Fluorescence Resonance Energy Transfer-Based DNA nanoprism with a Split Aptamer for ATP sensing in living cells

Transcription

1 Supporting Information Fluorescence Resonance Energy Transfer-Based DNA nanoprism with a Split Aptamer for sensing in living cells Xiaofang Zheng, Ruizi Peng, Xi Jiang, Yaya Wang, Shuai Xu, Guoliang Ke, Ting Fu, Qiaoling Liu, Shuangyan Huan*, Xiaobing Zhang Molecular Science and Biomedicine Laboratory, State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, College of Biology, Hunan University, Changsha , P. R. China. * shuangyanhuan@163.com; Tel: S-1

2 Table of contents 1. Synthesis... S-3 DNA synthesis..... S-3 Construction of the TP nanostructure.... S-3 2. Supporting Tables and Figures... S-5 Table S1... S-5 Figure S1.... S-5 Figure S S-6 Figure S S-6 Figure S4.... S-7 Figure S S-7 Figure S6.... S-8 Figure S S-8 Figure S S-9 Table S2... S-9 3. References... S-12 S-2

3 1. Synthesis DNA synthesis. DNA sequences were synthesized on DNA synthesizer (PolyGen GmbH, Langen, Germany). The synthesis protocol was set up according to the requirements specified by the reagents manufacturers. After on-machine synthesis, the DNA products were deprotected and cleaved from CPG at 65 C in water bath, which incubating with 2 ml of AMA (Ammonium Hydroxide and 40 % methylamine, 1:1) for normal deprotection in 30 min, and 2 ml mixed solution(methanol: tertbutylamine: water in 1:1:2 ratio) for Cy3 and Cy5 modified DNA strands in 3-4 hours, respectively. The cleaved DNA product was transferred into a 15 ml centrifuge tube and mixed with 200 µl of 3 M NaCl and 5 ml of ethanol, after which the sample was placed into a freezer at -20 C for ethanol precipitation. Afterwards, the DNA product was spun at 4000 rpm under 4 C for 30 min. The supernatant was removed, and the precipitated DNA product was dissolved in 400 µl of 0.1 M Triethylamine Acetate (TEAA) for HPLC purification. HPLC purification was performed with a cleaned C18 column (Inertsil ODS-3, 5 µm, mm, GL Science Inc., Japan) on 1260 infinity Agilent HPLC (Agilent Technologies, Germany). The collected DNA product was dried and processed for detritylation by dissolving and incubating in 200 µl of 80% acetic acid for 20 min. The detritylated DNA product was mixed with 20 µl of 3 M NaCl and 500 µl of ethanol and placed into a freezer at -20 C for 30 min. Afterwards, the DNA product was spun at rpm under 4 C for 5 min. The DNA product was dried by a vacuum dryer and resolved with ultrapure water, followed by desalting with desalting columns. Construction of the TP nanostructure. DNA nanoprism were synthesized by mixing equimolar sequences (DNA strands were shown in Table S1) in 1 TAE/Mg 2+ buffer S-3

4 (20 mm Tris-acetic acid, 2 mm EDTA and 12.5 mm magnesium acetate, balanced to ph 7.5). Followed by the annealing protocol using an automated polymerase chain reaction (PCR) thermocycler: 95 C for 5 min, 80 C for 30 min, 79 C for 30 min, 79 C for 30 min and then cooled to 4 C in 1.5 h. The final concentration of the TP was estimated to be 1.5 µm, which was stored at 4 C in the dark as a stock solution for further use. S-4

5 2. Supporting Tables and Figures Table S1. Sequences of oligonucleotides used in this work. The small character t is the corner of the three clips (S1, S2, S3), which represents a short non-base pairing spacer to decrease steric hindrance.three 96-base DNA sequences (S1, S2, S3) containing four 20-base edges, separated by four thymine (T) vertices, self-assembled into the DNA TP scaffold. The blue, red sequances in -Apt1, -Apt2 sequances represent the molecule recognition part on the top and bottom face of TP. Name Sequences (5-3 ) S1 TCG CTG AGT A ttttcca CCA CCA AAC CAC ATT TG tttt GCA AGT GTG GGC ACG CAC AC tttt CGC ACC GCG ACT GCG AGG AC tttt CAC AAA TCT G S2 CAC TGG TCA G tttt ATC AAG AAG CCG AAT TGA AG tttt TAC TCA GCG ACA GAT TTG TG tttt CGC TCT TCT ATA CTG GCG GA tttt GGT TTG CTG A S3 CCA CAC TTG C tttt CAA CCC ACA ATC CCA GTG TG tttt CTG ACC AGT GTC AGC AAA CC tttt CCA TGA CGA TGC ACT ACA TG tttt GTG TGC GTG C -Apt 1 -Apt 2 Cy3---ACCTGGGGGAGTATTTTTTTTTTTTGGTTTGGTGGTGG TGCGGAGGAAGGT(Cy5)TTTTTTTTTTAGTATAGAAGAGCG S-5

6 Figure S1. 5% Native Polyacrylamide gel electrophoresis Dynamic behavior of DNA triangular prism. (A) The results of split aptamer decoration of triangular prisms, running at 110 V for 70 min. Line 1: 20bp DNA ladder; Line 2: TP; Line 3: TP+Apt1; Line 4: TP+Apt1+Apt2. The gels were imaged using a Bio-Rad ChemiDoc XRS System. (B) The gels were run in the absence and in the presence, respectively, of 5 mm. Line 1: 20bp DNA ladder; Line 2 and 3: TP+Apt1+Apt2; Line 4-6: TP+Apt1+Apt2+5 mm, running at 100 V for 60 min. Figure S2. A two-step assembly of TP and modification of -Apt1, -Apt2 on the TP. S-6

7 Figure S3. The size of the TP was estimated according to the circum circle diameter model. 1 The 20-base edge (a) of TP was approximately 6.8 nm, so the radius (r) of the circumscribed circle of the bottom face was r= ( 2 / 3) ( 3 / 2) a= 3. 9 nm. And the distance from center of sphere to the bottom face center was d=a/2=3.4 nm. There, 2 2 according to Pythagorean theorem, R = = 5. 2 nm. The circum circle diameter of the rigid TP construction was estimated to be 5.2 2=10.4 nm. Figure S4. Determination of the size of the DNA TP nanostructure through Dynamic Light Scattering (DLS), Size: (16.0± 2.0 nm). S-7

8 Figure S5. Kinetics study of DNA nanoprism complex. Real-time recording of the fluorescence intensity changes of DNA nanoprism complex as a function of time upon addition of (5 mm).the excitation wavelength was fixed at 525 nm (Cy3), and the emission wavelength of 665 nm (Cy5). Figure S6. Fluorescence emission intensity ratio (F A /F D ) of 50 nm DNA TP nanoprobe with 5 mm, CTP, GTP, UTP, Respectively. S-8

9 Figure S7. PAGE analysis of the DNase I (0.25 U/mL) degradation assay products for (A) DNA TP nanoprobe and (B) ssdna probe at 37 C. Figure S8. Cell viability assay: Hela cells treated with different concentration of the DNA TP nanoprobe (0, 50, 100, 200, 400 nm) for 24 h at 37 C. Table S2 Advantages and limitations of different methods for detection and imaging. Tool Application Sample, Location Detection range (mm) Pros Cons Refs. Luciferase HEK cells, Sensitivity, Requires (2) S-9

10 bioluminesce high transfection and nce assay dynamics Hela cells, affinity bioluminescence; relies on the (3) concentration of luciferase, oxygen and luciferin Synthesized Yeast cells, Unique Need cell lysis to (4) fluorescent specificity, perform the dyes not require cellular detection In vitro ~ transfectio of in buffer (5) 10-5 ~0.1 n solutions (6) Organic dynamics HEK293 ~0.1 Combine Require organic (7) fluorescent cell, fluorescent synthesis, probes Membrane dye time-consuming, dynamics Hela cells, OSCC cells, molecules with designed receptors for cannot be used for imaging in living cells (8) (9) Apt-AuNPs Hela cells, Sensitivity, Require material (10) high synthesis, Adenosine dynamics Yeast cells, Yeast cells, affinity time-consuming, ~6 background (11) signal stability cannot avoid, (12) stability cannot solve, cannot be used for quantitative detection of cellular Apt-PDANs MCF Sensitivity, Require material (13) cells, high synthesis, affinity time-consuming, S-10

11 cytotoxicity, background signal stability cannot avoid, stability cannot solve,cannot be used for quantitative detection of cellular Apt-GO-nS/ JB6 cells, Sensitive, Long-term (14) GO specific for biosecurity is Hela cells, structurally uncertain for live similar cell studies, since (15) molecules, the biosecurity of not require transfectio n, suitable for visualizati on study nanomaterials has not been demonstrated yet, cannot be used for quantitative, GTP, adenosine derivates, guanosine derivates MCF-7 cells, detection of cellular (16), GTP MCF-7 cells, (17) DNA Hela cells Switchable, Low rate of (18) nanostructure high affinity, aptamer-diacyllip real-time id conjugates, and in situ cannot be used monitoring for quantitative detection of S-11

12 capability cellular Hela cells synthesized Cannot be used (19) with high for quantitative yields, with detection of high cell cellular permeability and stability In vitro With high Assembly is (20) affinity, high complex, specificity, time-consuming, and good and costly biocompatib ility, Hela cells simple, Cannot be used This work programmab for quantitative le, high cell detection of permeability cellular and stability, low background, low cytotoxicity, real-time and in situ monitoring capability S-12

13 3. References (1) Liu, Y.; Chen, Q. S.; Liu, J. B.; Yang, X. H.; Guo, Q. P.; Li, L.; Liu, W.; Wang, K. M. Anal. Chem. 2017, 89, (2) Tsuboi, T.; Lippiat, J. D.; Ashcroft, F. M.; Rutter, G. A. Proc. Natl. Acad. Sci. USA 2004, 101, (3) Kim, J. H.; Ahn, J. H.; Barone, P. W.; Jin, H.; Zhang, J.; Heller, D. A.; Strano, M. S. Angew. Chem., Int. Ed. 2010, 49, (4) Jose, D. A.; Mishra, S.; Ghosh, A.; Shrivastav, A.; Mishra, S. K.; Das, A. Org. Lett. 2007, 9, (5) Ojida, A.; Nonaka, H.; Miyahara, Y.; Tamaru, S.; Sada, K.; Hamachi, I. Angew. Chem., Int. Ed. 2006, 45, (6) Li, C.; Numata, M.; Takeuchi, M.; Shinkai, S. Angew. Chem., Int. Ed. 2005, 44, (7) Kurishita, Y.; Kohira, T.; Ojida, A.; Hamachi, I. J. Am. Chem. Soc. 2012, 134, (8) Tang, J. L.; Li, C. Y.; Li, Y. F.; Zou, C. X. Chem. Commun. 2014, 50, (9) Wang, L.; Yuan, L.; Zeng, X.; Peng, J.; Ni, Y.; Er, J. C.; Xu, W.; Agrawalla, B. K.; Su, D. D.; Kim, B.; Chang, Y. T. Angew. Chem., Int. Ed. 2015, 128, (10) Zheng, D.; Seferos, D. S.; Giljohann, D. A.; Patel, P. C.; Mirkin, C.A. Nano Lett. 2009, 9, (11) Nielsen, L. J.; Olsen, L. F.; Ozalp, V. C. Acs Nano 2010, 4, (12) Ouml;Zalp, V. C.; Nielsen, L. J.; Olsen, L. F. Chembiochem 2010, 11, (13) Qiang, W.; Hu, H.; Sun, L.; Li, H.; Xu, D. Anal. Chem. 2015, 87, (14) Wang, Y.; Li, Z.; Hu, D.; Lin, C. T.; Li, J.; Lin, Y. J. Am. Chem. Soc. 2010, 132, (15)Tan, X. H.; Chen, T.; Xiong, X. L.; Mao, Y.; Zhu, G. Z.; Yasun, E.; Li, C. M.; Zhu, Z.; Tan, W. S-13

14 H. Anal. Chem. 2012, 84, (16) Wang, Y.; Li, Z. H.; Weber, T. J.; Hu, D. H.; Lin, C. T.; Li, J. H.; Lin, Y. Anal. Chem. 2013, 85, (17) Wang, Y.; Tang, L.H.; Li, Z. H.; Lin, Y. H.; Li, J. H. Nat. Protoc. 2014, 9, (18) Wu, C. C.; Chen, T.; Han, D.; You, M. X.; Peng, L.; Cansiz, S.; Zhu, G. Z.; Li, C. M.; Xiong, X. L.; Jimenez, L.; Yang, C. Y. J.; Tan, W. H. Acs Nano 2013, 7, (19) Pei, H.; Liang, L.; Yao, G. B.; Li, J., Huang, Q.; Fan, C. H. Angew. Chem., Int. Ed. 2012, 51, (20) Walter, H. K.; Bauer, J.; Steinmeyer, J.; Kuzuya, A.; Niemeyer, C. M.; Wagenknecht, H. A. Nano Letters 2017, 17, S-14