Supporting Online Material for

Size: px
Start display at page:

Download "Supporting Online Material for"

Transcription

1 Supporting Online Material for Synchronization of the flowering transition by the tomato TERMINATING FLOWER gene. Cora A. MacAlister 1, Soon Ju Park 1, Ke Jiang 1, Fabien Marcel 2, Abdelhafid Bendahmane 2, Yinon Izkovich 3, Yuval Eshed 3 and Zachary B. Lippman 1 * * To whom correspondence should be addressed. lippman@cshl.edu (Z.B.L.) This PDF file includes Supplemental Note Supplemental Figures 1 to 9 Supplemental Table 4 1

2 Supplemental Note Coordination of flowering When and where flowers form on a plant, as well as inflorescence organization, varies widely between related species. In annual monopodial plants like the Arabidopsis model, flowering occurs after a short vegetative stage, followed by seed set and death. In contrast, in perennial plants like trees and their tomato model, recurring flowering events during sympodial growth enable the development of new vegetative shoots, inflorescences, and flowers during a single growing season and over many years. Although both monopodial and sympodial plants undergo a primary flowering transition, sympodial plants have the added complication of coordinating floral termination with the initiation and growth of sympodial meristems. The primary flowering event in tomato can be broken down to successive stages: i) induction of a gradual vegetative to reproductive transition following germination, ii) formation of the specialized sympodial meristems, the floral sympodial bud (SIM) and vegetative sympodial shoot (SYM), iii) termination of the primary shoot in a flower, and iv) rapid release of apical dominance allowing outgrowth of the sympodial meristems. When endogenous flowering signals are limiting, as occurs when SFT is mutated, the first stage is severely delayed, floral termination is weak, and the sympodial program fails to activate 1. Likewise, overexpression of SFT (35S:SFT) causes rapid flowering, and inflorescence architecture and sympodial cycling are largely unaffected unless the flowering repressor SP is also lost. Thus, inductive flowering signals from SFT, counterbalanced by SP, impose tight coordination among all flowering stages such that induction drives floral termination, and termination is necessary and sufficient for sympodial growth 2. By analyzing the tmf mutant, we have made the surprising discovery that the process of flowering in the primary shoot can be genetically partitioned and desynchronized. Despite precocious activation of a portion of the floral specification program - specifically the FA-AN complex - in the vegetative stage of tmf mutants, the terminating primary meristem lacks many developmental hallmarks of more advanced flowering stages, and the sequential activation of floral transition (FUL) and floral identity (SEP) genes is reversed (Fig. 4). That TMF blocks precocious floral termination in the primary shoot suggests TMF transcriptional dynamics may have evolved to permit the synchronization of a gradual flowering transition with floral termination and the activation of sympodial growth. It is possible that the shortened vegetative stage of tomato axillary meristems could explain the unique sensitivity of the primary meristem to loss of TMF, and that other factors functioning redundantly with or independently of TMF might exist to prevent precocious activation of AN-FA in sympodial shoots. Our observation of recurring single flower inflorescences in plants expressing AN under the S promoter is consistent with this hypothesis. Although the AN-FA complex is highly conserved 3-5, its regulation differs between species. Based on a current model 4, Arabidopsis UFO is expressed in the SAM from embryogenesis onward 6-8, and activation of the LFY-UFO complex depends on transcriptional upregulation of 2

3 LFY during the reproductive transition. In contrast, these relations seem to be reversed in petunia, in which activation of the UFO ortholog, DOT, in the incipient floral meristem defines when flower formation begins. Unexpectedly, we find that overexpression of either FA or AN can accelerate flowering and cause single flower inflorescences. It may be that FA activation is capable of driving termination by feedback regulation between FA and AN. Importantly, recent transcriptome analysis of flowering transition dynamics in Arabidopsis SAMs revealed that UFO is upregulated 8-fold in response to floral induction, suggesting a similar relationship between LFY and UFO expression dynamics might also exist in Arabidopsis 9. 3

4 Supplementary Figure 1. Loss of tmf does not cause an accelerated transition from juvenile to adult growth. (a) Representative final leaf produced by the PSM before floral termination of WT (left) and tmf (right). (b) Quantification of leaf complexity (mean number of primary, secondary and intercalary leaflets). Leaf complexity increases over developmental time, but tmf does not exhibit precociously increased complexity, suggesting it is not undergoing a more rapid transition from juvenile to adult growth (phase change), despite precocious flower formation. Error bars are s.e.m. and different letters mark statistically significant differences (student s t-test, p-value <0.05). 4

5 Supplementary Figure 2. Double mutants between tmf and members of the florigen pathway are additive. (a-c and e) Shoot architecture diagrams of the indicated genotypes. White circles mark inflorescences and lines represent shoots producing the indicated number of leaves 5

6 (L). (a) In wild type plants the primary inflorescence is formed after approximately 8 leaves at which point sympodial cycling begins with the reiteration of a three-leaf plus inflorescence sympodial unit. (b) tmf is early flowering (after approximately 5 leaves) and fails to transition to sympodial cycling. Lateral shoots originating from canonical axillary meristems develop later and successfully enter sympodial growth. (c) In mutants of tomato florigen, single flower truss (sft/ft), the primary flowering transition is extremely late (approximately 20 leaves) and the primary inflorescence undergoes vegetative reversion to produce a leafy inflorescence interspersed with flowers. (d) Flowering time for primary and axillary meristems of the indicated genotypes. tmf partially suppresses the late flowering of sft in both the primary and axillary meristems, though tmf alone does not alter axillary meristem flowering time. (e) In mutants of the floral repressor and florigen antagonist self pruning (sp/tfl1), sympodial cycling is initiated normally, but the successive sympodial units become progressively shorter until the shoot terminates in two consecutive inflorescences. (f) Flowering time for the primary meristem and the average number of leaves produced in the first three sympodial units of each axillary shoot. tmf is early flowering for the primary shoot in both WT and sp mutant backgrounds. Similarly, lateral shoots of tmf and tmf sp double mutants initiate normal sympodial cycling, but terminate like sp in tmf sp double mutants. (g-h) The tmf sp double mutant produces the tmf single flower primary inflorescence with enlarged sepals (g) and undergoes termination as in sp (h). White dots mark the inflorescence from each successively formed sympodial unit. Note the single leaf (L) separating each unit. Error bars in d and f are s.e.m. and * marks significant differences (Wilcoxon-Mann-Whitney test * p-value <0.05, ** p-value <0.005 and *** p<0.0005). 6

7 Supplementary Figure 3. The tmf lesion is a Rider Ty1-copia-like retrotransposon insertion in Solyc09g (a) Semi-quantitative RT-PCR of Solyc09g and flanking genes from the TM of tmf (left) and WT (right). Solyc9g expression was not detected in either WT or tmf, and there is no evidence for expression at other stages of meristem maturation 10. DNA ladder is shown to the left. (b) The coding region of Solyc09g cannot be PCR-amplified from tmf genomic DNA, unlike a control sequence within the tmf mapping interval. 2-Log DNA ladder is shown from 500-1,000bp. (c) A Southern blot probed with the complete coding sequence of Solyc09g shows a genomic rearrangement in tmf mutants. For each restriction enzyme the lane order is: 1. M82 (a processing type tomato), 2. Break o Day (BOD: the WT progenitor of the tmf mutant), 3. tmf, 4. M99 (a fresh market tomato variety), and 5. Heinz 1706, which was sequenced by the tomato genome sequencing consortium 11. White arrows mark the expected fragment sizes according to the tomato genome sequence, while white asterisks highlight the structural deviation observed in tmf. (d) Rider element insertion site mapping in tmf by PCR. Chromosome 9 physical positions are given in kilobases along the top. Fragments in green are amplifiable from both WT and tmf, whereas fragments in red can only be amplified in WT suggesting a disruption in the region spanning the fragment. The blue dashed lines mark the region of genomic disturbance in tmf. Red triangle marks the observed Rider transposon insertion. 7

8 Supplementary Figure 4. The tmf-2 TILLING allele phenocopies tmf and carries a mutation that disrupts a highly conserved amino acid. (a) tmf-2 produces a primary inflorescence with a single flower with enlarged leaf-like sepals (arrow) like the original allele of tmf. (b) Flowering time in tmf and tmf-2 is accelerated in both penetrant and non-penetrant individuals. * marks statistically significant difference from WT (t-test p<0.05), error bars are s.d. (c) Diagram of the TMF protein with the site of the missense threonine105 to isoleucine mutation in tmf-2 marked in red and the conserved ALOG family domain in blue. Shown below is a partial multiple sequence alignment of TMF and the predicted protein sequences of ALOG family members in Arabidopsis thaliana, Selaginella moellendorffii (Smo) and Physcomitrella patens (Pp) showing the highly conserved amino acid disrupted in tmf-2 and flanking residues. 8

9 Supplementary Figure 5. Phylogenetic tree of the ALOG gene family. Neighbor joining phylogenetic tree based on the complete predicted protein coding sequences of the ALOG family members of tomato, Arabidopsis thaliana (LSH1-10), Selaginella moellendorffii (Smo) and Physcomitrella patens (Pp). Bootstrap values for 100 replicates are given inside nodes. 9

10 Supplementary Figure 6. The TMF protein shows transcriptional activity and interacts physically with transcriptional factors. (a) The construct used to test TMF for transcriptional activation activity and the corresponding control (left) show that the TMF full-length ORF induces His and LacZ synthesis in yeast in -His medium (middle) and liquid culture -gal assay (right) respectively. GAL4 BD (empty vector), control; -gal, -galactosidase. (b) Confirmation of interactions between TMF and selected transcription factors identified by yeast-two-hybrid screen (Supplementary Table 1). Left column is non-selective media (+His) and right column is selective media (-His) supplemented with 0.5 mm 3-aminotriazole (3AT) to reduce autoactivation of TMF. 10

11 Supplementary Figure 7. Transcriptome profiling of tmf vegetative meristems. (a-b) Representative vegetative apices of WT (a) and tmf (b) as collected for mrna sequencing. Dashed lines mark the limit of collected tissue, and leaf numbers (L) are indicated. (c-d) K- means cluster analysis of 674 differentially expressed genes between tmf and WT (Supplementary Table 2). The differentially expressed genes were divided into up-regulated (532 genes) and down-regulated (142 genes) in tmf compared to WT and compared to genes dynamically expressed during PSM maturation 10. The WT expression patterns of the 389 upregulated and 112 downregulated dynamically expressed genes were clustered by K-Means clustering using cluster numbers optimized by minimization of within-group sum of squares and 11

12 hierarchical clustering dendrograms. (c) The two clusters of genes that were down-regulated in tmf. (d) The four clusters of genes that were up-regulated in tmf. Number of genes in each cluster is given in the lower right corner. (e) A sampling of gene expression changes in tmf vegetative meristems showing that floral meristem and organ identity genes like the tomato homolog of Arabidopsis APETALA1 (SlAP1/MC) are activated precociously, while other flowering transition markers genes like S are not. The Digital Differentiation Index (DDI) algorithm quantifies unknown tissue maturation states based on expression of marker genes from known calibration tissues. (f) DDI predictions of tmf and control vegetative meristems based on known WT meristem stages (EVM: Early Vegetative Meristem, MVM: Middle Vegetative Meristem, LVM: Late Vegetative Meristem) 10. Curves represent density distribution of maturation states predicted by marker genes. Colored curves, calibration stages of a second biological replicate predicted on top of a first biological replicate; black curves, predictions of tmf and WT progenitor vegetative meristems. Heatmaps represent P values (in the form of scaled 1/(-logP); darker color indicates higher P-values and higher similarity of maturation) from pairwise t-tests between calibration stages and WT and tmf meristems. Supplementary Figure 8. Constitutive overexpression of FA/LFY produces a single flower primary inflorescence like tmf and tmf2-d. (a) Semi-quantitative RT-PCR of FA expression in the cotyledons of WT and tmf2-d (Fig. 5). (b and c) Transgenic constitutive overexpression of FA under the cauliflower mosaic virus 35S promoter recapitulates the tmf2-d early flowering and single flower primary inflorescences, frequently with enlarged sepals (white arrows) with incomplete penetrance when introgressed into the MicroTom genetic background (see Online Methods). 12

13 Supplementary Figure 9. Transcription of the Nicotiana benthamiana ortholog of AN (NbAN) is activated earlier than tomato AN during meristem maturation. (a) Stereoscope images showing matched developmental stages of PSM maturation between S. lycopersicum (cv. M82) and N. benthamiana. Dashed lines indicate tissue dissected for qrt-pcr, L=leaf number counted from 1st leaf. (b) Dynamic expression of the tomato AN and N. benthamiana AN ortholog (NbAN) by qrt-pcr showing that NbAN is already activated in the TM stage compared to tomato and is also activated earlier in the SYM (Student t-test assuming equal variance, tomato TM vs tomato LVM, P=0.5834, tomato SYM vs tomato LVM, P=0.5505; N. benthamiana TM vs N. benthamiana LVM, P=0.0029**, N. benthamiana SYM vs N. benthamiana LVM, P=0.0087**. ** indicates statistical significance at P<0.01). 13

14 Supplemental Table Legends Supplementary Table 1. List of TMF-interacting proteins as determined by Yeast Two- Hybrid analysis. [This table is provided as a separate file in MS Excel (.xlsx) Format] Tomato gene identifiers are shown along with annotated descriptions. Supplementary Table 2. Genes differentially expressed between tmf mutants and WT vegetative apices. [This table is provided as a separate file in MS Excel (.xlsx) Format] Genes showing greater than two fold change and P value < 0.05 are listed (P-values and log fold changes are shown in column C and D, respectively). The total mean RPKM expression values over two biological replicates of both genotypes are also shown (column E and F for tmf mutants and WT, respectively). Additional columns show whether a particular gene belongs to a Transcription Factor (TF) family (column F) and functional annotation of each gene (column G). Supplementary Table 3. Primer sequences. [This table is provided as a separate file in MS Excel (.xlsx) Format] Supplementary Table 4. Read number and mapping rate for mrna sequencing libraries. genotype replicate total reads mapped reads multiple mapping mapping rate multi rate Tmf 1 29,344,526 16,813, , Tmf 2 39,558,459 19,674, , WT 1 44,161,216 28,310,492 1,220, WT 2 44,205,239 22,977,411 1,055,

15 Supplemental References 1. Lifschitz, E. & Eshed, Y. Universal florigenic signals triggered by FT homologues regulate growth and flowering cycles in perennial day-neutral tomato. Journal of Experimental Botany 57, (2006). 2. Shalit, A. et al. The flowering hormone florigen functions as a general systemic regulator of growth and termination. Proc. Nat.l Acad. Sci. USA 106, (2009). 3. Chae, E., Tan, Q.K.-G., Hill, T.A. & Irish, V.F. An Arabidopsis F-box protein acts as a transcriptional co-factor to regulate floral development. Development 135, (2008). 4. Souer, E. et al. Patterning of Inflorescences and Flowers by the F-Box Protein DOUBLE TOP and the LEAFY Homolog ABERRANT LEAF AND FLOWER of Petunia. The Plant Cell 20, (2008). 5. Ikeda-Kawakatsu, K., Maekawa, M., Izawa, T., Itoh, J.-I. & Nagato, Y. ABERRANT PANICLE ORGANIZATION 2/RFL, the rice ortholog of Arabidopsis LEAFY, suppresses the transition from inflorescence meristem to floral meristem through interaction with APO1. The Plant Journal 69, (2012). 6. Long, J.A. & Barton, M.K. The development of apical embryonic pattern in Arabidopsis. Development 125, (1998). 7. Lee, I., Wolfe, D.S., Nilsson, O. & Weigel, D. A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS. Current Biology : CB 7, (1997). 8. Weigel, D. & Nilsson, O. A developmental switch sufficient for flower initiation in diverse plants. Nature 377, (1995). 9. Torti, S. et al. Analysis of the Arabidopsis Shoot Meristem Transcriptome during Floral Transition Identifies Distinct Regulatory Patterns and a Leucine-Rich Repeat Protein That Promotes Flowering. The Plant cell 24, (2012). 10. Park, S.J., Jiang, K., Schatz, M.C. & Lippman, Z.B. Rate of meristem maturation determines inflorescence architecture in tomato. Proc. Nat.l Acad. Sci. USA 109, (2012)

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background. Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.

Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway. Supplementary Figure 1 The FIN and FAB genes act separately from the meristem maturation pathway. (a) Representative inflorescence from the compound inflorescence (s, defective in the homolog of Arabidopsis

More information

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the

More information

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions. Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

More information

Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence

Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence Epigenetics and Flowering Any potentially stable and heritable change in gene expression that occurs without a change in DNA sequence www.plantcell.org/cgi/doi/10.1105/tpc.110.tt0110 Epigenetics Usually

More information

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and

More information

Virus mediated Strategies for Transient Gene Expression and Silencing in Cotton

Virus mediated Strategies for Transient Gene Expression and Silencing in Cotton Virus mediated Strategies for Transient Gene Expression and Silencing in Cotton Brian Ayre, Dept. of Biological Sciences, University of North Texas, Denton, Texas Overview Virus mediated gene delivery

More information

Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family

Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family Leucine-rich repeat receptor-like kinases (LRR-RLKs), HAESA, ERECTA-family GENES & DEVELOPMENT (2000) 14: 108 117 INTRODUCTION Flower Diagram INTRODUCTION Abscission In plant, the process by which a plant

More information

THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING. AnitaHajdu. Thesis of the Ph.D.

THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING. AnitaHajdu. Thesis of the Ph.D. THE ROLE OF THE PHYTOCHROME B PHOTORECEPTOR IN THE REGULATION OF PHOTOPERIODIC FLOWERING AnitaHajdu Thesis of the Ph.D. dissertation Supervisor: Dr. LászlóKozma-Bognár - senior research associate Doctoral

More information

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin

More information

Chapter 18 Lecture. Concepts of Genetics. Tenth Edition. Developmental Genetics

Chapter 18 Lecture. Concepts of Genetics. Tenth Edition. Developmental Genetics Chapter 18 Lecture Concepts of Genetics Tenth Edition Developmental Genetics Chapter Contents 18.1 Differentiated States Develop from Coordinated Programs of Gene Expression 18.2 Evolutionary Conservation

More information

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation

More information

Biological Roles of Cytokinins

Biological Roles of Cytokinins Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY

More information

23-. Shoot and root development depend on ratio of IAA/CK

23-. Shoot and root development depend on ratio of IAA/CK Balance of Hormones regulate growth and development Environmental factors regulate hormone levels light- e.g. phototropism gravity- e.g. gravitropism temperature Mode of action of each hormone 1. Signal

More information

Supplementary Figure 1. Phenotype of the HI strain.

Supplementary Figure 1. Phenotype of the HI strain. Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants

More information

Other funding Sources Agency Name: MSU Agricultural Experiment Station /Project GREEEN Amount requested or awarded: 30,000

Other funding Sources Agency Name: MSU Agricultural Experiment Station /Project GREEEN Amount requested or awarded: 30,000 FINAL PROJECT REPORT Project Title: Functional genomics of flowering in apple PI: Herb Aldwinckle Co-PI(2): Steve VanNocker Organization: Cornell University Organization: Michigan State University Telephone/email:

More information

Reflexions, le site de vulgarisation de l'université de Liège

Reflexions, le site de vulgarisation de l'université de Liège When tomatoes flower 3/13/12 Understanding the mechanisms responsible for tomato plant flowering will enable new selection procedures to be developed in order to obtain even more productive varieties.

More information

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature10534 Supplementary Fig. 1. Diagrammatic representation of the N-end rule pathway of targeted proteolysis (after Graciet and Wellmer 2010 9 ). Tertiary, secondary

More information

Major Plant Hormones 1.Auxins 2.Cytokinins 3.Gibberelins 4.Ethylene 5.Abscisic acid

Major Plant Hormones 1.Auxins 2.Cytokinins 3.Gibberelins 4.Ethylene 5.Abscisic acid Plant Hormones Lecture 9: Control Systems in Plants What is a Plant Hormone? Compound produced by one part of an organism that is translocated to other parts where it triggers a response in target cells

More information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

More information

The Plant Cell, November. 2017, American Society of Plant Biologists. All rights reserved

The Plant Cell, November. 2017, American Society of Plant Biologists. All rights reserved The Genetics of Floral Development Teaching Guide Overview The development of flowers in angiosperm plants provided a critical evolutionary advantage, allowing more options for pollen dispersal and seed

More information

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within

More information

Expression of CENTRORADIALIS (CEN) and CEN-like Genes in Tobacco Reveals a Conserved Mechanism Controlling Phase Change in Diverse Species

Expression of CENTRORADIALIS (CEN) and CEN-like Genes in Tobacco Reveals a Conserved Mechanism Controlling Phase Change in Diverse Species The Plant Cell, Vol. 11, 1405 1417, August 1999, www.plantcell.org 1999 American Society of Plant Physiologists Expression of CENTRORADIALIS (CEN) and CEN-like Genes in Tobacco Reveals a Conserved Mechanism

More information

Supplemental Data. Yang et al. (2012). Plant Cell /tpc

Supplemental Data. Yang et al. (2012). Plant Cell /tpc Supplemental Figure 1. Mature flowers of P. heterotricha. (A) An inflorescence of P. heterotricha showing the front view of a zygomorphic flower characterized by two small dorsal petals and only two fertile

More information

Genetic control of branching pattern and floral identity during Petunia inflorescence development

Genetic control of branching pattern and floral identity during Petunia inflorescence development Development 125, 733-742 (1998) Printed in Great Britain The Company of Biologists Limited 1998 DEV0153 733 Genetic control of branching pattern and floral identity during Petunia inflorescence development

More information

673 Comparative Genomics of Angiosperm MADS Box Genes Yale University, New Haven, CT. 674 The evolution of plant architecture in Brassicaceae

673 Comparative Genomics of Angiosperm MADS Box Genes Yale University, New Haven, CT. 674 The evolution of plant architecture in Brassicaceae 673 Comparative Genomics of Angiosperm MADS Box Genes Vivian F. Irish Yale University, New Haven, CT. MADS box genes encode key transcriptional regulators that have been implicated in the control of various

More information

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four

More information

Useful Propagation Terms. Propagation The application of specific biological principles and concepts in the multiplication of plants.

Useful Propagation Terms. Propagation The application of specific biological principles and concepts in the multiplication of plants. Useful Propagation Terms Propagation The application of specific biological principles and concepts in the multiplication of plants. Adventitious Typically describes new organs such as roots that develop

More information

Outline. Leaf Development. Leaf Structure - Morphology. Leaf Structure - Morphology

Outline. Leaf Development. Leaf Structure - Morphology. Leaf Structure - Morphology Outline 1. Leaf Structure: Morphology & Anatomy 2. Leaf Development A. Anatomy B. Sector analysis C. Leaf Development Leaf Structure - Morphology Leaf Structure - Morphology 1 Leaf Structure - Morphology

More information

SUSTAINABLE AND INTEGRAL EXPLOITATION OF AGAVE

SUSTAINABLE AND INTEGRAL EXPLOITATION OF AGAVE SUSTAINABLE AND INTEGRAL EXPLOITATION OF AGAVE Editor Antonia Gutiérrez-Mora Compilers Benjamín Rodríguez-Garay Silvia Maribel Contreras-Ramos Manuel Reinhart Kirchmayr Marisela González-Ávila Index 1.

More information

Poplar FT2 Shortens the Juvenile Phase and Promotes Seasonal Flowering W

Poplar FT2 Shortens the Juvenile Phase and Promotes Seasonal Flowering W The Plant Cell, Vol. 18, 1846 1861, August 2006, www.plantcell.org ª 2006 American Society of Plant Biologists Poplar FT2 Shortens the Juvenile Phase and Promotes Seasonal Flowering W Chuan-Yu Hsu, a Yunxia

More information

Flower Development Pathways

Flower Development Pathways Developmental Leading to Flowering Flower Development s meristem Inflorescence meristem meristems organ identity genes Flower development s to Flowering Multiple pathways ensures flowering will take place

More information

18.4 Embryonic development involves cell division, cell differentiation, and morphogenesis

18.4 Embryonic development involves cell division, cell differentiation, and morphogenesis 18.4 Embryonic development involves cell division, cell differentiation, and morphogenesis An organism arises from a fertilized egg cell as the result of three interrelated processes: cell division, cell

More information

Curriculum vitae Xigang Liu

Curriculum vitae Xigang Liu Curriculum vitae Xigang Liu 1, EDUCATION: 09/1993-07/1997 B.S. Major: Biology. College of Life Sciences, Hebei Normal University Academic Degree Paper: RAPD analysis of Taigu genic male-sterile wheat and

More information

Plant Structure and Organization - 1

Plant Structure and Organization - 1 Plant Structure and Organization - 1 In our first unit of Biology 203 we will focus on the structure and function of the higher plants, in particular the angiosperms, or flowering plants. We will look

More information

Supplementary Figure 1. Nature Genetics: doi: /ng.3848

Supplementary Figure 1. Nature Genetics: doi: /ng.3848 Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/301/ra98/dc1 Supplementary Materials for Regulation of Epithelial Morphogenesis by the G Protein Coupled Receptor Mist and Its Ligand Fog Alyssa J. Manning,

More information

Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication

Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,

More information

Analysis of regulatory function of circadian clock. on photoreceptor gene expression

Analysis of regulatory function of circadian clock. on photoreceptor gene expression Thesis of Ph.D. dissertation Analysis of regulatory function of circadian clock on photoreceptor gene expression Tóth Réka Supervisor: Dr. Ferenc Nagy Biological Research Center of the Hungarian Academy

More information

Utilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function

Utilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function Utilizing Illumina high-throughput sequencing technology to gain insights into small RNA biogenesis and function Brian D. Gregory Department of Biology Penn Genome Frontiers Institute University of Pennsylvania

More information

Principles of Genetics

Principles of Genetics Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics

More information

Reproductive Development

Reproductive Development Plant Reproduction Chapter 42 Angiosperms represent an evolutionary innovation with their production of flowers and fruits Plants go through developmental changes leading to reproductive maturity by adding

More information

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA

DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA DEVELOPMENTAL GENETICS OF ARABIDOPSIS THALIANA CHASE BALLARD LINDA EAN HECTOR LOPEZ DR. JOANNA WERNER-FRACZEK IN COLLABORATION WITH DR. PATRICIA SPRINGER S LAB AT UCR AND ROBERT KOBLE PURPOSE OF RESEARCH

More information

Plant Growth and Development

Plant Growth and Development Plant Growth and Development Concept 26.1 Plants Develop in Response to the Environment Factors involved in regulating plant growth and development: 1. Environmental cues (e.g., day length) 2. Receptors

More information

GFP GAL bp 3964 bp

GFP GAL bp 3964 bp Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive

More information

Classical Selection, Balancing Selection, and Neutral Mutations

Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected

More information

Supplementary Table 1. Primers used in this study.

Supplementary Table 1. Primers used in this study. Supplementary Tale 1. Primers used in this study. Name Primer sequence (5'-3') Primers of PCR-ased molecular markers developed in this study M1 F M1 R M2 F M2 R M3 F M3 R M4 F M4 R M5 F M5 R M6 F M6 R

More information

Plant Molecular and Cellular Biology Lecture 10: Plant Cell Cycle Gary Peter

Plant Molecular and Cellular Biology Lecture 10: Plant Cell Cycle Gary Peter Plant Molecular and Cellular Biology Lecture 10: Plant Cell Cycle Gary Peter 9/10/2008 1 Learning Objectives Explain similarities and differences between fungal, mammalian and plant cell cycles Explain

More information

Written Exam 15 December Course name: Introduction to Systems Biology Course no

Written Exam 15 December Course name: Introduction to Systems Biology Course no Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Discussion Rationale for using maternal ythdf2 -/- mutants as study subject To study the genetic basis of the embryonic developmental delay that we observed, we crossed fish with different

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative

More information

7.06 Problem Set #4, Spring 2005

7.06 Problem Set #4, Spring 2005 7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain

More information

Pea Compound Leaf Architecture Is Regulated by Interactions among the Genes UNIFOLIATA, COCHLEATA, AFILA, and TENDRIL-LESS

Pea Compound Leaf Architecture Is Regulated by Interactions among the Genes UNIFOLIATA, COCHLEATA, AFILA, and TENDRIL-LESS The Plant Cell, Vol. 12, 1279 1294, August 2000, www.plantcell.org 2000 American Society of Plant Physiologists Pea Compound Leaf Architecture Is Regulated by Interactions among the Genes UNIFOLIATA, COCHLEATA,

More information

Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1

Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR

More information

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION med!1,2 Wild-type (N2) end!3 elt!2 5 1 15 Time (minutes) 5 1 15 Time (minutes) med!1,2 end!3 5 1 15 Time (minutes) elt!2 5 1 15 Time (minutes) Supplementary Figure 1: Number of med-1,2, end-3, end-1 and

More information

The mode of development in animals and plants is different

The mode of development in animals and plants is different The mode of development in animals and plants is different Outcome of animal embryogenesis is a mini edition of the adult Outcome of plant embryogenesis is a simple structure with -root apical meristem

More information

CONTROL SYSTEMS IN PLANTS

CONTROL SYSTEMS IN PLANTS AP BIOLOGY PLANTS FORM & FUNCTION ACTIVITY #5 NAME DATE HOUR CONTROL SYSTEMS IN PLANTS HORMONES MECHANISM FOR HORMONE ACTION Plant Form and Function Activity #5 page 1 CONTROL OF CELL ELONGATION Plant

More information

Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis W

Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis W The Plant Cell, Vol. 18, 3399 3414, December 2006, www.plantcell.org ª 2006 American Society of Plant Biologists Genetic Characterization and Functional Analysis of the GID1 Gibberellin Receptors in Arabidopsis

More information

Review of molecular biology

Review of molecular biology Review of molecular biology DNA is into RNA, which is into protein. What mrna sequence would be transcribed from the DNA template CTA? What sequence of trna would be attracted by the above mrna sequence?

More information

Gene Regulation and Expression

Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium that contains more than 4000 genes.

More information

Regulation of Phosphate Homeostasis by microrna in Plants

Regulation of Phosphate Homeostasis by microrna in Plants Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,

More information

A MicroRNA as a Translational Repressor of APETALA2 in Arabidopsis Flower Development

A MicroRNA as a Translational Repressor of APETALA2 in Arabidopsis Flower Development A MicroRNA as a Translational Repressor of APETALA2 in Arabidopsis Flower Development Xuemei Chen Waksman Institute, Rutgers University, Piscataway, NJ 08854, USA. E-mail: xuemei@waksman.rutgers.edu Plant

More information

(Dimocarpus longan Lour.)

(Dimocarpus longan Lour.) Institute of Crop Science Section of Crop Physiology University of Hohenheim Physiological and Molecular mechanisms of flowering in longan (Dimocarpus longan Lour.) Palumpom Tiyayon VERLAG GRAUER' Stuttgart.

More information

7. Summary of avocado tree architecture.

7. Summary of avocado tree architecture. 53 7. Summary of avocado tree architecture. Architectural tree models, defined by F. Hallé, R.A.A. Oldeman and P.B. Tomlinson (1978), are relatively new concepts in plant morphology that have gained wide

More information

Developmental Analysis of a Medicago truncatula smooth leaf margin1 Mutant Reveals Context-Dependent Effects on Compound Leaf Development W OA

Developmental Analysis of a Medicago truncatula smooth leaf margin1 Mutant Reveals Context-Dependent Effects on Compound Leaf Development W OA This article is a Plant Cell Advance Online Publication. The date of its first appearance online is the official date of publication. The article has been edited and the authors have corrected proofs,

More information

Crop Development and Components of Seed Yield. Thomas G Chastain CSS 460/560 Seed Production

Crop Development and Components of Seed Yield. Thomas G Chastain CSS 460/560 Seed Production Crop Development and Components of Seed Yield Thomas G Chastain CSS 460/560 Seed Production White clover seed field Seed Yield Seed yield results from the interaction of the following factors: 1. Genetic

More information

Gene regulation I Biochemistry 302. Bob Kelm February 25, 2005

Gene regulation I Biochemistry 302. Bob Kelm February 25, 2005 Gene regulation I Biochemistry 302 Bob Kelm February 25, 2005 Principles of gene regulation (cellular versus molecular level) Extracellular signals Chemical (e.g. hormones, growth factors) Environmental

More information

Reproduction, Seeds and Propagation

Reproduction, Seeds and Propagation Reproduction, Seeds and Propagation Diploid (2n) somatic cell Two diploid (2n) somatic cells Telophase Anaphase Metaphase Prophase I One pair of homologous chromosomes (homologues) II Homologues condense

More information

Correlation between flowering time, circadian rhythm and gene expression in Capsella bursa-pastoris

Correlation between flowering time, circadian rhythm and gene expression in Capsella bursa-pastoris Correlation between flowering time, circadian rhythm and gene expression in Capsella bursa-pastoris Johanna Nyström Degree project in biology, Bachelor of science, 2013 Examensarbete i biologi 15 hp till

More information

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,

More information

Cytokinin. Fig Cytokinin needed for growth of shoot apical meristem. F Cytokinin stimulates chloroplast development in the dark

Cytokinin. Fig Cytokinin needed for growth of shoot apical meristem. F Cytokinin stimulates chloroplast development in the dark Cytokinin Abundant in young, dividing cells Shoot apical meristem Root apical meristem Synthesized in root tip, developing embryos, young leaves, fruits Transported passively via xylem into shoots from

More information

CBSE Quick Revision Notes (Class-11 Biology) CHAPTER-15 PLANT GROWTH AND DEVELOPMENT

CBSE Quick Revision Notes (Class-11 Biology) CHAPTER-15 PLANT GROWTH AND DEVELOPMENT CBSE Quick Revision Notes (Class-11 Biology) CHAPTER-15 PLANT GROWTH AND DEVELOPMENT Root, stem leaves, flower, fruits and seeds arise in orderly manner in plants. The sequence of growth is as follows-

More information

Lesson Overview. Ribosomes and Protein Synthesis 13.2

Lesson Overview. Ribosomes and Protein Synthesis 13.2 13.2 The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to mrna. This transcribed information contains a code for making proteins. The Genetic

More information

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation. Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *

More information

Computational identification and analysis of MADS box genes in Camellia sinensis

Computational identification and analysis of MADS box genes in Camellia sinensis www.bioinformation.net Hypothesis Volume 11(3) Computational identification and analysis of MADS box genes in Camellia sinensis Madhurjya Gogoi*, Sangeeta Borchetia & Tanoy Bandyopadhyay Department of

More information

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner ABA represses the transcription of chloroplast genes Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner Supplementary data Supplementary tables Table

More information

Capsicum annuum S (CaS) promotes reproductive transition and is required for flower formation in pepper (Capsicum annuum)

Capsicum annuum S (CaS) promotes reproductive transition and is required for flower formation in pepper (Capsicum annuum) Research Capsicum annuum S (CaS) promotes reproductive transition and is required for flower formation in pepper (Capsicum annuum) Oded Cohen, Yelena Borovsky, Rakefet David-Schwartz and Ilan Paran Institute

More information

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny

More information

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang

More information

Genome-Wide Analysis of Gene Expression during Early Arabidopsis Flower Development

Genome-Wide Analysis of Gene Expression during Early Arabidopsis Flower Development Genome-Wide Analysis of Gene Expression during Early Arabidopsis Flower Development Frank Wellmer, Márcio Alves-Ferreira a, Annick Dubois b, José Luis Riechmann, Elliot M. Meyerowitz * Division of Biology,

More information

Lecture 18 June 2 nd, Gene Expression Regulation Mutations

Lecture 18 June 2 nd, Gene Expression Regulation Mutations Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase

More information

Integrative Biology 200A "PRINCIPLES OF PHYLOGENETICS" Spring 2012 University of California, Berkeley

Integrative Biology 200A PRINCIPLES OF PHYLOGENETICS Spring 2012 University of California, Berkeley Integrative Biology 200A "PRINCIPLES OF PHYLOGENETICS" Spring 2012 University of California, Berkeley B.D. Mishler Feb. 7, 2012. Morphological data IV -- ontogeny & structure of plants The last frontier

More information

Supplemental Data. Hou et al. (2016). Plant Cell /tpc

Supplemental Data. Hou et al. (2016). Plant Cell /tpc Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence

More information

Predicting Protein Functions and Domain Interactions from Protein Interactions

Predicting Protein Functions and Domain Interactions from Protein Interactions Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput

More information

REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E

REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,

More information

Stamina pistilloida, the Pea Ortholog of Fim and UFO, Is Required for Normal Development of Flowers, Inflorescences, and Leaves

Stamina pistilloida, the Pea Ortholog of Fim and UFO, Is Required for Normal Development of Flowers, Inflorescences, and Leaves The Plant Cell, Vol. 13, 31 46, January 2001, www.plantcell.org 2001 American Society of Plant Physiologists RESEARCH ARTICLE Stamina pistilloida, the Pea Ortholog of Fim and UFO, Is Required for Normal

More information

Cell Cycle Regulation by Chlamydomonas Cyclin-Dependent Protein Kinases

Cell Cycle Regulation by Chlamydomonas Cyclin-Dependent Protein Kinases Plant Cell Advance Publication. Published on February 5, 2018, doi:10.1105/tpc.18.00103 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 IN BRIEF Cell Cycle Regulation by Chlamydomonas

More information

RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus

RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus Haiwei Lu and Steven H. Strauss Oregon State University Forest Tree Workshop PAG XXVI, San Diego, CA, 2018 The containment issue

More information

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary

More information

Multiple Choice Review- Eukaryotic Gene Expression

Multiple Choice Review- Eukaryotic Gene Expression Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule

More information

Simon Scofield, Walter Dewitte, and James AH Murray* School of Biosciences; Cardiff University; Cardiff, UK

Simon Scofield, Walter Dewitte, and James AH Murray* School of Biosciences; Cardiff University; Cardiff, UK Short Communication Plant Signaling & Behavior 9, e28934; April; 2014 Landes Bioscience Short Communication STM sustains stem cell function in the Arabidopsis shoot apical meristem and controls KNOX gene

More information

16. TRANSMISSION OF STIMULUS - THEORIES OF FLOWERING.

16. TRANSMISSION OF STIMULUS - THEORIES OF FLOWERING. 16. TRANSMISSION OF STIMULUS - THEORIES OF FLOWERING. Photoperiodic Induction The influence of the length of day and night on the initiation of flowering is called photoperiodic induction or photo induction.

More information

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha

Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Gene expression in prokaryotic and eukaryotic cells, Plasmids: types, maintenance and functions. Mitesh Shrestha Plasmids 1. Extrachromosomal DNA, usually circular-parasite 2. Usually encode ancillary

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Microarray analysis Grains of 7 DAP of the wild-type and gif1 were harvested for RNA preparation. Microarray analysis was performed with the Affymetrix (Santa Clara, CA) GeneChip

More information

Introduction. Gene expression is the combined process of :

Introduction. Gene expression is the combined process of : 1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression

More information

Table S1 List of primers used for genotyping and qrt-pcr.

Table S1 List of primers used for genotyping and qrt-pcr. Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!

More information