Collecting flies for genomic research: workflow at Smithsonian NMNH and Biorepository
|
|
|
- Rudolf Ross Butler
- 6 years ago
- Views:
Transcription
1 1 Collecting flies for genomic research: workflow at Smithsonian NMNH and Biorepository Torsten Dikow #asiloidflies doi: /m9.figshare Smithsonian National Museum of Natural History
2 NMNH Biorepository cryo-preservation facility at Museum Support Center 20 liquid nitrogen tanks (-190 C) 43 mechanical chest freezers (-80 C) new type of collection not taxonomically focused vial with mammal tissue right next to vial with insect specimen FreezerPro 2 Biorepository images Smithsonian Institution, Don Hurlbert
3 Global Genome Initiative Global Genome Initiative GGI headquarter at NMNH Jonathan Coddington director Seán Brady research 3 Collect and barcode a synoptic sample of Earth s genomic diversity... Cryo-preserve 50% of the diversity of life in the next five years and make these collections available for research, with appropriate access and benefit sharing Increase computational support and technological capacity to sequence genomes Train the next generation of genomics researchers in biodiversity science GGI
4 Global Genome Biodiversity Network Global Genome Biodiversity Network GGBN headquarter at NMNH bioinformatics at BGBM (Botanischer Garten und Botanisches Museum Berlin-Dahlem) currently 36 member institutions and five collaborating institutions A global network of well-managed collections of genome quality tissue samples from across the Tree of Life, benefiting society through biodiversity research, development, and conservation. 4 GGBN
5 Global Genome Biodiversity Network 5 AA6GE27
6 collecting genome-quality flies 6 goal is to preserve specimens in liquid N 2 not new methodology done by vertebrate collectors for years and some entomologists allows both RNA and DNA to be sequenced we need to think about preserving specimens for genome sequencing! vouchers / exemplars extremely important to have vouchers / exemplars that are not in liquid N 2 applying unique specimen identifiers in the field specimen records will be connected by unique identifiers separate identifier for pinned specimen, liquid N 2 specimen, and leg for COI barcoding recording specimen-level data in the field FIMS (Field Information Management System) import into EMu
7 collecting genome-quality flies disclaimer research taxa (Apioceridae, Asilidae, and Mydidae) collected by hand-net one specimen at a time generic identification possible in field identification of conspecific specimens also possible I want to sequence genomes of asiloid flies for phylogenetic research! field work in southern Arizona and California in April Scleropogon duncani in the field field site E of Portal, AZ
8 collecting genome-quality flies in the field flies kept alive in individual vials at particular site once several specimens of same species collected, next few preserved in ethyl acetate for pinning specimens destined for liquid N 2 placed in a small cooler later transferred to fridge at hotel in the evening flies pinned unique identifier (USNMENTXXXXXX) attached to pin record databased conspecific specimen placed in pre-labeled vial with two unique identifiers USNMENTXXXXXX + Biorepository (AA8IQ05) 8 pinned flies in the field USNMENT on pin USNMENT AA8IQ05 in vial
9 collecting genome-quality flies in the evening flies pinned unique identifier (USNMENTXXXXXX) attached to pin record databased conspecific specimen placed in pre-labeled vial with two unique identifiers USNMENTXXXXXX + Biorepository (AA8IQ05) 9 USNMENT on pin USNMENT AA8IQ05 in vial
10 collecting genome-quality flies in the evening wrap vials in aluminum foil drop vials into liquid N 2 dry shipper 10
11 collecting genome-quality flies in the evening take legs off for COI barcoding pinned exemplar specimen USNMENT liquid N 2 specimen USNMENT AA8IQ05 new leg record USNMENT USNMENT of hind leg
12 back at NMNH pinned flies special label indicating exemplar status added to collection liquid N 2 -preserved specimens added to Biorepository vial location recorded in FreezerPro based on unique identifier AA8IQ05 specimen / leg records uploaded from FIMS into EMu 12 Scleropogon duncani pinned specimens
13 back at NMNH 13 USNMENT on pin in USNM USNMENT record AA8IQ05 in Biorepository AA8IQ05 record
14 sequencing a genome Proctacanthus coquilletti large fly (5 cm long) with plenty of thoracic muscle tissue sequenced DNA from one specimen on two lanes of HiSeq 2500 (goal 60x coverage) DISCOVAR de novo assembly genome size = 420 Million bp N50 = 790,000 bp 98% gene recovery (evaluated through BUSCO and OrthoDB) 14 Proctacanthus coquilletti in the field
15 conclusions let s collect specimens for genome sequencing 15 genomic diversity needs to be preserved now as it might vanish soon GGI and NMNH Biorepository would be happy to store your genomic specimens accessibility to these samples can be negotiated Mike Gates and Matt Buffington (USDA SEL) have workflow for parasitoid wasps
16 acknowledgements data import and troubleshooting Patricia Gentili-Poole and Michael Lloyd NMNH Biorepository Chris Huddleston discussions Jonathan Coddington 16 presentation PDF doi: /m9.figshare Asiloid Flies blog: bit.ly/1j0bnxd Smithsonian National Museum of Natural History
Archiving of OCS Invertebrate Specimens and Genomic Tissue Samples. NMNH, Department of Invertebrate Zoology April 2018 SAML Annual Meeting
Archiving of OCS Invertebrate Specimens and Genomic Tissue Samples NMNH, Department of Invertebrate Zoology April 2018 SAML Annual Meeting Department of Invertebrate Zoology invertebrates.si.edu Dr. Ellen
DNA Barcoding and taxonomy of Glossina
DNA Barcoding and taxonomy of Glossina Dan Masiga Molecular Biology and Biotechnology Department, icipe & Johnson Ouma Trypanosomiasis Research Centre, KARI The taxonomic problem Following ~250 years of
The study of insect species diversity and modern approaches
The study of insect species diversity and modern approaches Humala A.E. Forest Research Institute Karelian Research Centre RAS Petrozavodsk, RUSSIA The main idea and aim of any research TO FILL THE GAPS
DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity
DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity DNA barcoding has inspired a global initiative dedicated to: Creating a library of new knowledge about species
Animal Sound Archives and Zoological Museums
Animal Sound Archives and Zoological Museums Do they share a common purpose? Can one take on the other s s tasks? Gustav Peters, ZFMK, Bonn, Germany Animal Sound Archives Purpose and Tasks - Collection/acquisition
Amy Driskell. Laboratories of Analytical Biology National Museum of Natural History Smithsonian Institution, Wash. DC
DNA Barcoding Amy Driskell Laboratories of Analytical Biology National Museum of Natural History Smithsonian Institution, Wash. DC 1 Outline 1. Barcoding in general 2. Uses & Examples 3. Barcoding Bocas
Introduction to Biosystematics. Course Website: Lecture 1: Introduction to Biological Systematics Outline: The role and value of Systematics
Introduction to Biosystematics Course Website: http://homepages.ucalgary.ca/~dsikes/courses.htm Check weekly for lecture updates, readings, etc. D. S. Sikes University of Calgary There have been many authorities
W. John Kress TRACKING EVOLUTIONARY DIVERSITY AND PHYLOGENETIC STRUCTURE ACROSS GLOBAL FOREST DYNAMICS PLOTS USING PLANT DNA BARCODES
TRACKING EVOLUTIONARY DIVERSITY AND PHYLOGENETIC STRUCTURE ACROSS GLOBAL FOREST DYNAMICS PLOTS USING PLANT DNA BARCODES 6 th international Barcode of Life Conference Guelph, 2015 W. John Kress 50-ha Forest
THE FORGOTTEN POLLINATORS : FILLING A BIODIVERSITY INFORMATION GAP. Jonathan F. Colville Applied Biodiversity Research, SANBI
THE FORGOTTEN POLLINATORS : FILLING A BIODIVERSITY INFORMATION GAP Jonathan F. Colville Applied Biodiversity Research, SANBI South Africa s Terrestrial Biodiversity: World renowned flora! Well studied
USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES
USING BLAST TO IDENTIFY PROTEINS THAT ARE EVOLUTIONARILY RELATED ACROSS SPECIES HOW CAN BIOINFORMATICS BE USED AS A TOOL TO DETERMINE EVOLUTIONARY RELATIONSHPS AND TO BETTER UNDERSTAND PROTEIN HERITAGE?
Ants in the Heart of Borneo a unique possibility to join taxonomy, ecology and conservation
Ants in the Heart of Borneo a unique possibility to join taxonomy, ecology and conservation Carsten Brühl, University Landau, Germany 1 Borneo Interior mountain ranges of Central Borneo represent the only
Creating an e-flora for South Africa
SANBI POLICY DOCUMENT DIVISION: Biosystematics Research and Biodiversity Collections EFFECTIVE DATE: 1 April 2014 Compiler: Marianne le Roux & Janine Victor POLICY NUMBER: LAST AMENDED: Creating an e-flora
Digitisation of insect collections An Australian perspective
Digitisation of insect collections An Australian perspective Beth Mantle Pacific Science Inter-Congress, Suva, Fiji 10 July 2013 AUSTRALIAN NATIONAL INSECT COLLECTION Infrastructure: the IT world since
The Saguaro Genome. Toward the Ecological Genomics of a Sonoran Desert Icon. Dr. Dario Copetti June 30, 2015 STEMAZing workshop TCSS
The Saguaro Genome Toward the Ecological Genomics of a Sonoran Desert Icon Dr. Dario Copetti June 30, 2015 STEMAZing workshop TCSS Why study a genome? - the genome contains the genetic information of an
Curation of Zoological Collections
Entomologie II Managing and Curating Museum Collections II: Curation of Zoological Collections Part 1: Entomological Collections [im Rahmen des Workshopprogramms der Goethe Graduate Academy (GRADE), 19.
10 Biodiversity Support. AQA Biology. Biodiversity. Specification reference. Learning objectives. Introduction. Background
Biodiversity Specification reference 3.4.5 3.4.6 3.4.7 Learning objectives After completing this worksheet you should be able to: recall the definition of a species and know how the binomial system is
1.1. KEY CONCEPT Biologists study life in all its forms. 4 Reinforcement Unit 1 Resource Book. Biology in the 21st Century CHAPTER 1
1.1 THE STUDY OF LIFE KEY CONCEPT Biologists study life in all its forms. Biology is the scientific study of all forms of life. Living things are found almost everywhere on Earth, from very hot environments
Postgraduate teaching for the next generation of taxonomists
Postgraduate teaching for the next generation of taxonomists Alfried P. Vogler Professor of Molecular Systematics Imperial College London and Natural History Museum MSc in Taxonomy and Biodiversity MRes
Phylogenetic diversity and conservation
Phylogenetic diversity and conservation Dan Faith The Australian Museum Applied ecology and human dimensions in biological conservation Biota Program/ FAPESP Nov. 9-10, 2009 BioGENESIS Providing an evolutionary
DRMREEF: DNA taxonomy and Recruitment Monitoring of the Coral Reef Marine Organisms
DRMREEF: DNA taxonomy and Recruitment Monitoring of the Coral Reef Marine Organisms 2015. 05. 13 Youn-Ho Lee Korea Institute of Ocean Science and Technology I. Objectives To enhance national and regional
AToL: Collaborative research on ant phylogeny: a comprehensive evolutionary tree for the world s premier social organisms
AToL: Collaborative research on ant phylogeny: a comprehensive evolutionary tree for the world s premier social organisms NSF EF-0431330; 10/01/2004 09/30/2009 P.S.Ward1, Seán Brady2, Brian Fisher3 & Ted
Modern Evolutionary Classification. Section 18-2 pgs
Modern Evolutionary Classification Section 18-2 pgs 451-455 Modern Evolutionary Classification In a sense, organisms determine who belongs to their species by choosing with whom they will mate. Taxonomic
Organizing Life s Diversity
17 Organizing Life s Diversity section 2 Modern Classification Classification systems have changed over time as information has increased. What You ll Learn species concepts methods to reveal phylogeny
Molecular Genetics for Aquatic and Marine Biodiversity Conservation
Molecular Genetics for Aquatic and Marine Biodiversity Conservation Course Code: 176040H01... Overview In a wider standpoint, conservation genetics uses a combination of ecology, molecular biology, population
Background: Imagine it is time for your lunch break, you take your sandwich outside and you sit down to enjoy your lunch with a beautiful view of
Background: Imagine it is time for your lunch break, you take your sandwich outside and you sit down to enjoy your lunch with a beautiful view of Montana s Rocky Mountains. As you look up, you see what
Microbiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and
Genomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
A minimalist barcode can identify a specimen whose DNA is degraded
Molecular Ecology Notes (2006) 6, 959 964 doi: 10.1111/j.1471-8286.2006.01470.x Blackwell Publishing Ltd BARCODING A minimalist barcode can identify a specimen whose DNA is degraded MEHRDAD HAJIBABAEI,*
Censusing the Sea in the 21 st Century
Censusing the Sea in the 21 st Century Nancy Knowlton & Matthieu Leray Photo: Ove Hoegh-Guldberg Smithsonian s National Museum of Natural History Estimates of Marine/Reef Species Numbers (Millions) Marine
Homeotic Genes and Body Patterns
Homeotic Genes and Body Patterns Every organism has a unique body pattern. Although specialized body structures, such as arms and legs, may be similar in makeup (both are made of muscle and bone), their
BIODIVERSITY: STRUCTURE AND FUNCTION Vol. I - Data and Information Management and Communication - Walter G. Berendsohn
DATA AND INFORMATION MANAGEMENT AND COMMUNICATION Walter G. Freie Universität Berlin, Botanic Garden and Botanical Museum Berlin-Dahlem, Germany Keywords: Biodiversity informatics, biological informatics,
Shaw Nature Reserve. Preserving and documenting diversity By Garrett Billings
Shaw Nature Reserve Preserving and documenting diversity By Garrett Billings History of Shaw Nature Reserve Burned frequently Native Americans Natural fire regimes Used almost exclusively as agriculture
Bio 1M: The evolution of apes. 1 Example. 2 Patterns of evolution. Similarities and differences. History
Bio 1M: The evolution of apes 1 Example Humans are an example of a biological species that has evolved Possibly of interest, since many of your friends are probably humans Humans seem unique: How do they
Genome Assembly. Sequencing Output. High Throughput Sequencing
Genome High Throughput Sequencing Sequencing Output Example applications: Sequencing a genome (DNA) Sequencing a transcriptome and gene expression studies (RNA) ChIP (chromatin immunoprecipitation) Example
Post-doc fellowships to non-eu researchers FINAL REPORT. Home Institute: Centro de Investigaciones Marinas, Universidad de La Habana, CUBA
Recipient: Maickel Armenteros Almanza. Post-doc fellowships to non-eu researchers FINAL REPORT Home Institute: Centro de Investigaciones Marinas, Universidad de La Habana, CUBA Promoter: Prof. Dr. Wilfrida
DNA barcoding is a technique for characterizing species of organisms using a short DNA sequence from a standard and agreed-upon position in the
DNA barcoding is a technique for characterizing species of organisms using a short DNA sequence from a standard and agreed-upon position in the genome. DNA barcode sequences are very short relative to
Theory a well supported testable explanation of phenomenon occurring in the natural world.
Evolution Theory of Evolution Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution the process by which modern organisms changed over time from ancient common
Computational Biology, University of Maryland, College Park, MD, USA
1 Data Sharing in Ecology and Evolution: Why Not? Cynthia S. Parr 1 and Michael P. Cummings 2 1 Institute for Advanced Computer Studies, 2 Center for Bioinformatics and Computational Biology, University
Traditional and emergent molecular techniques to characterize species biodiversity and ecosystem health (plus a bunch of other stuff)
Traditional and emergent molecular techniques to characterize species biodiversity and ecosystem health (plus a bunch of other stuff) Heather Bracken Grissom Florida International University Tracey Sutton,
Use of DNA metabarcoding to identify plants from environmental samples: comparisons with traditional approaches
Use of DNA metabarcoding to identify plants from environmental samples: comparisons with traditional approaches Christine E. Edwards 1, Denise L. Lindsay 2, Thomas Minckley 3, and Richard F. Lance 2 1
UoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)
- Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the
Chapter 16: Reconstructing and Using Phylogenies
Chapter Review 1. Use the phylogenetic tree shown at the right to complete the following. a. Explain how many clades are indicated: Three: (1) chimpanzee/human, (2) chimpanzee/ human/gorilla, and (3)chimpanzee/human/
Background: Comment [1]: Comment [2]: Comment [3]: Comment [4]: mass spectrometry
![Background: Comment [1]: Comment [2]: Comment [3]: Comment [4]: mass spectrometry](/thumbs/78/77840982.jpg "Background: Comment [1]: Comment [2]: Comment [3]: Comment [4]: mass spectrometry")
Background: Imagine it is time for your lunch break, you take your sandwich outside and you sit down to enjoy your lunch with a beautiful view of Montana s Rocky Mountains. As you look up, you see what
Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Title ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses
Phylogeny is the evolutionary history of a group of organisms. Based on the idea that organisms are related by evolution
Bio 1M: Phylogeny and the history of life 1 Phylogeny S25.1; Bioskill 11 (2ndEd S27.1; Bioskills 3) Bioskills are in the back of your book Phylogeny is the evolutionary history of a group of organisms
Plant Names and Classification
Plant Names and Classification Science of Taxonomy Identification (necessary!!) Classification (order out of chaos!) Nomenclature (why not use common names?) Reasons NOT to use common names Theophrastus
Q-bank An Online DNA Barcode Database For Identification Of Quarantine Organisms
Poster D16 Q-bank An Online DNA Barcode Database For Identification Of Quarantine Organisms presented by Ewald (J.Z.) Groenewald www.q-bank.eu EPPO European and Mediterranean Plant Protection Organization
Eric D. Stein Biology Department
Eric D. Stein Biology Department The Promise of Molecular Methods Faster answers Weeks vs. months Less expensive Better data Recognizing misidentifications Improving taxonomic keys Helping with difficult
Potential of metatranscriptomics as indicator for ecosystem level diversity and function. diversitv Prof. Dr. Jens Boenigk. Department.
Department Bio diversitv Prof. Dr. Jens Boenigk From traditional bioindication......via metabarcoding & molecular diversity......to monitoring functional genes From traditional bioindication......via metabarcoding
DATA and KNOWLEDGE INFRASTRUCTURE ANALYTICS, KNOWLEDGE DISSEMINATION
DATA and KNOWLEDGE INFRASTRUCTURE ANALYTICS, KNOWLEDGE DISSEMINATION Contributors from multiple sectors add to Map of Life Consumers use Map of Life knowledge for societal needs BUT TO PROPERLY USE THESE
Survey Protocols for Monitoring Status and Trends of Pollinators
Survey Protocols for Monitoring Status and Trends of Pollinators This annex presents the bee monitoring protocols to be applied in the context of monitoring status and trends of pollinators in STEP sites.
Anatomy of a species tree
Anatomy of a species tree T 1 Size of current and ancestral Populations (N) N Confidence in branches of species tree t/2n = 1 coalescent unit T 2 Branch lengths and divergence times of species & populations
BIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
SEM studies on fruit and seed of some Chenopodium L. species (Chenopodiaceae)
SEM studies on fruit and seed of some Chenopodium L. species (Chenopodiaceae) Jagna Karcz 1, Bozena Kolano 2, Jolanta Maluszynska 2 University of Silesia, Faculty of Biology and Environmental Protection
Project Budget: State Wildlife Grant Requested: $16,412 Project Match (UARK in kind services): $5,744 Total Project Cost: $22,156
Project Title: Genetic examination of the Ringed Crayfish species group, with special emphasis on the endemic Gapped Ringed Crayfish (Orconectes neglectus chaenodactylus) Project Summary: Morphological
Pest Species of Copitarsia Hampson in the Neotropics: Identification and Hosts
Pest Species of Copitarsia Hampson in the Neotropics: Identification and Hosts D R. M I C H A E L G. P O G U E U S D A S Y S T E M A T I C E N T O M O L O G Y L A B S M I T H S O N I A N I N S T I T U
Motivation for project:
Motivation for project: Shale Gas exploration and development requested of government by Oil Companies. Shale Gas Development Strategic Environment Assessment (SGD SEA) commissioned by DEA Biodiversity
The Living Environment Unit 4 History of Biologic Diversity Unit 15 Evolution: (15.2) Evidence of Evolution-class key. Name: Class key.
Name: Class key Period: Topic 15.2 assignments Pages/Sections Date Assigned Date Due Topic: Evidence for Evolution Objective: What scientific evidence supports evolution theory? Evidence supporting evolution
What is Forensic Entomology?
What is Forensic Entomology? Forensic Entomology is the use of insects and their arthropod relatives that inhabit decomposing remains to aid legal investigations. It is one of the many tools of forensic
PHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
Microbial Diversity. Yuzhen Ye I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University
Microbial Diversity Yuzhen Ye (yye@indiana.edu) I609 Bioinformatics Seminar I (Spring 2010) School of Informatics and Computing Indiana University Contents Microbial diversity Morphological, structural,
Correlations to Next Generation Science Standards. Life Sciences Disciplinary Core Ideas. LS-1 From Molecules to Organisms: Structures and Processes
Correlations to Next Generation Science Standards Life Sciences Disciplinary Core Ideas LS-1 From Molecules to Organisms: Structures and Processes LS1.A Structure and Function Systems of specialized cells
Species Tree Inference using SVDquartets
Species Tree Inference using SVDquartets Laura Kubatko and Dave Swofford May 19, 2015 Laura Kubatko SVDquartets May 19, 2015 1 / 11 SVDquartets In this tutorial, we ll discuss several different data types:
COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST
Big Idea 1 Evolution INVESTIGATION 3 COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST How can bioinformatics be used as a tool to determine evolutionary relationships and to
Biodiversity data, current gaps and work package efforts
Biodiversity data, current gaps and work package efforts Florian T. Wetzel 1, Veljo Runnel 2, Anton Güntsch 3, Urmas Köljalg 2 1 Museum für Naturkunde Berlin - Leibniz Institute for Evolution and Biodiversity
Lecture 7: Animal Liberation
Lecture 7: Animal Liberation Two arguments against speciesism Animal liberation and utilitarianism Animal liberation vs. biocentrism Are animal rights inviolable? Animal liberation and biodiversity conservation
A phylogenomic toolbox for assembling the tree of life
A phylogenomic toolbox for assembling the tree of life or, The Phylota Project (http://www.phylota.org) UC Davis Mike Sanderson Amy Driskell U Pennsylvania Junhyong Kim Iowa State Oliver Eulenstein David
Orthologous loci for phylogenomics from raw NGS data
Orthologous loci for phylogenomics from raw NS data Rachel Schwartz The Biodesign Institute Arizona State University Rachel.Schwartz@asu.edu May 2, 205 Big data for phylogenetics Phylogenomics requires
Priorities for the development of a European taxonomic information system
Beispielbild Priorities for the development of a European taxonomic information system Cornelia Löhne & Walter Berendsohn Botanischer Garten und Botanisches Museum Berlin-Dahlem Freie Universität Berlin
(POD) from Tree of Life: Integration Challenges from Yellow Slimy Things to Black Crunchy Stuff
Phyl-O Data (POD) from Tree of Life: Integration hallenges from Yellow Slimy Things to Black runchy Stuff Junhyong Kim Department of Biology Penn enter for Bioinformatics University of Pennsylvania Satellite
Prereq: Concurrent 3 CH
0201107 0201101 General Biology (1) General Biology (1) is an introductory course which covers the basics of cell biology in a traditional order, from the structure and function of molecules to the structure
Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley
Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley B.D. Mishler Feb. 14, 2018. Phylogenetic trees VI: Dating in the 21st century: clocks, & calibrations;
Radiation and Evolution of Metazoans: The Cambrian Explosion and the Burgess Shale Fossils. Geology 331, Paleontology
Radiation and Evolution of Metazoans: The Cambrian Explosion and the Burgess Shale Fossils Geology 331, Paleontology Marshall, 2006 Halkierids, which produced some of the small, shelly fossils of the Early
Air-sea Gas Exchange and Bio-surfactants: Low and High Wind Speed Extremes
Air-sea Gas Exchange and Bio-surfactants: Low and High Wind Speed Extremes A. Soloviev in collaboration with M. McGauley, S. Matt, M.Shivji, A. Tartar, N. Kurata, K. Vella, W. Perrie B. Haus, D. Ortiz-Suslow,
Proceedings of Association of Pacific Rim Universities (APRU) Research Symposium on University Museums: Forming a University Museum Collection
Proceedings of Association of Pacific Rim Universities (APRU) Research Symposium on University Museums: Forming a University Museum Collection Network as the Core of Frontier Research O-10 The Beaty Biodiversity
Introduction to de novo RNA-seq assembly
Introduction to de novo RNA-seq assembly Introduction Ideal day for a molecular biologist Ideal Sequencer Any type of biological material Genetic material with high quality and yield Cutting-Edge Technologies
Wolbachia PCR: Discover the Microbes Within!
Wolbachia PCR: Discover the Microbes Within! Overview of the Wolbachia Lab Insect identification DNA extraction PCR? Wolbachia lecture Bioinformatics ACAGATGTC TTGTAATCCG GCCGTTGGT GGCATAGGG AAAGGACAT
What makes things alive? CRITERIA FOR LIFE
What makes things alive? CRITERIA FOR LIFE Learning Goals I can determine if something is alive based on the criteria for life. I can describe the history of life on Earth. I can describe how organisms
Chapter 26 Phylogeny and the Tree of Life
Chapter 26 Phylogeny and the Tree of Life Chapter focus Shifting from the process of how evolution works to the pattern evolution produces over time. Phylogeny Phylon = tribe, geny = genesis or origin
Browsing Genes and Genomes with Ensembl
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
A DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
Evolutionary transitions to disparate light environments: approaching a genomics-collections rapport
Evolutionary transitions to disparate light environments: approaching a genomics-collections rapport Simon Tierney Hawkesbury Institute for the Environment Christian Ziegler photography Evolution of Vision
The Environment and Change Over Time
The Environment and Change Over Time Biological Evidence of Evolution What do you think? Read the two statements below and decide whether you agree or disagree with them. Place an A in the Before column
CLASS XI BIOLOGY NOTES CHAPTER 1: LIVING WORLD
CLASS XI BIOLOGY NOTES CHAPTER 1: LIVING WORLD Biology is the science of life forms and non-living processes. The living world comprises an amazing diversity of living organisms. In order to facilitate
Managing Mycological Mysteries
Managing Mycological Mysteries (Systematics and the Identification of Fungi) NPDN meeting March 2016 Megan Romberg USDA APHIS PPQ PHP NIS APHIS NIS Beltsville APHIS CPHST Beltsville APHIS NIS (Mycology)
Building the Tree of Life
Building the Tree of Life THINK ABOUT IT The process of identifying and naming all known organisms, living and extinct, is a huge first step toward the goal of systematics. Yet naming organisms is only
GIS Applications to Museum Specimens
GIS Applications to Museum Specimens Joseph Grinnell (1877 1939) At this point I wish to emphasize what I believe will ultimately prove to be the greatest value of our museum. This value will not, however,
The science behind the conservation of endangered species: My experiences with Australian and Japanese bats. Kyle N. Armstrong
The science behind the conservation of endangered species: My experiences with ustralian and Japanese bats Kyle N rmstrong The Kyoto University Museum This talk Why I am a Zoologist / Conservation Biologist
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of
Connecting Content Information Connections Research SAA Research Forum August
Connecting Content Information Connections Research SAA Research Forum August 23 2011 Richard T. Fischer, MLS Information Connections Research Intern Connecting Content: Project Background The California
DNA metabarcoding reveals diverse but selective diet of three-spined stickleback in a coastal ecosystem
DNA metabarcoding reveals diverse but selective diet of three-spined stickleback in a coastal ecosystem Jakubavičiūtė E* 1, Bergström U 2, Haenel Q 3, Bourlat SJ 4, Eklöf J 5 1 Nature Research Centre,
Warning: Some material in this presentation and related videos may be too graphic for some people. T. Trimpe 2009
Warning: Some material in this presentation and related videos may be too graphic for some people. T. Trimpe 2009 http://sciencespot.net/ What do they do? Forensic entomologists apply their knowledge of
Mitochondrial Genome Annotation
Protein Genes 1,2 1 Institute of Bioinformatics University of Leipzig 2 Department of Bioinformatics Lebanese University TBI Bled 2015 Outline Introduction Mitochondrial DNA Problem Tools Training Annotation
Laboratory Identification Labels, printers & software for laboratories
www.bradyeurope.com/labid Laboratory Identification s, printers & software for laboratories About BRADY Once you have worked with BRADY, our name will stick with you, (just like our labels) because BRADY
Amplicon Sequencing. Dr. Orla O Sullivan SIRG Research Fellow Teagasc
Amplicon Sequencing Dr. Orla O Sullivan SIRG Research Fellow Teagasc What is Amplicon Sequencing? Sequencing of target genes (are regions of ) obtained by PCR using gene specific primers. Why do we do
The Theory of Evolution
The Theory of Evolution Matthew Ferry Evolution The process by which different kinds of living organisms are thought to have developed and diversified from earlier forms during the history of the Earth.
Studying Life. Lesson Overview. Lesson Overview. 1.3 Studying Life
Lesson Overview 1.3 Characteristics of Living Things What characteristics do all living things share? Living things are made up of basic units called cells, are based on a universal genetic code, obtain
Name Class Date. biosphere biology metabolism biodiversity organism DNA. MAIN IDEA: Earth is home to an incredible diversity of life.
Section 1: The Study of Life KEY CONCEPT Biologists study life in all its forms. VOCABULARY biosphere biology metabolism biodiversity organism DNA species cell MAIN IDEA: Earth is home to an incredible