More information

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis

Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,

More information

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid. 1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the

More information

BIOS /30/17. DNA in the Courtroom Student Ques3ons from edx.. A Protein is a Polymer too. Week 2. Biology s Impact in Our World.

BIOS /30/17. DNA in the Courtroom Student Ques3ons from edx.. A Protein is a Polymer too. Week 2. Biology s Impact in Our World. Week DNA in the Courtroom Student Ques3ons from edx.. 1. STR vs VNTR, RFLP. Do police need probable cause to collect DNA samples?, how to guard against unreasonable search and seizure?. 3. What is difference

More information

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Types of RNA Messenger RNA (mrna) makes a copy of DNA, carries instructions for making proteins,

More information

Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.

Related Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever. CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains

More information

GCD3033:Cell Biology. Transcription

GCD3033:Cell Biology. Transcription Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors

More information

NOTE: Questions are written on both sides of the sheets of paper making up this exam booklet!

NOTE: Questions are written on both sides of the sheets of paper making up this exam booklet! Biology 1010 Section A Midterm 1 January 30, 2008 (print): ANSWER KEY Name (signature): Student I.D. #: Time: 50 minutes Read the following instructions: 1. Do not open the examination until you are instructed

More information

Types of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell.

Types of RNA. 1. Messenger RNA(mRNA): 1. Represents only 5% of the total RNA in the cell. RNAs L.Os. Know the different types of RNA & their relative concentration Know the structure of each RNA Understand their functions Know their locations in the cell Understand the differences between prokaryotic

More information

Introduction to the Ribosome Overview of protein synthesis on the ribosome Prof. Anders Liljas

Introduction to the Ribosome Overview of protein synthesis on the ribosome Prof. Anders Liljas Introduction to the Ribosome Molecular Biophysics Lund University 1 A B C D E F G H I J Genome Protein aa1 aa2 aa3 aa4 aa5 aa6 aa7 aa10 aa9 aa8 aa11 aa12 aa13 a a 14 How is a polypeptide synthesized? 2

More information

Biology 112 Practice Midterm Questions

Biology 112 Practice Midterm Questions Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,

More information

Computational Genomics. Reconstructing dynamic regulatory networks in multiple species

Computational Genomics. Reconstructing dynamic regulatory networks in multiple species 02-710 Computational Genomics Reconstructing dynamic regulatory networks in multiple species Methods for reconstructing networks in cells CRH1 SLT2 SLR3 YPS3 YPS1 Amit et al Science 2009 Pe er et al Recomb

More information

Introduction to molecular biology. Mitesh Shrestha

Introduction to molecular biology. Mitesh Shrestha Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of

More information

Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids. Prepared by Woojoo Choi

Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids. Prepared by Woojoo Choi Chapter 19. Gene creatures, Part 1: viruses, viroids and plasmids Prepared by Woojoo Choi Dead or alive? 1) In this chapter we will explore the twilight zone of biology and the gene creature who live there.

More information

Molecular Biology - Translation of RNA to make Protein *

Molecular Biology - Translation of RNA to make Protein * OpenStax-CNX module: m49485 1 Molecular Biology - Translation of RNA to make Protein * Jerey Mahr Based on Translation by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative

More information

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant?

2. What was the Avery-MacLeod-McCarty experiment and why was it significant? 3. What was the Hershey-Chase experiment and why was it significant? Name Date Period AP Exam Review Part 6: Molecular Genetics I. DNA and RNA Basics A. History of finding out what DNA really is 1. What was Griffith s experiment and why was it significant? 1 2. What was

More information

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation.

Protein Synthesis. Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis Unit 6 Goal: Students will be able to describe the processes of transcription and translation. Protein Synthesis: Protein synthesis uses the information in genes to make proteins. 2 Steps

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2007

Bio 1B Lecture Outline (please print and bring along) Fall, 2007 Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution

More information

Biased amino acid composition in warm-blooded animals

Biased amino acid composition in warm-blooded animals Biased amino acid composition in warm-blooded animals Guang-Zhong Wang and Martin J. Lercher Bioinformatics group, Heinrich-Heine-University, Düsseldorf, Germany Among eubacteria and archeabacteria, amino

More information

Revisiting the Central Dogma The role of Small RNA in Bacteria

Revisiting the Central Dogma The role of Small RNA in Bacteria Graduate Student Seminar Revisiting the Central Dogma The role of Small RNA in Bacteria The Chinese University of Hong Kong Supervisor : Prof. Margaret Ip Faculty of Medicine Student : Helen Ma (PhD student)

More information

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail

More information

protein synthesis and the ribosome

protein synthesis and the ribosome protein synthesis and the ribosome Central dogma of biology DNA codes for DNA DNA codes for RNA RNA codes for proteins not surprisingly, many points for regulation of the process RNA codes for proteins

More information

UNIT 5. Protein Synthesis 11/22/16

UNIT 5. Protein Synthesis 11/22/16 UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA

More information

From gene to protein. Premedical biology

From gene to protein. Premedical biology From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,

More information

What is the central dogma of biology?

What is the central dogma of biology? Bellringer What is the central dogma of biology? A. RNA DNA Protein B. DNA Protein Gene C. DNA Gene RNA D. DNA RNA Protein Review of DNA processes Replication (7.1) Transcription(7.2) Translation(7.3)

More information

Gene regulation II Biochemistry 302. February 27, 2006

Gene regulation II Biochemistry 302. February 27, 2006 Gene regulation II Biochemistry 302 February 27, 2006 Molecular basis of inhibition of RNAP by Lac repressor 35 promoter site 10 promoter site CRP/DNA complex 60 Lewis, M. et al. (1996) Science 271:1247

More information

In Genomes, Two Types of Genes

In Genomes, Two Types of Genes In Genomes, Two Types of Genes Protein-coding: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] + DNA codons translated to amino acids to form a protein Non-coding RNAs (NcRNAs) No consistent patterns

More information

RNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA

RNA & PROTEIN SYNTHESIS. Making Proteins Using Directions From DNA RNA & PROTEIN SYNTHESIS Making Proteins Using Directions From DNA RNA & Protein Synthesis v Nitrogenous bases in DNA contain information that directs protein synthesis v DNA remains in nucleus v in order

More information

Cellular Processes in Bacterial Cells

Cellular Processes in Bacterial Cells Part II - Applications of MultiSeq Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Part III Towards in silico Cells: Simulating processes in entire cells Zaida (Zan) Luthey-Schulten

More information

Physical Models of Allostery: Allosteric Regulation in Capsid Assembly

Physical Models of Allostery: Allosteric Regulation in Capsid Assembly Physical Models of Allostery: Allosteric Regulation in Capsid Assembly QCB Journal Club Prof. Sima Setayeshgar JB Holmes Nov. 2, 2017 Mechanisms of Allosteric Regulation From R.A. Laskowski, FEBS Letters,

More information

GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.

GENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS. !! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms

More information

On the optimality of the standard genetic code: the role of stop codons

On the optimality of the standard genetic code: the role of stop codons On the optimality of the standard genetic code: the role of stop codons Sergey Naumenko 1*, Andrew Podlazov 1, Mikhail Burtsev 1,2, George Malinetsky 1 1 Department of Non-linear Dynamics, Keldysh Institute

More information

Advanced Topics in RNA and DNA. DNA Microarrays Aptamers

Advanced Topics in RNA and DNA. DNA Microarrays Aptamers Quiz 1 Advanced Topics in RNA and DNA DNA Microarrays Aptamers 2 Quantifying mrna levels to asses protein expression 3 The DNA Microarray Experiment 4 Application of DNA Microarrays 5 Some applications

More information

GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications

GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription

More information

Principles of Gene Expression

Principles of Gene Expression Principles of Gene Expression I. Introduc5on Genome : the en*re set of genes (transcrip*on units) of an organism Transcriptome : the en*re set of marns found in a cell at a given *me Proteome : the en*re

More information

What examples can you think of?

What examples can you think of? What examples can you think of? Geocentrism Alchemy Heliocentrism: Copernicus, Kepler, Newton, Galileo Nature of the chemical bond (Rutherford, Pauling ) Aristotelian view of the biosphere Woese/Pace (subject

More information

Review. Membrane proteins. Membrane transport

Review. Membrane proteins. Membrane transport Quiz 1 For problem set 11 Q1, you need the equation for the average lateral distance transversed (s) of a molecule in the membrane with respect to the diffusion constant (D) and time (t). s = (4 D t) 1/2

More information

Translation. Genetic code

Translation. Genetic code Translation Genetic code If genes are segments of DNA and if DNA is just a string of nucleotide pairs, then how does the sequence of nucleotide pairs dictate the sequence of amino acids in proteins? Simple

More information

From Gene to Protein

From Gene to Protein From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed

More information

The evolution of complexity I!! Iain Mathieson!

The evolution of complexity I!! Iain Mathieson! The evolution of complexity I!! Iain Mathieson! There is no theoretical reason to expect evolutionary lineages to increase in complexity with time, and no empirical evidence that they do so. Nevertheless,

More information

PROTEIN SYNTHESIS: TRANSLATION AND THE GENETIC CODE

PROTEIN SYNTHESIS: TRANSLATION AND THE GENETIC CODE PROTEIN SYNTHESIS: TRANSLATION AND THE GENETIC CODE HLeeYu Jsuico Junsay Department of Chemistry School of Science and Engineering Ateneo de Manila University 1 Nucleic Acids are important for their roles

More information

1. In most cases, genes code for and it is that

1. In most cases, genes code for and it is that Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod

More information

L3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus

L3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus L3.1: Circuits: Introduction to Transcription Networks Cellular Design Principles Prof. Jenna Rickus In this lecture Cognitive problem of the Cell Introduce transcription networks Key processing network

More information

Lecture 3: A basic statistical concept

Lecture 3: A basic statistical concept Lecture 3: A basic statistical concept P value In statistical hypothesis testing, the p value is the probability of obtaining a result at least as extreme as the one that was actually observed, assuming

More information

2015 FALL FINAL REVIEW

2015 FALL FINAL REVIEW 2015 FALL FINAL REVIEW Biomolecules & Enzymes Illustrate table and fill in parts missing 9A I can compare and contrast the structure and function of biomolecules. 9C I know the role of enzymes and how

More information

Translation and Operons

Translation and Operons Translation and Operons You Should Be Able To 1. Describe the three stages translation. including the movement of trna molecules through the ribosome. 2. Compare and contrast the roles of three different

More information

Predicting Protein Functions and Domain Interactions from Protein Interactions

Predicting Protein Functions and Domain Interactions from Protein Interactions Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput

More information

What can sequences tell us?

What can sequences tell us? Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more

More information

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr

Introduction to Bioinformatics. Shifra Ben-Dor Irit Orr Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A

More information

TRANSLATION: How to make proteins?

TRANSLATION: How to make proteins? TRANSLATION: How to make proteins? EUKARYOTIC mrna CBP80 NUCLEUS SPLICEOSOME 5 UTR INTRON 3 UTR m 7 GpppG AUG UAA 5 ss 3 ss CBP20 PABP2 AAAAAAAAAAAAA 50-200 nts CYTOPLASM eif3 EJC PABP1 5 UTR 3 UTR m 7

More information

Gene regulation II Biochemistry 302. Bob Kelm February 28, 2005

Gene regulation II Biochemistry 302. Bob Kelm February 28, 2005 Gene regulation II Biochemistry 302 Bob Kelm February 28, 2005 Catabolic operons: Regulation by multiple signals targeting different TFs Catabolite repression: Activity of lac operon is restricted when

More information

Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2

Cellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2 Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized

More information

Fitness constraints on horizontal gene transfer

Fitness constraints on horizontal gene transfer Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:

More information

Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype

Reading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

.PROTEIN SYNTHESIS AND I T S CONTROI D.

.PROTEIN SYNTHESIS AND I T S CONTROI D. 212..PROTEIN SYNTHESIS AND I T S CONTROI D. CALIFORNIA J. McCONNELL INSTITUTE O F TECHNOLOGY Recent advances i n molecular biology have given us a c l e a r p i c t u r e of t h e mechanism of p r o t

More information

Lecture 15: Programming Example: TASEP

Lecture 15: Programming Example: TASEP Carl Kingsford, 0-0, Fall 0 Lecture : Programming Example: TASEP The goal for this lecture is to implement a reasonably large program from scratch. The task we will program is to simulate ribosomes moving

More information

CSCI1950 Z Computa3onal Methods for Biology Lecture 24. Ben Raphael April 29, hgp://cs.brown.edu/courses/csci1950 z/ Network Mo3fs

CSCI1950 Z Computa3onal Methods for Biology Lecture 24. Ben Raphael April 29, hgp://cs.brown.edu/courses/csci1950 z/ Network Mo3fs CSCI1950 Z Computa3onal Methods for Biology Lecture 24 Ben Raphael April 29, 2009 hgp://cs.brown.edu/courses/csci1950 z/ Network Mo3fs Subnetworks with more occurrences than expected by chance. How to

More information

BME Engineering Molecular Cell Biology. Structure and Dynamics of Cellular Molecules. Basics of Cell Biology Literature Reading

BME Engineering Molecular Cell Biology. Structure and Dynamics of Cellular Molecules. Basics of Cell Biology Literature Reading BME 42-620 Engineering Molecular Cell Biology Lecture 05: Structure and Dynamics of Cellular Molecules Basics of Cell Biology Literature Reading BME42-620 Lecture 05, September 13, 2011 1 Outline Review:

More information

RNA Matrices and RNA Secondary Structures

RNA Matrices and RNA Secondary Structures RNA Matrices and RNA Secondary Structures Institute for Mathematics and Its Applications: RNA in Biology, Bioengineering and Nanotechnology, University of Minnesota October 29 November 2, 27 Asamoah Nkwanta,

More information

BIOLOGY STANDARDS BASED RUBRIC

BIOLOGY STANDARDS BASED RUBRIC BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:

More information

Protein synthesis I Biochemistry 302. February 17, 2006

Protein synthesis I Biochemistry 302. February 17, 2006 Protein synthesis I Biochemistry 302 February 17, 2006 Key features and components involved in protein biosynthesis High energy cost (essential metabolic activity of cell Consumes 90% of the chemical energy

More information

Practice Test on Cell Biology (the REAL test is on Friday the 17th) KEY LO: Describe and explain the Central Dogma. SLE: Meet NGSS.

Practice Test on Cell Biology (the REAL test is on Friday the 17th) KEY LO: Describe and explain the Central Dogma. SLE: Meet NGSS. Practice Test on Cell Biology (the REAL test is on Friday the 17th) KEY LO: Describe and explain the Central Dogma. SLE: Meet NGSS. On the real test, you will be given this chart of the genetic code (from

More information

More Protein Synthesis and a Model for Protein Transcription Error Rates

More Protein Synthesis and a Model for Protein Transcription Error Rates More Protein Synthesis and a Model for Protein James K. Peterson Department of Biological Sciences and Department of Mathematical Sciences Clemson University October 3, 2013 Outline 1 Signal Patterns Example

More information

Lecture 7: Simple genetic circuits I

Lecture 7: Simple genetic circuits I Lecture 7: Simple genetic circuits I Paul C Bressloff (Fall 2018) 7.1 Transcription and translation In Fig. 20 we show the two main stages in the expression of a single gene according to the central dogma.

More information

Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes

Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop

More information

Part 3: Introduction to Master Equation and Complex Initial Conditions in Lattice Microbes

Part 3: Introduction to Master Equation and Complex Initial Conditions in Lattice Microbes Part 3: Introduction to Master Equation Cells: and Complex Initial Conditions in Lattice re cells Microbes en Biophysics, and UC urgh, June 6-8, 2016 rson Joseph R. Peterson and Michael J. Hallock Luthey-Schulten

More information

F. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1

F. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1 Zhou Pei-Yuan Centre for Applied Mathematics, Tsinghua University November 2013 F. Piazza Center for Molecular Biophysics and University of Orléans, France Selected topic in Physical Biology Lecture 1

More information

Lecture 25: Protein Synthesis Key learning goals: Be able to explain the main stuctural features of ribosomes, and know (roughly) how many DNA and

Lecture 25: Protein Synthesis Key learning goals: Be able to explain the main stuctural features of ribosomes, and know (roughly) how many DNA and Lecture 25: Protein Synthesis Key learning goals: Be able to explain the main stuctural features of ribosomes, and know (roughly) how many DNA and protein subunits they contain. Understand the main functions

More information

Lecture 13: PROTEIN SYNTHESIS II- TRANSLATION

Lecture 13: PROTEIN SYNTHESIS II- TRANSLATION http://smtom.lecture.ub.ac.id/ Password: https://syukur16tom.wordpress.com/ Password: Lecture 13: PROTEIN SYNTHESIS II- TRANSLATION http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/translation2.gif

More information

Part II - Applications of MultiSeq Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes

Part II - Applications of MultiSeq Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Part II - Applications of MultiSeq Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Part III Towards in silico Cells: Simulating processes in entire cells Zaida (Zan) Luthey-Schulten!

More information

Nucleus. The nucleus is a membrane bound organelle that store, protect and express most of the genetic information(dna) found in the cell.

Nucleus. The nucleus is a membrane bound organelle that store, protect and express most of the genetic information(dna) found in the cell. Nucleus The nucleus is a membrane bound organelle that store, protect and express most of the genetic information(dna) found in the cell. Since regulation of gene expression takes place in the nucleus,

More information

Nuclear Functional Organization

Nuclear Functional Organization Lecture #4 The Cell as a Machine Nuclear Functional Organization Background readings from Chapters 4 of Alberts et al. Molecular Biology of the Cell (4 th Edition) Description of Functions by Biosystems

More information

Tutorial 1 Geometry, Topology, and Biology Patrice Koehl and Joel Hass

Tutorial 1 Geometry, Topology, and Biology Patrice Koehl and Joel Hass Tutorial 1 Geometry, Topology, and Biology Patrice Koehl and Joel Hass University of California, Davis, USA http://www.cs.ucdavis.edu/~koehl/ims2017/ Biology = Multiscale. 10 6 m 10 3 m m mm µm nm Å ps

More information

ومن أحياها Translation 1. Translation 1. DONE BY :Maen Faoury

ومن أحياها Translation 1. Translation 1. DONE BY :Maen Faoury Translation 1 DONE BY :Maen Faoury 0 1 ومن أحياها Translation 1 2 ومن أحياها Translation 1 In this lecture and the coming lectures you are going to see how the genetic information is transferred into proteins

More information

Cybergenetics: Control theory for living cells

Cybergenetics: Control theory for living cells Department of Biosystems Science and Engineering, ETH-Zürich Cybergenetics: Control theory for living cells Corentin Briat Joint work with Ankit Gupta and Mustafa Khammash Introduction Overview Cybergenetics:

More information

Regulation of Gene Expression *

Regulation of Gene Expression * OpenStax-CNX module: m44534 1 Regulation of Gene Expression * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 4.0 By the end of this section,

More information

Midterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer.

Midterm Review Guide. Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. Midterm Review Guide Name: Unit 1 : Biochemistry: 1. Give the ph values for an acid and a base. 2. What do buffers do? 3. Define monomer and polymer. 4. Fill in the Organic Compounds chart : Elements Monomer

More information

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1

Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 Name I. Multiple Choice (1 point each) Introduction to Microbiology BIOL 220 Summer Session I, 1996 Exam # 1 B 1. Which is possessed by eukaryotes but not by prokaryotes? A. Cell wall B. Distinct nucleus

More information