Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
|
|
- Logan Lamb
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on the primary shoot (a) and mean number of leaves in the first four sympodial shoots (b) in WT (black bar) and ssp-2129 SP and ssp-1906 SP (gray bars) plants. Alternating white and gray boxes indicate sympodial shoot flowering time on the main shoot. Note that the ssp mutation has no effect on sympodial shoot flowering time in an SP background, and the ssp-1906 mutation causes only slight delays, resulting in an average of four leaves per sympodial shoot. Mean values (± s.e.m.) were compared to WT values using Student s t test: **P <
2 Supplementary Figure 2 Cloning of ssp-1906 (renamed sft-1906). (a) The ssp-1906 mapping interval on chromosome 3 defined by flanking insertion/deletion (indel) markers (red font) (Online Methods). Bottom, detailed gene structure showing the exons (black boxes) and introns of the primary candidate gene SFT. The ssp-1906 allele carried a nonsynonymous mutation (GTG to ATG; red bar; red A ) in exon 4. (b) Multiple-sequence alignment (ClustalW2) of the 2
3 florigen proteins from rice (Hd3a), Arabidopsis (FT) and tomato (SFT), and florigen antagonist from tomato (SP). The yellow box indicates the external loop domain, which is identical among florigen proteins but diverged in SP. Putative binding sites are conserved (red asterisks), and red boxes indicate residues that are conserved in the binding surface. Blue boxes indicate putative ligand-binding sites, and red and green characters therein indicate different conserved residues within the SFT subfamily and the SP subfamily. An arrow indicates the sft-1906 mutation. (c) Complementation tests confirming that sft-1906 is a weak allele of sft. Two known sft loss-of-function alleles, sft-4537 and sft-7187, were crossed with sft Bar graphs indicate leaf numbers produced on the primary shoot (green bar), alternating sympodial shoots (white and gray bars) and axillary shoot resulting from a failure to initiate sympodial growth (yellow bar). Mean values (± s.d.) are shown. Note that ssp-1906 sp failed to complement sft-4537 sp and sft7187 sp, as indicated by late flowering and the promotion of axillary meristem growth after generating a few late-flowering sympodial shoots. AxM, axillary shoot growth; ID, indeterminate shoot growth; D, determinate shoot growth. AxM growth is distinguished from indeterminate growth in that more than three leaves are produced on axillary shoots compared to typical sympodial shoots. AxM/ID indicates a mixed growth pattern of AxM and ID. 3
4 Supplementary Figure 3 Cloning of ssp-2129 and ssp-610. (a) The ssp-2129 mapping interval on chromosome 2 defined by flanking indel markers (red font). Five nonsynonymous mutations (arrows) in four genes were identified from ssp-2129 RNA sequencing data (Online Methods and Supplementary Table 2). Bottom, detailed gene structure of Solyc02g showing the exons (black boxes) and introns. Red bars indicate nonsynonymous mutations (ssp-2129, CCA to CTA; ssp-610, ACT to ATT; red T ) in exon 3. (b) Complementation tests confirming that ssp-2129 and ssp-610 are allelic. ssp-2129 sp and ssp-610 sp were crossed with each other. Both parents were backcrossed two times to sp plants to eliminate unlinked background mutations. Flowering times as determined by leaf number from the primary shoot (green bar) and successive sympodial shoots (alternating white and gray bars) are shown. Note that ssp-610 sp failed to complement ssp-2129 sp. ID, indeterminate shoot growth; D, determinate shoot growth. Error bars, s.d. 4
5 Supplementary Figure 4 A paralog of SSP and molecular evidence supporting functional redundancy. (a) Phylogenetic tree of the basic leucine-zipper (bzip) transcription factor family in tomato and Arabidopsis. Full-length bzip proteins from A. thaliana and tomato were aligned with ClustalW2 ( and a 5
6 phylogenetic tree was constructed (neighbor joining) using the FigTree v1.3 program. The blue wedge indicates FD paralogs and orthologs in Arabidopsis and tomato (red fonts). bzip family genes were retrieved from AGRIS ( and from the Solanaceae Genomics Network (SGN) (ftp://ftp.solgenomics.net/tomato_genome/). Scale bar, 0.05 substitutions per site. (b) Multiple-sequence alignment of the C termini from FD homologs using ClustalW2. The bzip domain (red bar and background) and the SAP motif required for protein interactions (green bar and background) are highly conserved. Note that we found a misannotation on the C terminus of the Solyc02g (SPGB2) protein and corrected it for this analysis. The red asterisk on the green bar indicates a putative phosphorylation site. Blue fonts, binding motif. (c) Yeast two-hybrid assays showing interaction between the SPGB2 and proteins. Tomato proteins binding with SFT interact with SPGB2 but not an spgb2 mutant having a deletion of the SAP motif. 3AT, 3 aminotriazole; L, lysine; T, tryptophan; H, histidine. (d) Normalized read counts for SPGB2 across five primary shoot meristem (PSM) stages and two sympodial meristems from our tomato meristem maturation atlas. A dashed line separates the PSM stages from the sympodial meristems. EVM, MVM and LVM, early (fifth leaf initiated), middle (sixth leaf initiated) and late (seventh leaf initiated) vegetative meristems, respectively; TM, transition meristem (eighth (final) leaf initiation before termination); FM, floral meristem; SIM, sympodial inflorescence meristem; SYM, sympodial shoot meristem. 6
7 Supplementary Figure 5 Functional conservation among proteins in rice and tomato. (a) Multiple-sequence alignment (ClustalW2) of three tomato homologs of proteins with rice proteins involved in florigen activation complex formation. The three tomato homologs have residues identical to the Hd3a-binding sites and OsFD1-interacting sites of the rice proteins (GF14b, GF14c and GF14e). Shown are putative SFT-binding sites (red asterisks) and putative SSP 7
8 interaction sites (blue boxes). The green bar indicates a highly conserved motif for a putative nuclear export signal (NES). Black and gray backgrounds indicate identity and high similarity. (b,c) Expression dynamics of genes from our tomato meristem maturation atlas generated by RNA sequencing of five primary shoot meristem (PSM) stages and two sympodial meristems (SIM and SYM) (c). Normalized read counts (RPKM) indicate expression values. EVM, MVM and LVM, early (fifth leaf initiated), middle (sixth leaf initiated) and late (seventh leaf initiated) vegetative meristems, respectively; TM, transition meristem (eighth (final) leaf initiated before termination); FM, floral meristem; SIM, sympodial inflorescence meristem; SYM, sympodial shoot meristem. (d,e) Protein interaction tests between proteins using yeast two-hybrid assays and BiFC assays in tobacco (N. benthamiana) leaf cells proteins that interact with SSP form homo- and heterodimers in yeast (d). Confocal images showing that GFP /74 localizes to the cytosol and nucleus (e, top). Confocal images detecting EYFP signals indicate BiFC interactions between N-YFP /74 and C-YFP /74, which are also localized to the cytosol and nucleus (e, bottom). A nuclear expression marker (NLS-RFP) is coexpressed in the epidermal cells of leaves from 3-week-old plants (e). 3AT, 3-aminotriazole; L, lysine; T, tryptophan; H, histidine; Scale bar, 50 µm. 8
9 Supplementary Figure 6 Confocal images showing the effects of coexpressing SSP and the ssp-2129 mutant protein on the subcellular localization of the SFT /74 interaction. EYFP signals are visualizing SFT /74 interaction via BiFC assay. Coexpression of CFP-SSP strongly increases nuclear localization of the interaction signals (bottom left), but coexpression of CFP ssp-2129 slightly affects the movement of the SFT /74 interaction into the nucleus (top left). CFP-SSP and CFP ssp-2129 are colocalized in the nuclei of N. benthamiana leaf cells. To quantify the SFT /74 interaction signals visualized by EYFP (Fig, 2g), the whole-cell (white dashed line) and nuclear (red dashed line) areas were drawn, on the basis of DIC (differential interference contrast) images, nuclear marker (NLS-RFP) expression and the expression of the SSP proteins (middle). YFP florescence signals from confocal images were captured by z-stack scanning and were then quantified for the whole-cell and nuclear areas. Scale bar, 50 µm. 9
10 Supplementary Figure 7 mrna in situ hybridization showing the spatial expression of SSP. (a c) SSP expression and dynamics during PSM maturation (a), in the SIM and SYM (b), and in canonical axillary meristems (c). SSP is expressed in all meristem types and in all cell layers but is relatively weakly expressed in the SIM and FM. SSP is also weakly expressed in vasculature cells (arrowheads). SSP, antisense probe; AxM, axillary meristem; FM3, third floral meristem (the second floral meristem is not in this plane); L4, fourth leaf, etc. Scale bar, 100 µm. 10
11 Supplementary Figure 8 Combining sft and ssp mutations enhances suppression of sp. (a) Representative images of the main shoots from sft ssp sp triple-mutant plants (at 3 months) showing that sft-1906 ssp-2129 sp triple mutants produce more leaves in successive sympodial shoots and enhance bract/leaf and branch production in inflorescences. (b) The sft-4537 ssp-2129 sp triple mutant shows stronger vegetative reversions of inflorescences, having less flower production compared to sft-4537 sp and ssp-2129 sp plants. Note that the enhanced sp suppression from combining ssp and sft alleles is likely because the ssp and sft mutations affect different components of the same complex. L, leaf; BR, bract; B, branched inflorescence; R, reversion to vegetative shoot; ID, indeterminate growth; D, determinate growth; AxM, axillary shoot growth. AxM/ID indicates a mixed growth pattern of alternating AxM and ID growth. Scale bar, 5 cm. 11
12 Supplementary Figure 9 Flowering times of the side (axillary) shoots and sympodial shoots derived from axillary shoots. (a) Average leaf number produced from the basal axillary shoots originating from the axil of the first leaf on the primary shoot. (b) Average leaf number produced from proximal axillary shoots from the axil of the last leaf on the primary shoot. (c) Average leaf number from four successive sympodial shoots derived from the basal axillary shoot. (d) Average leaf number from four successive sympodial shoots derived from the proximal axillary shoot. All single- and double-heterozygous genotypes are shown along with controls. The vertical dashed line indicates a switch to indeterminate growth (see also Supplementary Fig. 10). Mean values (± s.e.m.) are shown, and statistically significant differences (Student s t test) compared to WT and sp are represented by black and red asterisks, respectively: *P < 0.05, **P <
13 Supplementary Figure 10 Conversion of sp determinate growth to indeterminate growth using sft and ssp mutations. (a d) Quantification and comparison of shoot determinacy from primary shoots (a,b), basal axillary shoots (c) and proximal axillary shoots (d). Shown are data from 16 field-grown plants after 3 months (a,c,d) and from 10 greenhouse-grown plants after 3 months (b). Shoots were qualitatively scored as determinate (D, red bar) or indeterminate (ID, light-green bar) and then quantified from replicates. Note that, in some cases, determinacy was ambiguous at the time of data collection (D/ID, orange bar). AxM, axillary shoot (dark-green bar). 13
14 Supplementary Figure 11 Breakdown of component traits for two yield trials in Israel and New York. Statistical comparisons of mean values (± s.e.m.) for red-fruit yield (a,e), plant weight (b,f), fruit weight (c,g) and Brix (d,h) for M82 sp control (white bar), ssp-2129 (indeterminate control; black bar), single heterozygotes (light-gray bar) and double heterozygotes (darkgray bar). The vertical dashed line indicates a switch to indeterminate growth (see also Supplementary Fig. 10). Asterisks indicate significant differences from the M82 sp control plants according to the Dunnett s compare with control test: *P < 0.05, **P < Results were also obtained using multiple-range comparison analysis (Tukey-Kramer test; P < 0.05) (Supplementary Table 4). 14
15 Supplementary Figure 12 Double heterozygosity of the ssp mutations with sft-1906 produces the highest yields in multiple genetic backgrounds. Hybrids with three distinct determinate inbred lines ( SAR (a), REB (b) and LEA (c)) were generated by crossing with M82 determinate plants (as controls) and with all single and double mutants of ssp and sft (in the sp background). Double heterozygotes (black bars) were generated by crossing homozygous double mutants for ssp and sft with each inbred. Each genotype was evaluated for at least 15 replicates (Online Methods). Asterisks indicate significantly different yields from control hybrids (light-gray bar) calculated on the basis of Dunnett s compare with control test (*P < 0.05, **P < 0.01). Results were also obtained using a multiple-range comparison test (Tukey-Kramer test; P < 0.05) for total fruit yield and Brix-yield (Supplementary Table 5). Dark-gray bar, single heterozygote. Error bars, s.e.m. 15
16 Supplementary Figure 13 The ssp mutations improve shoot architecture and inflorescence production in different tomato types. (a) Representative main shoot of the cherry tomato cv. Sweet100, cv. M82 and the large-fruited cv. M99, each with introgressions of the ssp-2129 and sp mutations. All genotypes are indeterminate (ID) and produce less than three leaves in each sympodial shoot 16
17 compared to WT parental lines. Three-month-old plants are shown. Gray arrows indicate representative fruits from each cultivar. Red arrowheads point to inflorescences. L, leaf. Scale bar, 5 cm. (b,c) Quantification and comparison of average leaf number per sympodial shoot (b) and flowering times from five successive sympodial shoots (c; stacked gray and white bars) of the ssp-2129 and ssp-610 mutations in the three different genotypes shown above. The ssp and sp mutations were introgressed into each genotype by backcrossing and genotyping three times followed by self-fertilization to identify double-mutant progeny by genotyping. M99 was already in the background of sp. Mean values (± s.e.m.) from ten replicates were compared to WT and sp values using Student s t test. Black and red asterisks represent significant differences from WT and sp, respectively: **P <
18 Supplementary Table 1. Quantification of flowering time measured by leaf number in successive sympodial shoots derived from the primary shoots of sp, WT, and ssp plants. The first five sympodial shoots were examined from main shoots in 3-month old plants. STDEV, standard deviation; N, number of replicates. 1
19 Supplementary Table 2. List of nonsynonymous mutations within the SSP mapping interval on chromosome 2 identified from the mrna-sequencing of meristems from ssp-2129 mutants. Tomato gene identifiers are shown along with the position of the SNP and quality of the RNA-seq data and read depth supporting the SNP. SNP quality was calculated using SAMtools and bcftools. Position reflects the nucleotide in the coding sequence. The C to T change at position 647 in Soly02g (highlighted in red) was verified by Sanger sequencing and further confirmed by PCR genotyping. 2
20 Supplementary Table 3. Quantification of flowering time measured by leaf number in successive sympodial shoots derived from the primary shoots. The first five sympodial shoots were examined from the main shoot in 3-month old plants. STDEV, standard deviation; N, number of replicates. 3
21 Supplementary Table 4. Statistical comparisons of tomato yield components from two yield trials in two different environments. Shown are Red fruit (Red-kg), green fruit (Green-kg) and total yields (TY-kg) for each indicated genotype. Plant weight (PW-kg) is the 2 vegetative biomass after removing fruits. Comparisons of Fruit weight (FW-g), Brix (BX-%) and Brix-yield (BY-g/m ) are also shown. The percentage increase for each trait in each genotype over sp is shown (red font). Mean values were compared using a multiple range comparison test (Tukey-Kramer test; P < 0.05). Different letters represent significant differences. 4
22 Supplementary Table 5. Statistical comparisons of yield under optimal field conditions involving ssp and sft single and double mutant heterozygosity in the hybrid state with three distinct genetic backgrounds. Shown are total yields (kg) and Brix-yield (BY-g/m 2 ) for each indicated genotype. The percentage increase for each trait in each genotype over corresponding control hybrids (M82 x SAR, M82 x REB, and M82 x LEA) is shown. The Average effect change columns show average percentage changes for total yield and Brix-yield across four distinct genetic backgrounds (M82, and three hybrids with SAR, REB, and LEA). Mean values were compared using a multiple range comparison test (Tukey-Kramer test; P < 0.05). Different letters represent significant differences. 5
23 Supplementary Table 6. Primer sequences used in this study. 6
Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.
Supplementary Figure 1 The FIN and FAB genes act separately from the meristem maturation pathway. (a) Representative inflorescence from the compound inflorescence (s, defective in the homolog of Arabidopsis
More informationNature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationSupporting Online Material for
Supporting Online Material for Synchronization of the flowering transition by the tomato TERMINATING FLOWER gene. Cora A. MacAlister 1, Soon Ju Park 1, Ke Jiang 1, Fabien Marcel 2, Abdelhafid Bendahmane
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationBiological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
More informationTable S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
More informationLeucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family
Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family GENES & DEVELOPMENT (2000) 14: 108 117 INTRODUCTION Flower Diagram INTRODUCTION Abscission In plant, the process by which a plant
More informationSupplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
More informationSupplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
More informationSupplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary
More informationSupplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
More informationSupplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
More informationGENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
More informationVirus mediated Strategies for Transient Gene Expression and Silencing in Cotton
Virus mediated Strategies for Transient Gene Expression and Silencing in Cotton Brian Ayre, Dept. of Biological Sciences, University of North Texas, Denton, Texas Overview Virus mediated gene delivery
More informationSupplemental Data. Gao et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Plant EMP Proteins. (A) The Accession numbers of the 12 EMP members from Arabidopsis. (B) Phylogenetic analysis of EMP proteins from Arabidopsis, human and yeast using the Mac Vector
More informationSupplemental Data. Hou et al. (2016). Plant Cell /tpc
Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence
More informationSupplementary Methods
Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip
More informationThe phenotype of this worm is wild type. When both genes are mutant: The phenotype of this worm is double mutant Dpy and Unc phenotype.
Series 2: Cross Diagrams - Complementation There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
More informationCell Division and Genetics
Name Date Cell Division and Genetics 1. Black fur is dominant over brown fur in a particular population of guinea pig. The genetic information that gives a guinea pig brown fur is described as having A.
More informationDevelopment 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
More informationSupplementary Figure 1. Nature Genetics: doi: /ng.3848
Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More informationPenghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
More informationPhotoreceptor Regulation of Constans Protein in Photoperiodic Flowering
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within
More informationGenetic control of branching pattern and floral identity during Petunia inflorescence development
Development 125, 733-742 (1998) Printed in Great Britain The Company of Biologists Limited 1998 DEV0153 733 Genetic control of branching pattern and floral identity during Petunia inflorescence development
More informationReflexions, le site de vulgarisation de l'université de Liège
When tomatoes flower 3/13/12 Understanding the mechanisms responsible for tomato plant flowering will enable new selection procedures to be developed in order to obtain even more productive varieties.
More informationSupplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1
Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR
More informationChapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype.
Chapter 2: Extensions to Mendel: Complexities in Relating Genotype to Phenotype. please read pages 38-47; 49-55;57-63. Slide 1 of Chapter 2 1 Extension sot Mendelian Behavior of Genes Single gene inheritance
More informationGFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationDuplication of an upstream silencer of FZP increases grain yield in rice
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41477-017-0042-4 In the format provided by the authors and unedited. Duplication of an upstream silencer of FZP increases grain yield in rice
More informationExam 1 PBG430/
1 Exam 1 PBG430/530 2014 1. You read that the genome size of maize is 2,300 Mb and that in this species 2n = 20. This means that there are 2,300 Mb of DNA in a cell that is a. n (e.g. gamete) b. 2n (e.g.
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationI. GREGOR MENDEL - father of heredity
GENETICS: Mendel Background: Students know that Meiosis produces 4 haploid sex cells that are not identical, allowing for genetic variation. Essential Question: What are two characteristics about Mendel's
More informationArabidopsis TERMINAL FLOWER1 Is Involved in the Regulation of Flowering Time and Inflorescence Development through Transcriptional Repression C W OA
The Plant Cell, Vol. 23: 3172 3184, September 2011, www.plantcell.org ã 2011 American Society of Plant Biologists. All rights reserved. Arabidopsis TERMINAL FLOWER1 Is Involved in the Regulation of Flowering
More informationDNA Structure and Function
DNA Structure and Function Nucleotide Structure 1. 5-C sugar RNA ribose DNA deoxyribose 2. Nitrogenous Base N attaches to 1 C of sugar Double or single ring Four Bases Adenine, Guanine, Thymine, Cytosine
More informationEpigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence
Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence www.plantcell.org/cgi/doi/10.1105/tpc.110.tt0110 Epigenetics Usually
More informationPea Compound Leaf Architecture Is Regulated by Interactions among the Genes UNIFOLIATA, COCHLEATA, AFILA, and TENDRIL-LESS
The Plant Cell, Vol. 12, 1279 1294, August 2000, www.plantcell.org 2000 American Society of Plant Physiologists Pea Compound Leaf Architecture Is Regulated by Interactions among the Genes UNIFOLIATA, COCHLEATA,
More informationSUPPLEMENTARY INFORMATION
Figure S1. Haploid plant produced by centromere-mediated genome elimination Chromosomes containing altered CENH3 in their centromeres (green dots) are eliminated after fertilization in a cross to wild
More informationOther funding Sources Agency Name: MSU Agricultural Experiment Station /Project GREEEN Amount requested or awarded: 30,000
FINAL PROJECT REPORT Project Title: Functional genomics of flowering in apple PI: Herb Aldwinckle Co-PI(2): Steve VanNocker Organization: Cornell University Organization: Michigan State University Telephone/email:
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More informationRNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus
RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus Haiwei Lu and Steven H. Strauss Oregon State University Forest Tree Workshop PAG XXVI, San Diego, CA, 2018 The containment issue
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil
More informationSolutions to Problem Set 4
Question 1 Solutions to 7.014 Problem Set 4 Because you have not read much scientific literature, you decide to study the genetics of garden peas. You have two pure breeding pea strains. One that is tall
More informationJMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue
Fig. S1 JMJ14 JMJ14 JMJ14ΔFYR Methylene Blue Col jmj14-1 JMJ14-HA Methylene Blue Col jmj14-1 JMJ14ΔFYR-HA Fig. S1. The expression level of JMJ14 and truncated JMJ14 with FYR (FYRN + FYRC) domain deletion
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,
More informationEXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
More informationHeterozygous BMN lines
Optical density at 80 hours 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 0.8 0.6 0.4 0.2 a YPD b YPD + 1µM nystatin c YPD + 2µM nystatin d YPD + 4µM nystatin 1 3 5 6 9 13 16 20 21 22 23 25 28 29 30
More informationUnit 3 - Molecular Biology & Genetics - Review Packet
Name Date Hour Unit 3 - Molecular Biology & Genetics - Review Packet True / False Questions - Indicate True or False for the following statements. 1. Eye color, hair color and the shape of your ears can
More information** LCA LCN PCA
% of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number
More informationEvolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites
Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed
More informationGenetics 275 Notes Week 7
Cytoplasmic Inheritance Genetics 275 Notes Week 7 Criteriafor recognition of cytoplasmic inheritance: 1. Reciprocal crosses give different results -mainly due to the fact that the female parent contributes
More informationRegulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication
SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING
More informationA MicroRNA as a Translational Repressor of APETALA2 in Arabidopsis Flower Development
A MicroRNA as a Translational Repressor of APETALA2 in Arabidopsis Flower Development Xuemei Chen Waksman Institute, Rutgers University, Piscataway, NJ 08854, USA. E-mail: xuemei@waksman.rutgers.edu Plant
More information2 Numbers in parentheses refer to literature cited.
A Genetic Study of Monogerm and Multigerm Characters in Beets V. F. SAVITSKY 1 Introduction Monogerm beets were found in the variety Michigan Hybrid 18 in Oregon in 1948. Two of these monogerm plants,
More information. Supplementary Information
. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.
More informationAP Biology Unit 6 Practice Test 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8
AP Biology Unit 6 Practice Test Name: 1. A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 8 picograms of DNA per nucleus. How many picograms
More informationIllegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
More informationUNIT IV - FOUNDATIONS OF GENETIC ENGINEERING. Cell Reproduction and Genetics. Study Questions. 1. What is mitosis? 2. What is meiosis?
UNIT IV - FOUNDATIONS OF GENETIC ENGINEERING Lesson 2: Cell Reproduction and Genetics Competency/Objective: Explain how cells reproduce. Study Questions References 1. What is mitosis? 2. What is meiosis?
More informationDesigner Genes C Test
Northern Regional: January 19 th, 2019 Designer Genes C Test Name(s): Team Name: School Name: Team Number: Rank: Score: Directions: You will have 50 minutes to complete the test. You may not write on the
More informationName: Period: EOC Review Part F Outline
Name: Period: EOC Review Part F Outline Mitosis and Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences
More informationLooking for LOV: Location of LOV1 function in Nicotiana benthamiana cells
Looking for LOV: Location of LOV1 function in Nicotiana benthamiana cells By: Patrick Rutledge 1 Dr. Jennifer Lorang 2,3, Dr. Marc Curtis 2,3, Dr. Thomas Wolpert 2,3 BioResource Research 1, Botany and
More informationSupplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri
More information23-. Shoot and root development depend on ratio of IAA/CK
Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal
More informationCover Requirements: Name of Unit Colored picture representing something in the unit
Name: Period: Cover Requirements: Name of Unit Colored picture representing something in the unit Biology B1 1 Target # Biology Unit B1 (Genetics & Meiosis) Learning Targets Genetics & Meiosis I can explain
More informationCHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
More informationCell Growth and Genetics
Cell Growth and Genetics Cell Division (Mitosis) Cell division results in two identical daughter cells. The process of cell divisions occurs in three parts: Interphase - duplication of chromosomes and
More informationCytokinin. Fig Cytokinin needed for growth of shoot apical meristem. F Cytokinin stimulates chloroplast development in the dark
Cytokinin Abundant in young, dividing cells Shoot apical meristem Root apical meristem Synthesized in root tip, developing embryos, young leaves, fruits Transported passively via xylem into shoots from
More information1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine.
Protein Synthesis & Mutations RNA 1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. RNA Contains: 1. Adenine 2.
More informationSupplemental Data. Yang et al. (2012). Plant Cell /tpc
Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More informationSupplemental Table 1. Primers used for cloning and PCR amplification in this study
Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC
More informationChapter 4 Evaluating a potential interaction between deltex and git in Drosophila: genetic interaction, gene overexpression and cell biology assays.
Evaluating a potential interaction between deltex and git in Drosophila: genetic interaction, gene overexpression and cell biology assays. The data described in chapter 3 presented evidence that endogenous
More informationHeather Currinn, Benjamin Guscott, Zita Balklava, Alice Rothnie and Thomas Wassmer*
Online Resources APP controls the formation of PI(3,5)P 2 vesicles through its binding of the PIKfyve complex. Cellular and Molecular Life Sciences Heather Currinn, Benjamin Guscott, Zita Balklava, Alice
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More informationCONSTANS is a photoperiod regulated activator of flowering in sorghum
Yang et al. BMC Plant Biology 2014, 14:148 RESEARCH ARTICLE Open Access CONSTANS is a photoperiod regulated activator of flowering in sorghum Shanshan Yang, Brock D Weers, Daryl T Morishige and John E
More informationCell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.
Mitosis & Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences for genetic variation. 1. Students will describe
More informationQUANTITATIVE traits are characterized by continuous
Copyright Ó 2007 by the Genetics Society of America DOI: 10.1534/genetics.106.066423 Development of a Near-Isogenic Line Population of Arabidopsis thaliana and Comparison of Mapping Power With a Recombinant
More informationGenome-wide analysis of the MYB transcription factor superfamily in soybean
Du et al. BMC Plant Biology 2012, 12:106 RESEARCH ARTICLE Open Access Genome-wide analysis of the MYB transcription factor superfamily in soybean Hai Du 1,2,3, Si-Si Yang 1,2, Zhe Liang 4, Bo-Run Feng
More informationD. Incorrect! That is what a phylogenetic tree intends to depict.
Genetics - Problem Drill 24: Evolutionary Genetics No. 1 of 10 1. A phylogenetic tree gives all of the following information except for. (A) DNA sequence homology among species. (B) Protein sequence similarity
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2647 Figure S1 Other Rab GTPases do not co-localize with the ER. a, Cos-7 cells cotransfected with an ER luminal marker (either KDEL-venus or mch-kdel) and mch-tagged human Rab5 (mch-rab5,
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More information8. Use the following terms: interphase, prophase, metaphase, anaphase, telophase, chromosome, spindle fibers, centrioles.
Midterm Exam Study Guide: 2nd Quarter Concepts Cell Division 1. The cell spends the majority of its life in INTERPHASE. This phase is divided up into the G 1, S, and G 2 phases. During this stage, the
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Overexpression of YFP::GPR-1 in the germline.
Supplementary Figure 1 Overexpression of YFP::GPR-1 in the germline. The pie-1 promoter and 3 utr were used to express yfp::gpr-1 in the germline. Expression levels from the yfp::gpr-1(cai 1.0)-expressing
More informationEST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.
hest1a / SMG6 EST1 Homology Domain 100 aa 853 695 761 780 1206 hest1 / SMG5 -like? -like 109 145 214 237 497 165 239 1016 114 207 212 381 583 hest1c / SMG7 a helical 1091 Sc 57 185 267 284 699 Figure S1:
More informationSUPPLEMENTARY INFORMATION
Fig. 1 Influences of crystal lattice contacts on Pol η structures. a. The dominant lattice contact between two hpol η molecules (silver and gold) in the type 1 crystals. b. A close-up view of the hydrophobic
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3267 Supplementary Figure 1 A group of genes required for formation or orientation of annular F-actin bundles and aecm ridges: RNAi phenotypes and their validation by standard mutations.
More informationFigure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and
Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and counterclockwise for the inner row, with green representing coding
More informationCONCEPT OF SEQUENCE COMPARISON. Natapol Pornputtapong 18 January 2018
CONCEPT OF SEQUENCE COMPARISON Natapol Pornputtapong 18 January 2018 SEQUENCE ANALYSIS - A ROSETTA STONE OF LIFE Sequence analysis is the process of subjecting a DNA, RNA or peptide sequence to any of
More informationWaithe et al Supplementary Figures
Waithe et al Supplementary Figures Supplementary Figure 1 Expression and properties of WT and W391A mutant YFP- Ca V 2.2. A Immunoblot using Ca V 2.2 Ab for untransfected cells (UT, lane 1), YFP-Ca V 2.2
More informationManaging segregating populations
Managing segregating populations Aim of the module At the end of the module, we should be able to: Apply the general principles of managing segregating populations generated from parental crossing; Describe
More informationWhen one gene is wild type and the other mutant:
Series 2: Cross Diagrams Linkage Analysis There are two alleles for each trait in a diploid organism In C. elegans gene symbols are ALWAYS italicized. To represent two different genes on the same chromosome:
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationThe Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11
The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding
More informationLIFE SCIENCE CHAPTER 5 & 6 FLASHCARDS
LIFE SCIENCE CHAPTER 5 & 6 FLASHCARDS Why were ratios important in Mendel s work? A. They showed that heredity does not follow a set pattern. B. They showed that some traits are never passed on. C. They
More informationA complementation test would be done by crossing the haploid strains and scoring the phenotype in the diploids.
Problem set H answers 1. To study DNA repair mechanisms, geneticists isolated yeast mutants that were sensitive to various types of radiation; for example, mutants that were more sensitive to UV light.
More informationCh. 10 Sexual Reproduction and Genetics. p
Ch. 10 Sexual Reproduction and Genetics p. 270 - 10.1 Meiosis p. 270-276 Essential Question Main Idea! Meiosis produces haploid gametes Where are the instructions for each trait located in a cell?! On
More information