MiGA: The Microbial Genome Atlas
|
|
- Mariah Bond
- 5 years ago
- Views:
Transcription
1 December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A.
2 Where I m From Michigan State University - 50,000 students (11,000 graduate students) College of Agriculture & Natural Resources Department of Plant Soil & Microbial Sciences Center for Microbial Ecology - Study the interactions of microbes with each other and with their environment. 1
3 Relationship to Health Sciences Microbiome: the microorganisms in a particular environment (including the body or a part of the body). Only 10% of the cells in your body are human! ~23,000 human genes 1,000,000+ genes in human microbiome
4 Outline of My Presentation Background Material MiGA, the Microbial Genome Atlas 3
5 One Representation of the Tree of Life
6 Can you name these bacteria? From: Ch Terrestrial Bacteria from Agricultural Soils: By Masoomeh Shams-Ghahfarokhi, Sanaz Kalantari and Mehdi Razzaghi-Abyaneh DOI: /
7 Elucidation of the three domains of life Carl Woese ( ) Ribosomal RNA sequence as phylogenetic marker Discovered 3 rd kingdom Archaea and Bacteria separate domains Contrast with former Prokaryote hypothesis
8 Phylogenetic Tree of Life Three domains of life based on the work of Carl Woese and colleagues 7
9 Ribosomes Universal Marker Subunits 30S 50S rrna 16S 23S 5S Protein synthesis factory. Core function present in all cellular organisms. Very little evidence of horizontal gene transfer. Historically easy to work with. Purify by centrifugation and extract rrna. Now we use PCR to amplify from genomic DNA rrna genes have conserved regions interspersed with highly variable regions. Conserved regions used for both PCR primers and sequencing primers. 8
10 Diversity of uncultured organisms explored by rrna sequencing David A. Stahl, David J. Lane, Gary J. Olsen and Norman R. Pace Science, New Series, Vol. 224, No (Apr. 27, 1984), pp Published by: American Association for the Advancement of Science
11 Hydrothermal Vent Black Smoker 10
12 Explosion in rrna Sequencing By 2008, the majority of all bacterial sequences submitted to GenBank were 16S rrna sequences Less than 2% of these had a Latin name attached (valid or not) (R. Christen, 2008)
13 Growth of rrna data 3.5 Release 11.4: 3,333,501 sequences Environmental Sequences Isolate Sequences No. of Sequences (in Millions) Year 0
14 Limits of rrna Phylogeny Slowly evolving - Can t resolve species Short sequence, ~1550 bases High random error Can add LSU rrna, but database is limited
15 Genes Beyond rrna rrna genes are slowly evolving and present in multiple copies. Other single-copy conserved genes are faster evolving. Many important ecological functions are encoded by genes that are horizontally transferred. Their evolutionary history does not match that of rrna. 14
16 rplb vs 16S Pariwise Distances in one Order (RefSeq Genomes) Jiarong Guo
17 1995 Haemophilus influenzae genome published
18 Bacterial and Archaeal Genomes from cultured organisms (INSDC 9/4/2017) (Compare to >3 million rrna genes) 8227 Complete Genomes 1469 Genomes with Gaps Scaffolds Contigs only Isolate genomes in total Now cheaper to obtain draft genome than single 16S rrna 15 years ago!
19 Microbial Genomes from Uncultured Organisms Single Cell Genomes: Single microbial cells are separated before sequencing Issues: Incomplete genomes, enzymatic DNA amplification causes artifacts Metagenomic Binning: Grouped from metagenomic assemblies Issues: Incomplete genomes, may mix allelic variants, contamination an issue
20
21 Objectives of the MiGA project How would you taxonomically classify a novel genome? How would you build a novel classification for a collection of genomes? In other words: to built the genome-equivalent of the Ribosomal Database Project (RDP) based on the ANI/AAI approach.
22 Multi-Gene Phylogenetic Analysis Use additional universal marker genes Universal: transcription translation replication Choose for no horizontal gene transfer Unfortunately, few genes meet these criteria genes commonly used Compare all genes common between each pair of organisms (Average Identity) Uses larger part of available genome Robust to missing data (partial genomes)
23 Introduction to the Pangenome Of Terms in Biology: The Pan-Genome by Christoph Weigel In Small Things Considered June 12, 2014 schaechter.asmblog.org
24 Horizontal gene transfer occurs more readily between closely related organisms
25 Need to find comparable genes Homologous: for ANI method The existence of shared ancestry between a pair of genes. Orthologous: Inherited by two organisms from the same ancestral sequence. (Usually same function.) Paralogous: Originally created by a duplication event within a single genome. (May have different functions.)
26 Reciprocal Best Matches - Likely Orthologs Strain A genes Strain B genes
27 Best matches not reciprocal - Potential Paralogs? Strain A genes Strain B genes
28 ANI: Average Nucleotide Identity AAI: Average Amino Acid Identity haai: Heuristic AAI Implementation Rodriguez-R & Konstantinidis 2016 PeerJ Preprint 27
29 Detect not-previously described (novel) taxa % of genome pairs in a taxonomic rank Novel taxa are determined at species, genus & phylum levels Novel species <95% AAI Novel genus <65% AAI Novel phylum <45% AAI
30 Average Nucleotide Identity - a replacement for DDH Among available genome relatedness indices, average nucleotide identity (ANI) is one of the of the most robust measurements of genomic relatedness between strains, and has great potential in the taxonomy of bacteria and archaea as a substitute for the labour-intensive DNA DNA hybridization (DDH) technique. Kim et al., IJSEM February 2014 vol. 64 no. Pt
31 MiGA uses average Identity 30
32
33 Hierarchical approach genome classification 1 Bacterium vs archeon, 1 CPU 2 Two E. coli genomes, 1 CPU 32
34 Hierarchical approach to genome classification 1 In the NCBI RefSeq database 2 Phylum, genus, or distant species 33
35 Pre-clustering references AAI or ANI distances Medoid clustering 34
36 Query the clustering Medoid clustering 35
37
38 Input data types and project types Genome classification against reference Clade project
39 MiGA s genome clasification output (in part)
40 16S rrna taxonomy and quality metrics
41 Genome contamination analysis with MyTaxa MyTaxa* scan of assembled Salmonella from a stool metagenome Detecting chimeras, areas to focus for manual checking, HGT Soon available through:
42 So many bad quality genomes. What to do? MyTaxa_Scan of a submitted genome B. cereus in 95% of the sequence, Streptococcus pneumoniae in the rest and 16S Detecting chimeras, areas to focus for manual checking, HGT
43 Clade project See also the ogs.* utilities in the Enveomics Collection
44 Pangenome calculation in a clade project Enveomics Collection: Rodriguez-R & Konstantinidis, PeerJ 2016
45 Medoid clustering to call clades Very robust separation even among closely related genome of B. anthracis (>99.5% ANI)
46 45
Microbiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics
More informationMicrobial Taxonomy. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationPhylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationChapter 19. Microbial Taxonomy
Chapter 19 Microbial Taxonomy 12-17-2008 Taxonomy science of biological classification consists of three separate but interrelated parts classification arrangement of organisms into groups (taxa; s.,taxon)
More informationChapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships
Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic
More informationA. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationBergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms
Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral
More informationMacroevolution Part I: Phylogenies
Macroevolution Part I: Phylogenies Taxonomy Classification originated with Carolus Linnaeus in the 18 th century. Based on structural (outward and inward) similarities Hierarchal scheme, the largest most
More informationMETHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
More informationCh 10. Classification of Microorganisms
Ch 10 Classification of Microorganisms Student Learning Outcomes Define taxonomy, taxon, and phylogeny. List the characteristics of the Bacteria, Archaea, and Eukarya domains. Differentiate among eukaryotic,
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationName: Class: Date: ID: A
Class: _ Date: _ Ch 17 Practice test 1. A segment of DNA that stores genetic information is called a(n) a. amino acid. b. gene. c. protein. d. intron. 2. In which of the following processes does change
More informationInterpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder
Interpreting the Molecular Tree of Life: What Happened in Early Evolution? Norm Pace MCD Biology University of Colorado-Boulder nrpace@colorado.edu Outline What is the Tree of Life? -- Historical Conceptually
More informationMethods for Microbiome Analysis
Classroom Lecture 4 December 2015 Methods for Microbiome Analysis James R. Cole Director, RDP (Ribosomal Database Project) Center for Microbial Ecology Michigan State University East Lansing, Michigan
More informationChapter 17. Table of Contents. Objectives. Taxonomy. Classifying Organisms. Section 1 Biodiversity. Section 2 Systematics
Classification Table of Contents Objectives Relatebiodiversity to biological classification. Explainwhy naturalists replaced Aristotle s classification system. Identifythe main criterion that Linnaeus
More informationOutline. I. Methods. II. Preliminary Results. A. Phylogeny Methods B. Whole Genome Methods C. Horizontal Gene Transfer
Comparative Genomics Preliminary Results April 4, 2016 Juan Castro, Aroon Chande, Cheng Chen, Evan Clayton, Hector Espitia, Alli Gombolay, Walker Gussler, Ken Lee, Tyrone Lee, Hari Prasanna, Carlos Ruiz,
More informationStepping stones towards a new electronic prokaryotic taxonomy. The ultimate goal in taxonomy. Pragmatic towards diagnostics
Stepping stones towards a new electronic prokaryotic taxonomy - MLSA - Dirk Gevers Different needs for taxonomy Describe bio-diversity Understand evolution of life Epidemiology Diagnostics Biosafety...
More informationPhylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationPhylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26
Phylogeny Chapter 26 Taxonomy Taxonomy: ordered division of organisms into categories based on a set of characteristics used to assess similarities and differences Carolus Linnaeus developed binomial nomenclature,
More informationMicrobial Diversity and Assessment (II) Spring, 2007 Guangyi Wang, Ph.D. POST103B
Microbial Diversity and Assessment (II) Spring, 007 Guangyi Wang, Ph.D. POST03B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm General introduction and overview Taxonomy [Greek
More informationMicrobiology / Active Lecture Questions Chapter 10 Classification of Microorganisms 1 Chapter 10 Classification of Microorganisms
1 2 Bergey s Manual of Systematic Bacteriology differs from Bergey s Manual of Determinative Bacteriology in that the former a. groups bacteria into species. b. groups bacteria according to phylogenetic
More informationOutline. Classification of Living Things
Outline Classification of Living Things Chapter 20 Mader: Biology 8th Ed. Taxonomy Binomial System Species Identification Classification Categories Phylogenetic Trees Tracing Phylogeny Cladistic Systematics
More informationFitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
More informationMicrobiology Helmut Pospiech
Microbiology http://researchmagazine.uga.edu/summer2002/bacteria.htm 05.04.2018 Helmut Pospiech The Species Concept in Microbiology No universally accepted concept of species for prokaryotes Current definition
More informationOrigins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life
The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life
More informationIntroduction to Evolutionary Concepts
Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq
More informationBacillus anthracis. Last Lecture: 1. Introduction 2. History 3. Koch s Postulates. 1. Prokaryote vs. Eukaryote 2. Classifying prokaryotes
Last Lecture: Bacillus anthracis 1. Introduction 2. History 3. Koch s Postulates Today s Lecture: 1. Prokaryote vs. Eukaryote 2. Classifying prokaryotes 3. Phylogenetics I. Basic Cell structure: (Fig.
More informationWhat examples can you think of?
What examples can you think of? Geocentrism Alchemy Heliocentrism: Copernicus, Kepler, Newton, Galileo Nature of the chemical bond (Rutherford, Pauling ) Aristotelian view of the biosphere Woese/Pace (subject
More informationChapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin
More informationAssigning Taxonomy to Marker Genes. Susan Huse Brown University August 7, 2014
Assigning Taxonomy to Marker Genes Susan Huse Brown University August 7, 2014 In a nutshell Taxonomy is assigned by comparing your DNA sequences against a database of DNA sequences from known taxa Marker
More informationBLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010
BLAST Database Searching BME 110: CompBio Tools Todd Lowe April 8, 2010 Admin Reading: Read chapter 7, and the NCBI Blast Guide and tutorial http://www.ncbi.nlm.nih.gov/blast/why.shtml Read Chapter 8 for
More informationBLAST. Varieties of BLAST
BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: http://testbankair.com/download/test-bankfor-microbiology-a-systems-approach-3rd-by-cowan/ Chapter 1: The Main Themes
More informationPhylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationThe Tree of Life. Chapter 17
The Tree of Life Chapter 17 1 17.1 Taxonomy The science of naming and classifying organisms 2000 years ago Aristotle Grouped plants and animals Based on structural similarities Greeks and Romans included
More informationUnit 5: Taxonomy. KEY CONCEPT Organisms can be classified based on physical similarities.
KEY CONCEPT Organisms can be classified based on physical similarities. Linnaeus developed the scientific naming system still used today. Taxonomy is the science of naming and classifying organisms. White
More informationSec$on 9. Evolu$onary Rela$onships
Sec$on 9 Evolu$onary Rela$onships Sec$on 9 Learning Goals Explain why the ribosomal 16S gene is a good marker for molecular phylogene$c comparisons. Be able to interpret a phylogene$c tree. Explain the
More informationHomology and Information Gathering and Domain Annotation for Proteins
Homology and Information Gathering and Domain Annotation for Proteins Outline Homology Information Gathering for Proteins Domain Annotation for Proteins Examples and exercises The concept of homology The
More informationChapter 18 Systematics: Seeking Order Amidst Diversity
Chapter 18 Systematics: Seeking Order Amidst Diversity Bird Diversity in Indonesia Chapter 18 At a Glance 18.1 How Are Organisms Named and Classified? 18.2 What Are the Domains of Life? 18.1 How Are Organisms
More informationMICROBIAL BIOCHEMISTRY BIOT 309. Dr. Leslye Johnson Sept. 30, 2012
MICROBIAL BIOCHEMISTRY BIOT 309 Dr. Leslye Johnson Sept. 30, 2012 Phylogeny study of evoluhonary relatedness among groups of organisms (e.g. species, populahons), which is discovered through molecular
More informationComparing Prokaryotic and Eukaryotic Cells
A prokaryotic cell Basic unit of living organisms is the cell; the smallest unit capable of life. Features found in all cells: Ribosomes Cell Membrane Genetic Material Cytoplasm ATP Energy External Stimuli
More informationInferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT
Inferring phylogeny Constructing phylogenetic trees Tõnu Margus Contents What is phylogeny? How/why it is possible to infer it? Representing evolutionary relationships on trees What type questions questions
More informationTitle ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses
More information08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
More informationMicrobial Taxonomy and Phylogeny: Extending from rrnas to Genomes
Microbial Taxonomy and Phylogeny: Extending from rrnas to Genomes Dr. Kostas Konstantinidis Department of Civil and Environmental Engineering & Department of Biology (Adjunct), Center for Bioinformatics
More informationThe practice of naming and classifying organisms is called taxonomy.
Chapter 18 Key Idea: Biologists use taxonomic systems to organize their knowledge of organisms. These systems attempt to provide consistent ways to name and categorize organisms. The practice of naming
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationGenome Annotation. Bioinformatics and Computational Biology. Genome sequencing Assembly. Gene prediction. Protein targeting.
Genome Annotation Bioinformatics and Computational Biology Genome Annotation Frank Oliver Glöckner 1 Genome Analysis Roadmap Genome sequencing Assembly Gene prediction Protein targeting trna prediction
More informationUoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)
- Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the
More informationMicrobial Taxonomy. C. Microbes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy 1. Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eucaryote, is in a mess we are stuck with it for traditional
More informationTest Bank for Microbiology A Systems Approach 3rd edition by Cowan
Test Bank for Microbiology A Systems Approach 3rd edition by Cowan Link download full: https://digitalcontentmarket.org/download/test-bank-formicrobiology-a-systems-approach-3rd-edition-by-cowan Chapter
More informationComparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationComparative Bioinformatics Midterm II Fall 2004
Comparative Bioinformatics Midterm II Fall 2004 Objective Answer, part I: For each of the following, select the single best answer or completion of the phrase. (3 points each) 1. Deinococcus radiodurans
More informationBacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria
Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria Seminar presentation Pierre Barbera Supervised by:
More information9/19/2012. Chapter 17 Organizing Life s Diversity. Early Systems of Classification
Section 1: The History of Classification Section 2: Modern Classification Section 3: Domains and Kingdoms Click on a lesson name to select. Early Systems of Classification Biologists use a system of classification
More informationChapters 25 and 26. Searching for Homology. Phylogeny
Chapters 25 and 26 The Origin of Life as we know it. Phylogeny traces evolutionary history of taxa Systematics- analyzes relationships (modern and past) of organisms Figure 25.1 A gallery of fossils The
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationTaxonomy and Clustering of SSU rrna Tags. Susan Huse Josephine Bay Paul Center August 5, 2013
Taxonomy and Clustering of SSU rrna Tags Susan Huse Josephine Bay Paul Center August 5, 2013 Primary Methods of Taxonomic Assignment Bayesian Kmer Matching RDP http://rdp.cme.msu.edu Wang, et al (2007)
More informationConcept Modern Taxonomy reflects evolutionary history.
Concept 15.4 Modern Taxonomy reflects evolutionary history. What is Taxonomy: identification, naming, and classification of species. Common Names: can cause confusion - May refer to several species (ex.
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Detailed overview of the primer-free full-length SSU rrna library preparation.
Supplementary Figure 1 Detailed overview of the primer-free full-length SSU rrna library preparation. Detailed overview of the primer-free full-length SSU rrna library preparation. Supplementary Figure
More informationPhylogeny and the Tree of Life
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 26 Phylogeny and the Tree of Life
More informationBiodiversity. The Road to the Six Kingdoms of Life
Biodiversity The Road to the Six Kingdoms of Life How the 6 kingdoms came about At first, only two kingdoms were recognized Then Haeckel proposed a third kingdom Protista (where protists had both plant
More informationCLASSIFICATION OF LIVING THINGS. Chapter 18
CLASSIFICATION OF LIVING THINGS Chapter 18 How many species are there? About 1.8 million species have been given scientific names Nearly 2/3 of which are insects 99% of all known animal species are smaller
More informationIntroduction to polyphasic taxonomy
Introduction to polyphasic taxonomy Peter Vandamme EUROBILOFILMS - Third European Congress on Microbial Biofilms Ghent, Belgium, 9-12 September 2013 http://www.lm.ugent.be/ Content The observation of diversity:
More informationFig. 26.7a. Biodiversity. 1. Course Outline Outcomes Instructors Text Grading. 2. Course Syllabus. Fig. 26.7b Table
Fig. 26.7a Biodiversity 1. Course Outline Outcomes Instructors Text Grading 2. Course Syllabus Fig. 26.7b Table 26.2-1 1 Table 26.2-2 Outline: Systematics and the Phylogenetic Revolution I. Naming and
More informationClassification and Phylogeny
Classification and Phylogeny The diversity of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme
More informationChapter 19 Organizing Information About Species: Taxonomy and Cladistics
Chapter 19 Organizing Information About Species: Taxonomy and Cladistics An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationMicrobial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
More informationClassification and Phylogeny
Classification and Phylogeny The diversity it of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize without a scheme
More informationCHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
More informationChapter 17. Organizing Life's Diversity
Chapter 17 Organizing Life's Diversity Key Concepts: Chapter 17 1. List the 3 domains and the 6 kingdoms. 2. Our current system of classification was originally based on structures; scientists now base
More informationScience Unit Learning Summary
Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In
More information10 Biodiversity Support. AQA Biology. Biodiversity. Specification reference. Learning objectives. Introduction. Background
Biodiversity Specification reference 3.4.5 3.4.6 3.4.7 Learning objectives After completing this worksheet you should be able to: recall the definition of a species and know how the binomial system is
More informationModern cellular organisms. From
Modern cellular organisms From http://www.ucmp.berkeley.edu/exhibit/phylogeny.html Endothelial cell Lysosomes, mitochondria and nucleus See the cellular cytoskeleton, ER and nucleus Modern cells are complex
More informationBiodiversity. The Road to the Six Kingdoms of Life
Biodiversity The Road to the Six Kingdoms of Life How the 6 kingdoms came about At first, only two kingdoms were recognized Then Haeckel proposed a third kingdom Protista (where protists had both plant
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationRobert Edgar. Independent scientist
Robert Edgar Independent scientist robert@drive5.com www.drive5.com "Bacterial taxonomy is a hornets nest that no one, really, wants to get into." Referee #1, UTAX paper Assume prokaryotic species meaningful
More informationThis is a repository copy of Microbiology: Mind the gaps in cellular evolution.
This is a repository copy of Microbiology: Mind the gaps in cellular evolution. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/114978/ Version: Accepted Version Article:
More informationCurriculum Links. AQA GCE Biology. AS level
Curriculum Links AQA GCE Biology Unit 2 BIOL2 The variety of living organisms 3.2.1 Living organisms vary and this variation is influenced by genetic and environmental factors Causes of variation 3.2.2
More informationSCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of
More informationExploring Microbes in the Sea. Alma Parada Postdoctoral Scholar Stanford University
Exploring Microbes in the Sea Alma Parada Postdoctoral Scholar Stanford University Cruising the ocean to get us some microbes It s all about the Microbe! Microbes = microorganisms an organism that requires
More informationSection 18-1 Finding Order in Diversity
Name Class Date Section 18-1 Finding Order in Diversity (pages 447-450) Key Concepts How are living things organized for study? What is binomial nomenclature? What is Linnaeus s system of classification?
More informationLecture 11 Friday, October 21, 2011
Lecture 11 Friday, October 21, 2011 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean system
More informationGenomics and Bioinformatics
Genomics and Bioinformatics Associate Professor Bharat Patel Genomes in terms of earth s history: Earth s environment & cellular evolution Genomes in terms of natural relationships: (Technology driven
More informationBiology 211 (2) Week 1 KEY!
Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of
More information9.3 Classification. Lesson Objectives. Vocabulary. Introduction. Linnaean Classification
9.3 Classification Lesson Objectives Outline the Linnaean classification, and define binomial nomenclature. Describe phylogenetic classification, and explain how it differs from Linnaean classification.
More informationBiology Assessment. Eligible Texas Essential Knowledge and Skills
Biology Assessment Eligible Texas Essential Knowledge and Skills STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules
More informationTaxonomical Classification using:
Taxonomical Classification using: Extracting ecological signal from noise: introduction to tools for the analysis of NGS data from microbial communities Bergen, April 19-20 2012 INTRODUCTION Taxonomical
More informationC3020 Molecular Evolution. Exercises #3: Phylogenetics
C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from
More informationSTAAR Biology Assessment
STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules as building blocks of cells, and that cells are the basic unit of
More informationSPECIATION. REPRODUCTIVE BARRIERS PREZYGOTIC: Barriers that prevent fertilization. Habitat isolation Populations can t get together
SPECIATION Origin of new species=speciation -Process by which one species splits into two or more species, accounts for both the unity and diversity of life SPECIES BIOLOGICAL CONCEPT Population or groups
More informationClassification, Phylogeny yand Evolutionary History
Classification, Phylogeny yand Evolutionary History The diversity of life is great. To communicate about it, there must be a scheme for organization. There are many species that would be difficult to organize
More information