Part II - Applications of MultiSeq Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes
|
|
|
- Elmer Preston
- 5 years ago
- Views:
Transcription
1 Part II - Applications of MultiSeq Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Part III Towards in silico Cells: Simulating processes in entire cells Zaida (Zan) Luthey-Schulten! Dept. Chemistry, Physics, Beckman Institute, Biophysics, Institute of Genomics Biology! NIH Resource Macromolecular Modeling and Bioinformatics! Workshop 2012!
2 Cellular'Processes'in'Bacterial'Cells' Noise'Contribu>ons'in'Gene>c'Switches:' Whole''Cell'Simula>ons' Roberts,'Magis,'Or>z,'Baumeister,'ZLS'' Plos'Comp.Bio.'7'(2011)' Assemble'cells'for'in'silico'studies' with'molecular'crowding'from'cet' &'proteomics'data'' Lac'Gene>c'switch'in'E.'coli' Stochas>c'gene'expression'models'' Kine>c'parameters'from'in'vitro'&' SM'experiments' Compare'solns'with'and'without' spa>al'heterogeneity' Reac>onGdiffusion'on'a'3D'laKce' using'gpus'for'an'en>re'cell'cycle'
3 theory''''''''lac'circuit''''''''cellgscale'modeling' Cellular'Models'from'Single'Cells' Slow growing E. coli cells with 3000 ribosomes CryoGelectron' tomography' '' ribosomes'and' membrane' Modeling' '' nucleoid'and'in% vivo'obstacles' Or>z,'et'al.'(2010),'J.Cell%Biol.%190:613G21' Roberts,'Magis,'Or>z,Baumeister,'ZLS'Plos%Comp.%Biol%(2011)''
4 theory''''''''lac'circuit''''''''cellgscale'modeling' Ridgway et al., (2008) Biophys J" Roberts, Stone, Sepulveda, Hwu, Luthey-Schulten (2009) IEEE Proc. HPCB - Italy! In%vivo'Crowding'in'E.%coli% %Fast%Growing% Immobile'obstacle'classes' Abundances'from'proteomics'studies' 20G30,000'ribosomes' randomly'placed' Fast'growth'phenotype'(55'min)' 'uniformly'distributed'obstacles' Reac>on'diffusion'master'equa>on'simula>ons'on'GPU'
5 Lac'gene>c'switch'in'E.'coli' 1) Choi et al, (2008) Science Kine>c'model'for'lac'regulatory'circuit'' Stochas>city'&'popula>on'heterogeneity?''' '''SM'experiments'(Xie,'Science'2007,'2008):'''
6 theory''''''''lac'circuit''''''''cellgscale'modeling' Kine>c'Model'of'lac'System' K in vitro kinetic experiment" S single molecule experiment" M model parameter fit to" single-molecule distributions"
![Analysis'of'biochemical'reac>ons' # of molecules 350 300 250 200 150 100 50 k 2' k 1' E + S ES ES E + S k 3' ES E + P S E ES P 0 0 50 100 150 Time (s) d[s] dt d[e] dt = k 2 [ES] k 1 [E][S] = k 2 [ES]](/docs-images/90/102628063/images/7-1.jpg "+ k 3 [ES] k 1 [E][S] d[es] = k 1 [E][S] k 2 [ES] k 3 [ES] dt d[p] = k 3 [ES] dt In'cells'hundreds'of'such'reac>ons'exist,'some' Involving'only'a'few'molecules'(9'repressors,' 1DNA,'")
7 Analysis'of'biochemical'reac>ons' # of molecules k 2' k 1' E + S ES ES E + S k 3' ES E + P S E ES P Time (s) d[s] dt d[e] dt = k 2 [ES] k 1 [E][S] = k 2 [ES] + k 3 [ES] k 1 [E][S] d[es] = k 1 [E][S] k 2 [ES] k 3 [ES] dt d[p] = k 3 [ES] dt In'cells'hundreds'of'such'reac>ons'exist,'some' Involving'only'a'few'molecules'(9'repressors,' 1DNA,' )'others'have'thousands'of'reactants.'
8 Stochas>c'vs.'Determinis>c'Solu>ons'' k 1' E + S ES # of molecules Cell'is'shaken,'but'not' wellgs>rred' Gillespie s'ssa'on'gpu' (2000'threads)' k 2' ES E + S k 3' ES E + P # of molecules S E ES P WellGs>rred'reac>ons' Time (s) Time (s)
9 theory''''''''experiment''''''''lac'circuit''''''''cellgscale'modeling' In%vivo'RDME'Sampling' Divide'space'into'equally'sized' subvolumes'which'can'each' contain'mul>ple'reac>ve'species' (par>cles)' Assume'subvolumes'are'wellG s>rred' During'each'>me'step'par>cles' randomly'react'with'other' par>cles'in'the'subvolume' according'to'wellgs>rred' chemical'kine>cs'(gillespie)' Ager'each'>me'step'par>cles' randomly'move'to'neighboring' subvolumes'according'to' transi>on'probabili>es'that' depend'on'the'par>cle s' diffusion'coefficient'as'well'as' the'type'of'both'subvolumes'
10 Mo>va>on' Choi, Cai, Frieda, Xie (2008) Science" Noise contributions in genetic switches:bacterial cell simulations, Roberts, Magis, Ortiz, Baumeister, ZLS (2010) submitted"
11 Switching'in'Fast'Growing'E.'coli'Cells' 'Burs>ng''of''mRNA'''''
12 theory''''''''lac'circuit''''''''cellgscale'modeling' Anomalous'Repressor'Rebinding' r 2 = 6Dt α
13 Effect of in vivo crowding on repressor re-binding (uniform distribution of ribosomes)'
14 theory''''''''lac'circuit''''''''cellgscale'modeling' In%vivo' 'Slow'Growing'Cells' Life>mes'RepressorGOperator'Complexes' Posi>on'mRNA'on'membrane' Fast'growing' Slow'growing'
15 Repressor'dynamics' 'in%vivo% model'of'slow'growing'cells' Inducer'binding'to'repressors'causes'shorter'repressorGoperator'life>mes' '''''''''''''''''''''''''''''''''''''''''''''(ribosomes'omiled'for'clarity)' Red' 'mrna'burs>ng'''yellow' 'Lac'Y'protein' Green/white' 'LacY'gene'bound/free' Light'Blue' 'Repressor'+'I 2 ' Dark'Blue''GG'Repressor'+'I'
16 Predic>ng'the'rates'of'switching' k 0' k 1'
17 theory''''''''experiment''''''''lac'circuit''''''''cellgscale'modeling' Switching'Behavior' Low" Probability" High"
18 theory''''''''experiment''''''''lac'circuit''''''''cellgscale'modeling' LaKce'Microbe'Method' Reac>onGdiffusion'master'equa>on'(RDME)'for'diffusion'&'reac>ons' 'G'Spa>al'heterogeneity'in'sublaKces' 'G'Crowded'cytoplasmic'condi>ons' Massive'paralleliza>on'on'the'GPU' permits'studying'>me'evolu>on'of' cellular'systems'for'the'dura>on'of'the' cell'cycle' La#ce&Size& Spacing&(nm)& Time&Step& ( s)& 64x64x128' 16' 50' 400's' 128x128x256' 8' 1.3' 20's' 256x256x512' 4' 0.32' 0.5's' Simula5on& Time&per&Day&
19 Carl Woese' Bill Metcalf' Wolfgang Baumeister' Nathan Price' John Eargle, '! Ke Chen, Jonathan Lai' Elijah Roberts, M. Ada Yonath! Assaf, T. Ernest, J. Cole' Julio Ortiz' Max'Planck'Ins>tute' Biochemistry' 'Piyush Labhsetwar! John Cole! ' Wen-mei! Hwu (ECE)' Woodson! J.Hopkins' 'Taekjip Ha, H.Kim! NCSA%%&%NSF%Supercomputers%% &%Nvidia%Center%of%Excellence' ' Li Li! Susan Martinis! S. Cusack, A. Palencia, EMBL' ' ' Beckman'Ins>tute,'NIH'Center'' '''''''VMD,'NAMD' GPU' John Stone' Mike Hallock, Corey Fry, Y. Tang'
Cellular Processes in Bacterial Cells
Part II - Applications of MultiSeq Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Part III Towards in silico Cells: Simulating processes in entire cells Zaida (Zan) Luthey-Schulten
Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Part II - Applications of MultiSeq
Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Part II - Applications of MultiSeq Zaida (Zan) Luthey-Schulten Dept. Chemistry, Physics, Beckman Institute, Biophysics, Institute
Simulating ribosome biogenesis in replicating whole cells
Simulating ribosome biogenesis in replicating whole cells Tyler Earnest / PI: Zan Luthey-Schulten (UIUC) NCSA Blue Waters Symposium for Petascale Science and Beyond: June 15, 2016 Multi-scale modeling
Introduction to Evolutionary Concepts
Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq
Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes
Evolution of Translation: Dynamics of Recognition in RNA:Protein Complexes Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop
Part 3: Introduction to Master Equation and Complex Initial Conditions in Lattice Microbes
Part 3: Introduction to Master Equation Cells: and Complex Initial Conditions in Lattice re cells Microbes en Biophysics, and UC urgh, June 6-8, 2016 rson Joseph R. Peterson and Michael J. Hallock Luthey-Schulten
GPU-Accelerated Analysis and Visualization of Large Structures Solved by Molecular Dynamics Flexible Fitting
GPU-Accelerated Analysis and Visualization of Large Structures Solved by Molecular Dynamics Flexible Fitting John E. Stone, Ryan McGreevy, Barry Isralewitz, and Klaus Schulten Theoretical and Computational
Klaus Schulten Department of Physics and Theoretical and Computational Biophysics Group University of Illinois at Urbana-Champaign
Klaus Schulten Department of Physics and Theoretical and Computational Biophysics Group University of Illinois at Urbana-Champaign GTC, San Jose Convention Center, CA Sept. 20 23, 2010 GPU and the Computational
Characterizing molecular systems
Introduction to evolutionary concepts and VMD/MultiSeq - Part I Characterizing molecular systems Zaida (Zan) Luthey-Schulten Dept. Chemistry, Physics, Beckman Institute, Institute of Genomics Biology,
Evolution of Protein Structure in the Aminoacyl-tRNA Synthetases
Evolution of Protein Structure in the Aminoacyl-tRNA Synthetases class I class II P. O Donoghue and Z. Luthey-Schulten* Department of Chemistry, Beckman Institute, Center for Biophysics and Computational
Part III - Bioinformatics Study of Aminoacyl trna Synthetases. VMD Multiseq Tutorial Web tools. Perth, Australia 2004 Computational Biology Workshop
Part III - Bioinformatics Study of Aminoacyl trna Synthetases VMD Multiseq Tutorial Web tools Perth, Australia 2004 Computational Biology Workshop Multiple Sequence Alignments The aminoacyl-trna synthetases,
Every step in the process of gene expression includes some
Effects of DNA replication on mrna noise Joseph R. Peterson a,1, John A. Cole b,1, Jingyi Fei c,d, Taekjip Ha a,b,c,d,e,f, and Zaida A. Luthey-Schulten a,b,c,d, a Department of Chemistry, University of
Basic modeling approaches for biological systems. Mahesh Bule
Basic modeling approaches for biological systems Mahesh Bule The hierarchy of life from atoms to living organisms Modeling biological processes often requires accounting for action and feedback involving
NIH Center for Macromolecular Modeling and Bioinformatics Developer of VMD and NAMD. Beckman Institute
NIH Center for Macromolecular Modeling and Bioinformatics Developer of VMD and NAMD 5 faculty members (2 physics, 1 chemistry, 1 biochemistry, 1 computer science); 8 developers; 1 system admin; 15 post
Introduction to Protein Structures - Molecular Graphics Tool
Lecture 1a Introduction to Protein Structures - Molecular Graphics Tool amino acid tyrosine LH2 energetics traficking Ubiquitin enzymatic control BPTI Highlights of the VMD Molecular Graphics Program >
Are DNA Transcription Factor Proteins Maxwellian Demons?
Are DNA Transcription Factor Proteins Maxwellian Demons? * physics as a design constraint on molecular evolution. Alexander Grosberg, Longhua Hu, U. Minnesota, NYU U. Minnesota Biophysical Journal 2008
Introduction to Evolutionary Concepts
Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2010 VMD/MultiSeq
Engineering of Repressilator
The Utilization of Monte Carlo Techniques to Simulate the Repressilator: A Cyclic Oscillatory System Seetal Erramilli 1,2 and Joel R. Stiles 1,3,4 1 Bioengineering and Bioinformatics Summer Institute,
Analysis for dimension-restricted reaction kinetics with a bacterial endonuclease movement
Analysis for dimension-restricted reaction kinetics with a bacterial endonuclease movement NORIKO HIROI, AKIRA FUNAHASHI and HIROAKI KITANO ERATO-SORST Kitano Symbiotic Systems Project Japan Science and
RIBOSOME: THE ENGINE OF THE LIVING VON NEUMANN S CONSTRUCTOR
RIBOSOME: THE ENGINE OF THE LIVING VON NEUMANN S CONSTRUCTOR IAS 2012 Von Neumann s universal constructor Self-reproducing machine: constructor + tape (1948/9). Program on tape: (i) retrieve parts from
2. Mathematical descriptions. (i) the master equation (ii) Langevin theory. 3. Single cell measurements
1. Why stochastic?. Mathematical descriptions (i) the master equation (ii) Langevin theory 3. Single cell measurements 4. Consequences Any chemical reaction is stochastic. k P d φ dp dt = k d P deterministic
NIH Center for Macromolecular Modeling and Bioinformatics Developer of VMD and NAMD. Beckman Institute
NIH Center for Macromolecular Modeling and Bioinformatics Developer of VMD and NAMD 5 faculty members (2 physics, 1 chemistry, 1 biochemistry, 1 computer science); 8 developers; 1 system admin; 15 post
Mechanical Proteins. Stretching imunoglobulin and fibronectin. domains of the muscle protein titin. Adhesion Proteins of the Immune System
Mechanical Proteins F C D B A domains of the muscle protein titin E Stretching imunoglobulin and fibronectin G NIH Resource for Macromolecular Modeling and Bioinformatics Theoretical Biophysics Group,
Folding WT villin in silico Three folding simulations reach native state within 5-8 µs
Modeling of Cryo-EM Maps Workshop Baylor College of Medicine Klaus Schulten, U. Illinois at Urbana-Champaign Molecular Modeling Flexible Fitting 1: Introduction to Molecular Dynamics MD force field Equation
Nonequilibrium stochastic Processes at Single-molecule and Single-cell levels
Nonequilibrium stochastic Processes at Single-molecule and Single-cell levels Hao Ge ( 葛颢 ) haoge@pku.edu.cn Beijing International Center for Mathematical Research 2 Biodynamic Optical Imaging Center Peking
What can sequences tell us?
Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more
Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse
Grundlagen der Systembiologie und der Modellierung epigenetischer Prozesse Sonja J. Prohaska Bioinformatics Group Institute of Computer Science University of Leipzig October 25, 2010 Genome-scale in silico
Text: No required text book. Handouts will be given during the classes. Suggested references:
Text: No required text book. Handouts will be given during the classes. Suggested references: COURSE CONTENTS: Biological web resources, structure databases, structure alignment, protein, DNA, and RNA
Stochastic Processes at Single-molecule and Single-cell levels
Stochastic Processes at Single-molecule and Single-cell levels Hao Ge haoge@pu.edu.cn Beijing International Center for Mathematical Research 2 Biodynamic Optical Imaging Center Peing University, China
Introduction to Protein Structures - Molecular Graphics Tool
Lecture 1a Introduction to Protein Structures - Molecular Graphics Tool amino acid tyrosine LH2 energetics traficking Ubiquitin enzymatic control BPTI VMD - a Tool to Think Carl Woese Atomic, CG, Particle:
Lecture 7: Simple genetic circuits I
Lecture 7: Simple genetic circuits I Paul C Bressloff (Fall 2018) 7.1 Transcription and translation In Fig. 20 we show the two main stages in the expression of a single gene according to the central dogma.
VMD: Visual Molecular Dynamics. Our Microscope is Made of...
VMD: Visual Molecular Dynamics Computational Microscope / Tool to Think amino acid tyrosine enzymatic control BPTI VMD tutorial traficking Ubiquitin case study http://www.ks.uiuc.edu/training/casestudies/
Steered Molecular Dynamics Introduction and Examples
Steered Molecular Dynamics Introduction and Examples Klaus Schulten Justin Gullingsrud Hui Lu avidin Sergei Izrailev biotin Rosemary Braun Ferenc Molnar Dorina Kosztin Barry Isralewitz Why Steered Molecular
Name: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
L3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus
L3.1: Circuits: Introduction to Transcription Networks Cellular Design Principles Prof. Jenna Rickus In this lecture Cognitive problem of the Cell Introduce transcription networks Key processing network
BME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
Macromolecular Crowding
Macromolecular Crowding Keng-Hwee Chiam Mathematical and Theoretical Biology Group Goodsell (1994) Macromolecular Crowding, Oct. 15, 2003 p.1/33 Outline What: introduction, definition Why: implications
Modeling of Cryo-EM Maps Workshop Baylor College of Medicine Klaus Schulten, U. Illinois at Urbana-Champaign
Modeling of Cryo-EM Maps Workshop Baylor College of Medicine Klaus Schulten, U. Illinois at Urbana-Champaign Molecular Modeling Flexible Fitting 3: Application to Ribosome Proofreading of codon recognition
INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA
INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA XIUFENG WAN xw6@cs.msstate.edu Department of Computer Science Box 9637 JOHN A. BOYLE jab@ra.msstate.edu Department of Biochemistry and Molecular Biology
Hybrid Model of gene regulatory networks, the case of the lac-operon
Hybrid Model of gene regulatory networks, the case of the lac-operon Laurent Tournier and Etienne Farcot LMC-IMAG, 51 rue des Mathématiques, 38041 Grenoble Cedex 9, France Laurent.Tournier@imag.fr, Etienne.Farcot@imag.fr
Gene Control Mechanisms at Transcription and Translation Levels
Gene Control Mechanisms at Transcription and Translation Levels Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9
Stochastic Processes at Single-molecule and Single-cell levels
Stochastic Processes at Single-molecule and Single-cell levels Hao Ge haoge@pu.edu.cn Beijing International Center for Mathematical Research 2 Biodynamic Optical Imaging Center Peing University, China
Sequence and Structure Alignment Z. Luthey-Schulten, UIUC Pittsburgh, 2006 VMD 1.8.5
Sequence and Structure Alignment Z. Luthey-Schulten, UIUC Pittsburgh, 2006 VMD 1.8.5 Why Look at More Than One Sequence? 1. Multiple Sequence Alignment shows patterns of conservation 2. What and how many
Bioinformatics: Network Analysis
Bioinformatics: Network Analysis Kinetics of Gene Regulation COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The simplest model of gene expression involves only two steps: the
Inferring the in vivo looping properties of DNA
1 Inferring the in vivo looping properties of DNA Leonor Saiz, J. Miguel Rubi *, and Jose M. G. Vilar Integrative Biological Modeling Laboratory, Computational Biology Program, Memorial Sloan-Kettering
Analog Electronics Mimic Genetic Biochemical Reactions in Living Cells
Analog Electronics Mimic Genetic Biochemical Reactions in Living Cells Dr. Ramez Daniel Laboratory of Synthetic Biology & Bioelectronics (LSB 2 ) Biomedical Engineering, Technion May 9, 2016 Cytomorphic
Chapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
RNA-protein interac/ons and the structure of the gene/c code
RNA-protein interac/ons and the structure of the gene/c code Bojan Zagrovic Department of Structural and Computa/onal Biology University of Vienna Evolu/on workshop, Salzburg, 07.07.2018 Physicochemical
Multiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
CHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
Effects of Different Burst Form on Gene Expression Dynamic and First-Passage Time
Advanced Studies in Biology, Vol. 9, 2017, no. 2, 91-100 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/asb.2017.726 Effects of Different Burst Form on Gene Expression Dynamic and First-Passage
Chapter
Chapter 17 17.4-17.6 Molecular Components of Translation A cell interprets a genetic message and builds a polypeptide The message is a series of codons on mrna The interpreter is called transfer (trna)
Algorithm of Insulin Amino acid Gln Lutvo Kurić Bosnia and Herzegovina, Novi Travnik, Kalinska 7
Algorithm of Insulin Amino acid Gln Lutvo Kurić Bosnia and Herzegovina, Novi Travnik, Kalinska 7 Abstract: This paper discusses cyberinformation studies of the amino acid composition of insulin, amino
Mechanical Proteins. Stretching imunoglobulin and fibronectin. domains of the muscle protein titin. Adhesion Proteins of the Immune System
Mechanical Proteins F C D B A domains of the muscle protein titin E Stretching imunoglobulin and fibronectin G NIH Resource for Macromolecular Modeling and Bioinformatics Theoretical Biophysics Group,
F. Piazza Center for Molecular Biophysics and University of Orléans, France. Selected topic in Physical Biology. Lecture 1
Zhou Pei-Yuan Centre for Applied Mathematics, Tsinghua University November 2013 F. Piazza Center for Molecular Biophysics and University of Orléans, France Selected topic in Physical Biology Lecture 1
The living cell is a society of molecules: molecules assembling and cooperating bring about life!
The Computational Microscope Computational microscope views the cell 100-1,000,000 processors http://micro.magnet.fsu.edu/cells/animals/images/animalcellsfigure1.jpg The living cell is a society of molecules:
Phylogenomics. Gene History, Genome History and Organismal Phylogeny (genealogy of cellular life)
Phylogenomics Gene History, Genome History and Organismal Phylogeny (genealogy of cellular life) The time will come I believe, though I shall not live to see it,when we shall have very fairly true genealogical
Lecture 11: Enzyme Kinetics, Part I
Biological Chemistry Laboratory Biology 3515/Chemistry 3515 Spring 2018 Lecture 11: Enzyme Kinetics, Part I 13 February 2018 c David P. Goldenberg University of Utah goldenberg@biology.utah.edu Back to
CONJOINT 541. Translating a Transcriptome at Specific Times and Places. David Morris. Department of Biochemistry
CONJOINT 541 Translating a Transcriptome at Specific Times and Places David Morris Department of Biochemistry http://faculty.washington.edu/dmorris/ Lecture 1 The Biology and Experimental Analysis of mrna
Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
Introduction to Mathematical Physiology I - Biochemical Reactions
Introduction to Mathematical Physiology I - Biochemical Reactions J. P. Keener Mathematics Department Math Physiology p.1/28 Introduction The Dilemma of Modern Biology The amount of data being collected
Fura22. Ca 2 +, Study on Transmembrane Behaviors of Ca 2 + to Escherichia coli Cells with Fura22 Fluorescence Probe
2004 62 4, 445 448 ACTA CHIMICA SINICA Vol 62, 2004 No 4, 445 448 Fura22 Ca 2 + Ξ, a, b b b a Ξ ( a 430072) ( b 430072) Fura22/ AM, Ca 2 + HB101, CaCl 2, Ca 2 +, ; Ca 2 +, Ca 2 +, Ca 2 +, Fura22/ AM, Study
Basic Synthetic Biology circuits
Basic Synthetic Biology circuits Note: these practices were obtained from the Computer Modelling Practicals lecture by Vincent Rouilly and Geoff Baldwin at Imperial College s course of Introduction to
Why EvoSysBio? Combine the rigor from two powerful quantitative modeling traditions: Molecular Systems Biology. Evolutionary Biology
Why EvoSysBio? Combine the rigor from two powerful quantitative modeling traditions: Molecular Systems Biology rigorous models of molecules... in organisms Modeling Evolutionary Biology rigorous models
Introduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
Curriculum Vitae. Lin Li
Curriculum Vitae Lin Li Department of Physics and Astronomy, Clemson University SC, United States, 29631 Email: lli5@g.clemson.edu Phone: 1-636-364-8518 Education and work experience: Research Associate
DNA/RNA structure and packing
DNA/RNA structure and packing Reminder: Nucleic acids one oxygen atom distinguishes RNA from DNA, increases reactivity (so DNA is more stable) base attaches at 1, phosphate at 5 purines pyrimidines Replace
(b) In 1977, Carl Woese suggested that there are three domains of living organisms: the Archaea, the Bacteria and the Eukaryota.
1 Prokaryotic and eukaryotic organisms can be classified depending on their cellular structure. (a) Describe three structural differences between prokaryotic and eukaryotic cells. (b) In 1977, Carl Woese
natural development from this collection of knowledge: it is more reliable to predict the property
1 Chapter 1 Introduction As the basis of all life phenomena, the interaction of biomolecules has been under the scrutiny of scientists and cataloged meticulously [2]. The recent advent of systems biology
Rui Dilão NonLinear Dynamics Group, IST
1st Conference on Computational Interdisciplinary Sciences (CCIS 2010) 23-27 August 2010, INPE, São José dos Campos, Brasil Modeling, Simulating and Calibrating Genetic Regulatory Networks: An Application
Bacterial growth control & control by bacterial growth. PICB, Shanghai July 18, 2008
Bacterial growth control & control by bacterial growth PICB, Shanghai July 18, 2008 Systems biology: from molecules to physiology Physiology: the working of a living organism; reproduction & adaptation
Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
Molecular biology and biochemistry of archaeal DNA replication
Molecular biology and biochemistry of archaeal DNA replication Isaac Cann Institute for Universal Biology, NASA Astrobiology Institute Department of Animal Science & Department of Microbiology University
Testing the transition state theory in stochastic dynamics of a. genetic switch
Testing the transition state theory in stochastic dynamics of a genetic switch Tomohiro Ushikubo 1, Wataru Inoue, Mitsumasa Yoda 1 1,, 3, and Masaki Sasai 1 Department of Computational Science and Engineering,
Topic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
From cell biology to Petri nets. Rainer Breitling, Groningen, NL David Gilbert, London, UK Monika Heiner, Cottbus, DE
From cell biology to Petri nets Rainer Breitling, Groningen, NL David Gilbert, London, UK Monika Heiner, Cottbus, DE Biology = Concentrations Breitling / 2 The simplest chemical reaction A B irreversible,
2 Dilution of Proteins Due to Cell Growth
Problem Set 1 1 Transcription and Translation Consider the following set of reactions describing the process of maing a protein out of a gene: G β g G + M M α m M β m M + X X + S 1+ 1 X S 2+ X S X S 2
Steered Molecular Dynamics Introduction and Examples
Steered Molecular Dynamics Introduction and Examples Klaus Schulten Justin Gullingsrud Hui Lu avidin Sergei Izrailev biotin Rosemary Braun Ferenc Molnar Dorina Kosztin Barry Isralewitz Why Steered Molecular
Translation. Genetic code
Translation Genetic code If genes are segments of DNA and if DNA is just a string of nucleotide pairs, then how does the sequence of nucleotide pairs dictate the sequence of amino acids in proteins? Simple
Multistability in the lactose utilization network of E. coli. Lauren Nakonechny, Katherine Smith, Michael Volk, Robert Wallace Mentor: J.
Multistability in the lactose utilization network of E. coli Lauren Nakonechny, Katherine Smith, Michael Volk, Robert Wallace Mentor: J. Ruby Abrams Motivation Understanding biological switches in the
Graph Alignment and Biological Networks
Graph Alignment and Biological Networks Johannes Berg http://www.uni-koeln.de/ berg Institute for Theoretical Physics University of Cologne Germany p.1/12 Networks in molecular biology New large-scale
Boolean models of gene regulatory networks. Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016
Boolean models of gene regulatory networks Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016 Gene expression Gene expression is a process that takes gene info and creates
Translation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
Genetics 304 Lecture 6
Genetics 304 Lecture 6 00/01/27 Assigned Readings Busby, S. and R.H. Ebright (1994). Promoter structure, promoter recognition, and transcription activation in prokaryotes. Cell 79:743-746. Reed, W.L. and
Stochastic dynamics of small gene regulation networks. Lev Tsimring BioCircuits Institute University of California, San Diego
Stochastic dynamics of small gene regulation networks Lev Tsimring BioCircuits Institute University of California, San Diego Nizhni Novgorod, June, 2011 Central dogma Activator Gene mrna Protein Repressor
Our Microscope is Made of...
The Computational Microscope Computational microscope views at atomic resolution... Rs E M RER SER N RER C GA L... how living cells maintain health and battle disease John%Stone Our Microscope is Made
the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
Bi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
Bioinformatics: Network Analysis
Bioinformatics: Network Analysis Reaction Kinetics COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 Reaction kinetics is the study of how fast chemical reactions take place, what
Biological Pathways Representation by Petri Nets and extension
Biological Pathways Representation by and extensions December 6, 2006 Biological Pathways Representation by and extension 1 The cell Pathways 2 Definitions 3 4 Biological Pathways Representation by and
CS-E5880 Modeling biological networks Gene regulatory networks
CS-E5880 Modeling biological networks Gene regulatory networks Jukka Intosalmi (based on slides by Harri Lähdesmäki) Department of Computer Science Aalto University January 12, 2018 Outline Modeling gene
Protein function studies: history, current status and future trends
19 3 2007 6 Chinese Bulletin of Life Sciences Vol. 19, No. 3 Jun., 2007 1004-0374(2007)03-0294-07 ( 100871) Q51A Protein function studies: history, current status and future trends MA Jing, GE Xi, CHANG
An Approach To Modeling Tracer Experiments In Metabolic Non-Steady States Robert Phair Integrative Bioinformatics Inc.
An Approach To Modeling Tracer Experiments In Metabolic Non-Steady States Robert Phair Integrative Bioinformatics Inc. Los Altos, CA integrativebioinformatics.com Starting point: A simple mechanistic model
Modeling network dynamics: the lac operon, a case study
Modeling network dynamics: the lac operon, a case study José M. G. Vilar 1, C lin C. Guet 1,2, and Stanislas Leibler 1 1 The Rockefeller University, 1230 York Avenue, New York, NY 10021, USA 2 Dept. of
GENES AND CHROMOSOMES III. Lecture 5. Biology Department Concordia University. Dr. S. Azam BIOL 266/
GENES AND CHROMOSOMES III Lecture 5 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University CELL NUCLEUS AND THE CONTROL OF GENE EXPRESSION OPERONS Introduction All cells in a multi-cellular
REGULATION OF GENE EXPRESSION. Bacterial Genetics Lac and Trp Operon
REGULATION OF GENE EXPRESSION Bacterial Genetics Lac and Trp Operon Levels of Metabolic Control The amount of cellular products can be controlled by regulating: Enzyme activity: alters protein function
Modelling Biochemical Pathways with Stochastic Process Algebra
Modelling Biochemical Pathways with Stochastic Process Algebra Jane Hillston. LFCS, University of Edinburgh 13th April 2007 The PEPA project The PEPA project started in Edinburgh in 1991. The PEPA project
Lecture 15: Programming Example: TASEP
Carl Kingsford, 0-0, Fall 0 Lecture : Programming Example: TASEP The goal for this lecture is to implement a reasonably large program from scratch. The task we will program is to simulate ribosomes moving
Inferring a System of Differential Equations for a Gene Regulatory Network by using Genetic Programming
Inferring a System of Differential Equations for a Gene Regulatory Network by using Genetic Programming Erina Sakamoto School of Engineering, Dept. of Inf. Comm.Engineering, Univ. of Tokyo 7-3-1 Hongo,
AP3162D: Lecture 4 - Basic modelling frameworks for developmental biology and cell-fate decisions
AP162D: Lecture 4 - Basic modelling frameworks for developmental biology and cell-fate decisions Hyun Youk Delft University of Technology (Dated: March 15, 2018) In this lecture, we will derive the Berg-Purcell