Biochemical properties of recombinant acetylcholinesterases with amino acid substitutions in the active site

Transcription

1 Appl. Entomol. Zool. 42 (3): (2007) Biochemical properties of recombinant acetylcholinesterases with amino acid substitutions in the active site Suenghyup OH, 1, * Toshinori KOZAKI, 2 Takashi TOMITA 2 and Yoshiaki KONO 1 1 Graduate School of Life and Environmental Sciences, University of Tsukuba; Ibaraki , Japan 2 Department of Medical Entomology, National Institute of Infectious Diseases; Shinjuku-ku, Tokyo , Japan (Received 26 July 2006; Accepted 31 January 2007) Abstract Several amino acid substitutions causing insensitivity have been found in the active site of Ace-paralogous acetylcholinesterase (AP-AChE); Gly119Ser (Culex pipiens, Anopheles gambiae), Ala201Ser (Aphis gossypii), Phe290Val (Nephotettix cincticeps), Ser331Phe (Myzus persicae, A. gossypii), Phe331Cys (Tetranychus urticae) and Phe331Trp (Cx. tritaeniorhynchus). To confirm the responsibility of these substitutions to the insensitivity, the six substitutions were introduced into the AP-AChE cdna of Cx. tritaeniorhynchus resistant strain (Toyama), and their biochemical properties were examined by using a baculovirus-insect cell system. The substitution Gly119Ser gave the enzyme a high level of insensitivity to carbamate insecticides but a slight insensitivity to organophosphates. On the other hand, an amino acid substitution Phe331Trp located in the acyl pocket induced a very high level of insensitivity to organophosphates and ten times lower insensitivity to carbamates. The amino acid replacement appear to render the acyl pocket less hydrophobic and smaller, and then alter the accessibility of the substrates and inhibitors to this site. Key words: Insensitive acetylcholinesterase; amino acid substitution; in vitro expression; Culex tritaeniorhynchus INTRODUCTION Acetylcholinesterase (AChE, EC ) is a key enzyme at the cholinergic synapses in the insect central nervous system, and the target of organophosphate and carbamate insecticides. Excessive use of these insecticides for pest control have evoked selection of resistance race in many insect species. More than 30 instances of modified AChE have been reported as a main mechanism of resistance since the first report of insensitive AChE to organophosphates in Tetranychus urticae (Smissaert, 1964; Voss and Matsumura, 1964). Recent molecular studies have revealed that the insensitivity of AChE is accompanied by amino acid replacements at or near the active site of the enzyme. In flies belonging to the suborder Brachycera, such as Drosophila melanogaster (Mutero et al., 1994) and Musca domestica (Kozaki et al., 2001; Walsh et al., 2001), several amino acid substitutions causing insensitivity to insecticides were found in Ace or Ace-orthologous AChE (AO-AChE). D. melanogaster has a single AChE gene in its genome (Adams et al., 2000). In other insect species that have two AChE genes in the genome, the amino acid substitution responsible for insensitivity has been found in a second type of AChE paralogous to Ace (AP-AChE) (Nabeshima et al., 2003, 2004; Weill et al., 2003). Several amino acid substitutions causing insensitivity have been found in the active site of AP-AChE; Gly119Ser (indicates a substitution from Gly to Ser, numbering of amino acid position follows the equivalent number of Torpedo californica AChE without notice) at the oxyanion hole in Culex pipiens (Weill et al., 2003), Anopheles gambiae (Weill et al., 2003) and An. albimanus (Weill et al., 2004); Phe331Trp at the acyl pocket in Cx. tritaeniorhynchus (Nabeshima et al., 2004) and Tetranychus kanzawai (Aiki et al., 2005); Ser331Phe in Myzus persicae (Nabeshima et al., 2003) and Aphis gossypii (Li and Han, 2002; Andrews et al., 2004; Toda et al., 2004) and Phe290Val at the acyl pocket in Nephotettix cincticeps (Terada et al., un- *To whom correspondence should be addressed at: shoh1975@goo.jp DOI: /aez

2 368 S. OH et al. published). As for substitutions Gly119Ser and Phe331Trp, their roles in insensitivity were examined by site directed mutagenesis (Weill et al., 2003; Oh et al., 2006). In the present study, therefore, 6 substitutions known to cause insensitivity in various species including positions of 119Gly and 331Phe were designed in the AP-AChE cdna of Cx. tritaeniorhynchus in order to examine their responsibility for changes in AChE biochemical properties. Names of insect AChE are now confused since the second AChE gene was discovered. After the discovery of the new AChE gene, two types of AChEs have been named freely by the workers. To avoid confusion, we use AO-AChE and AP-AChE for Drosophila Ace-orthologous and -paralogous gene family members, respectively, in the text. MATERIALS AND METHODS Chemicals. The organophosphorus compounds fenitroxon and DDVP, and carbamate compounds carbaryl and pirimicarb, were purchased from Wako Pure Chemical for inhibition assays, and eserine from Sigma. Other chemicals used for the experiment were analytical grade. Mutagenesis in AP-AChE cdna and production of recombinant baculovirus. An AP-AChE encoding region was amplified from the cdna of Cx. tritaeniorhynchus resistant strain (Toyama) by PfuUltra High-Fidelity DNA Polymerase with F99 (CACCTATTACATGCGACCTCTCCA) and R98 (CGGAAAACGGTGTTTAAATCT) at 95 C for 2 min, [95 C for 30 s, 56 C for 30 min and 72 C for 150 s] 30 cycles and 72 C for 10 min. The product was incorporated into pentr/sd/d- TOPO and then transferred to pdest8. Site directed mutagenesis was performed by QuikChange II Site-Directed Mutagenesis Kits (Stratagene) with PfuTurbo DNA Polymerase (Stratagene). FW455FCtAce2 (CCGAGGAGGGCTACTACTT- CATCATCTACTATCTAACTGAA) and RW455- FCtAce2 (TTCAGTTAGATAGTAGATGATGAA- GTAGTAGCCCTCCTCGG) were used to replace 331Trp with 331Phe that corresponds to the substitution in the insecticide susceptible strain of the mosquito Cx. tritaeniorhynchus (Nabeshima et al., 2004). Other mutations, Trp331Cys (TGG-TGT found in T. urticae) and Trp331Ser (TGG-TCA found in A. gossypii and M. persicae) were made by the same procedures mentioned above using specific primers. Mutations corresponding to Gly119Ser (GGC-AGC in Cx. pipiens), Ala201Ser (GCC- TCC in A. gossypii) and Phe290Val (TTC-GTC in N. cincticeps) were also obtained using cdna of 331Phe as a template. The seven cdnas of AChE obtained here are abbreviated as 331Phe, 119Ser, 201Ser, 290Val, 331Cys, 331Ser and 331Trp. Each cdna was ligated into pgem-t Easy (Promega). The vector that had an identical sequence of insert with the one in the previous report (Kozaki et al., 2002) was used in the next PCR with s95ctace (CACCATGTCGTCGATAAGTA- TGGTGG) and as98ctace by PfuUltra High-Fidelity DNA Polymerase DNA Polymerase (Stratagene) at 95 C for 2 min, [95 C for 30 s, 56 C for 30 min and 72 C for 150 s] 30 cycles and 72 C for 10 min. The product was ligated into pentr/ SD/D-TOPO (Invitrogen) following the manufacturer s instructions and then the AP-AChE encoding region was transferred to pdest 8 (Invitrogen) by LR clonase. Baculovirus was prepared as described in a previous paper (Kozaki et al., 2002). Expression of AChE in baculovirus-sf9 cell system. Sf9 cells were cultured in the serum free medium of Sf 900 SFM (Gibco BRL) containing 100 U/ml penicillin. The cells were infected with 331Phe, 119Ser, 201Ser, 290Val, 331Cys, 331Ser, 331Trp or the control virus without AChE cdna at an MOI (multiplicity of infection) of 8.0 and incubated at 27 C for 120 h. The cells were separated from medium by centrifugation at 900 g for 10 min and sonicated with buffer solution containing 0.1% Triton-X 100 for 3 min. Assay of AChE activity. The DTNB method by Ellman et al. (1961) was adapted for the determination of AChE activity with a minor modification as described by Mamiya et al. (1997). Forty microliters of enzyme source were added to each well of a microtiter plate containing 100 ml of 50 mm Tris- HCl buffer (ph 8.00) and 20 ml of DTNB solution (0.4 mm DTNB 1.5 mm NaHCO 3 ). Then 40 ml of substrate, 1.5 mm of acetylthiocholine (ATCh, replaced with other substrates when necessary), was added to each well. The enzyme mixture was incubated for 30 min with 10 min intervals at 25 C. Optical density was measured at 415 nm with a Microplate Reader Model 450 (Bio-Rad). For evaluation of Michaelis constant (K m ) values, concentra-

3 Biochemical Properties of Recombinant Acetylcholinesterases 369 tions of the substrate, ATCh, propionylthiocholine (PTCh) or butyrylthiocholine (BTCh) were assayed from 0.01 to 50 mm. Inhibition of AChE was measured by adding 40 ml of various concentrations of the inhibitors to the reaction mixture of the DTNB method 10 min before the incubation and observing residual activity after incubation. ATCh of 1.5 mm was used as substrate for the determination of AChE inhibition by inhibitors. All experiments were carried out in three replications and kinetic constants of AChE and I 50 were calculated using a computer program. RESULTS Production of AChE by expression of cdna Production of AChE was checked by DTNB assay method of AChE activity using ATCh as a substrate in the medium and cells of a baculovirus infected cell culture. Though the yield of the seven AChEs varied, more than 55% of the AChE activity was found in the cell fraction. Activity in the medium fraction was less than 45% of the total activity. Therefore, the subsequent assay for characterization of AChE was performed using homogenates of the cells as an enzyme source. AChE activity was negligible in the cells infected with recombinant virus containing a control virus without AChE cdna (less than 0.5%). Characterization of expressed AChE Substrate specificity of the AChEs was characterized using different substrates at various concentrations. K m values of 331Phe, 119Ser, 201Ser, 290Val, 331Cys, 331Ser and 331Trp are presented in Table 1. Sensitivities of the seven AChEs to the inhibitors, organophosphates and carbamates were determined and compared. The results are shown in Table Ser recombinant AChE Compared to 331Phe (AP-AChE of Cx. tritaeniorhynchus susceptible strain), AChE with a Gly119Ser substitution, showed greater K m values for ATCh, PTCh and BTCh (1.6 times, 7.5 times and 19.8 times, respectively). The affinity of 119Ser to substrates prominently decreased as the length of the substrate molecules become longer. In 119Ser, the I 50 values to fenitroxon and DDVP Table 1. Recombinant AChEs K m values of recombinant AChEs K m (m M) SE ATCh PTCh BTCh 331Phe Ser Ser Val Cys Ser Trp were M and M, respectively, which indicates 35.1 and 3.9 times more insensitive than 331Phe. For the monomethyl carbamates, carbaryl and eserine, the I 50 ratios of 119Ser to 331Phe were 3,328 times and 76 times, respectively, and these ratios indicate that the reduction of sensitivity to these carbamates was higher than that to organophosphates. The sensitivity of 119Ser was rather low to the dimethyl carbamate primicarb Ser recombinant AChE Compared to 331Phe, 201Ser recombinant AChE showed greater K m values for ATCh indicating low affinity of the enzyme to the substrate (2.1 times). 201Ser showed insensitivity to DDVP, carbaryl and pirimicarb, and slightly lower insensitivity to eserine. In particular, the sensitivity of 201Ser to pirimicarb was about 30 times lower than 331Phe Val recombinant AChE Compared to 331Phe, 290Val recombinant AChE showed greater K m values for ATCh and PTCh (1.52 times and 2.75 times, respectively). 290Val showed insensitivity to fenitroxon, DDVP, carbaryl, eserine and pirimicarb. In particular, 290Val showed more than 20 times insensitivity to DDVP, carbaryl and pirimicarb, while it became more sensitive to propaphos sulfone (Ratio: 0.3) Cys recombinant AChE Compared to 331Phe, 331Cys recombinant AChE showed greater K m values for ATCh and PTCh (4.0 times and 2.1 times, respectively). 331Cys showed insensitivity to DDVP, carbaryl and eserine Ser recombinant AChE Compared to 331Phe, 331Ser showed smaller K m values for ATCh and PTCh. 331Phe showed insensitivity to DDVP and carbaryl, and the same

4 370 S. OH et al. Table 2. I 50 values of recombinant AChEs Recombinant AChEs I 50 (M) SE Fenitroxon DDVP Carbaryl Eserine Pirimicarb Propaphos 331Phe Ser Ratio (119Ser/331Phe) 201Ser Ratio (201Ser/331Phe) 290Val Ratio (290Val/331Phe) 331Cys Ratio (331Cys/331Phe) 331Ser Ratio (331Ser/331Phe) 331Trp Ratio (331Trp/331Phe)

5 Biochemical Properties of Recombinant Acetylcholinesterases 371 level of sensitivity to fenitroxon. It showed specific high sensitivity to pirimicarb (0.01) Trp recombinant AChE Compared to 331Phe, 331Trp showed greater K m values for ATCh, PTCh and BTCh (7.0, 10.5 and 20.6 times, respectively) indicating very low affinity to these substrates. The affinity of 331Trp to substrates prominently decreased as the length of substrate molecules become longer. In 331Trp, the I 50 values for fenitroxon and DDVP were M and M, respectively, indicating 331Trp to be 5,486 and 10,134 times more insensitive than 331Phe. For monomethyl carbamates, carbaryl and eserine, I 50 ratios of 331Trp to 331Phe were 210 and 138 times, respectively, and the ratios indicate that the reduction of sensitivity to these carbamates was less than to organophosphates. The sensitivity of 331Trp was rather low to dimethyl carbamate pirimicarb. DISCUSSION Amino acid substitutions responsible for insecticide insensitivity in AP-AChE have been reported in ten species of insects, and these high levels of insensitivity were thought to be caused by a single amino acid substitution occurring in the active site of the enzyme (Russell et al., 2004; Fournier, 2005; Kono and Tomita, 2006). The active site lies near the bottom of the gorge lined with highly conserved aromatic amino acid residues that facilitate diffusion of the substrate to the active site. The active site is composed of several subsites as follows. First a catalytic triad (220Ser, 327Glu, 440His) functions as a proton relay system for the catalysis of the substrate in the active site. The oxyanion hole situated next to the triad is composed of 118Gly, 119Gly and 201Ala that stabilize the carboxyl oxygen of ACh through hydrogen bonding. The acyl pocket composed of 233Trp, 288Phe, 290Phe and 331Phe orientate the ligand in an appropriate direction. Finally, the choline moiety of the substrate is stabilized by 84Trp at the choline binding subsite. In Cx. pipiens, a single mutation Gly119Ser in the oxyanion hole was found to be responsible for the insensitivity (Weill et al., 2003). Evaluation of the biochemical effect of the Gly119Ser mutation was made by expression of AP-AChE cdna from Cx. pipiens in S2 Drosophila cultured cells, and the recombinant AChE was shown insensitive to propoxur, a carbamate insecticide, as a resistant strain AChE (Weill et al., 2003). The Gly119Ser substitution seemed to interfere with the catalytic function by altering the orientation of the substrate and inhibitors in the active center. We introduced the six amino acid substitutions so far found, Gly119Ser (C. pipiens, An. gambiae), Ala201Ser (A. gossypii), Phe290Val (N. cincticeps), Ser331Phe (M. persicae, A. gossypii), Phe331Cys (T. urticae) and Phe331Trp (Cx. tritaeniorhynchus) into the AP-AChE cdna of Cx. tritaeniorhynchus to produce recombinant AChEs in a baculovirus-insect cultured cell system and examined the biochemical properties of the products. The substitution of Gly119Ser in this study also indicated that the substitution gave the enzyme a high level of insensitivity to carbamate insecticides but a slight insensitivity to organophosphates. On the other hand, an amino acid substitution Phe331Trp located in the acyl pocket induced a very high level of insensitivity to organophosphates and ten times lower insensitivity to carbamates (Oh et al., 2006). The amino acid replacement renders the acyl pocket less hydrophobic and smaller, and thus alters the accessibility of the substrates and inhibitors to this site. Especially the access of bulky molecules such as organophosphates seems to be restricted. The transportation of a positive charge during the hydrolyzing process was also influenced by the substitution (Nabeshima et al., 2004). In wild types of AP-AChE from aphid species, M. persicae and A. gossypii, the amino acid at position 331 is exceptionally Ser, and 331Ser is replaced with Phe in the pirimicarb resistant strains (Nabeshima et al., 2003; Andrews et al., 2004; Toda et al., 2004). The acyl pocket of AP-AChE with 331Ser seems larger and less hydrophobic than that with 331Phe. The recombinant AP-AChE with 331Ser clearly reproduced this phenomenon. Specific high sensitivity of aphid AChE to pirimicarb and the sensitivity of the mutated AChE that loses the pirimicarb sensitivity to methyl carbamates and organophosphates are well explained by the comparison of the biochemical features of 331Ser and 331Phe. In the green rice leafhopper N. cincticeps, an AChE resistant strain, Nakagawara showed ca. 100 times insensitivity to methyl carbamates such as

6 372 S. OH et al. carbaryl, metolcarb and propoxur as compared to the susceptible strain. The insensitive AChE simultaneously showed higher sensitivity to bulky inhibitors such as n-propyl carbamates and propaphos sulfone than AChE of the susceptible strain (Hama, 1980). Recently, amino acid substitution, Phe290Val, in the acyl pocket was found in N. cincticeps. The recombinant AChE, 290Val, reproduced the same characteristics of insensitive in AChE, especially inversed sensitivity to carbamates and propaphos sulfone. Based on the structure of amino acids, the Phe290Val substitution in AP-AChE seems to widen the dimension of the acyl pocket and to alter the accessibility of the ligands and inhibitors to the site. More bulky inhibitors, n-propyl carbamates and propaphos sulfone having low inhibitory activity to the sensitive AP-AChE, fit in the widened acyl pocket of the mutated AChE. Although two AChEs exist in the insect body, the insensitive features to insecticides in various resistant strains are well understood by the biochemical properties of AP-AChE with the corresponding amino acid substitutions expressed in vitro. Recent studies on AChE gene expression in some insect species indicate that AO-AChE gene expression is much lower than the AP-AChE gene in the insect body (Baek et al., 2005; Mizuno et al., 2006). Insensitivity appears to depend on a low level of expression of AO-AChE in the insect body as compared to AP-AChE. ACKNOWLEDGEMENTS We thank Dr. DeMar Taylor, Graduate School of Life and Environmental Sciences, University of Tsukuba for critically reading this manuscript. This work was supported by a Grantin-Aid from the Ministry of Education, Science and Culture, Japan (No ). REFERENCES Adams, M. D. et al. (2000) The genome sequence of Drosophila melanogaster. Science 287: Aiki, Y., T. Kozaki, H. Mizuno and Y. Kono (2005) Amino acid substitution in Ace paralogous acetylcholinesterase accompanied by organophosphate resistance in the spider mite Tetranychus kanzawai. Pestic. Biochem. Physiol. 82: Andrews, M. C., A. Callaghan, L. M. Field, M. S. Williamson and G. D. Moores (2004) Identification of mutations conferring insecticide-insensitive AChE in the cottonmelon aphid, Aphis gossypii Glover. Insect Mol. Biol. 13: Baek, J. H., J. I. Kim, D.-W. Lee, B. K. Chung, T. Miyata and S. H. Lee (2005) Identification and characterization of ace1-type acetylcholinesterase likely associated with organophosphate resistance in Plutella xylostella. Pestic. Biochem. Physiol. 81: Ellman, G. L., K. D. Courtny, U. Andres and K. M. Featherstone (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7: Fournier, D. (2005) Mutations of acetylcholinesterase which confer insecticide resistance in insect populations. Chemico-Biological Interactions : Hama, H. (1980) Studies on mechanism of resistance to insecticide in the green rice leafhopper, Nephotettix cincticeps Uhler, with particular reference to reduced sensitivity of acetylcholinesterase. Bull. Natl. Inst. Agric. Sci. C 34: Kono, Y. and T. Tomita (2006) Amino acid substitutions conferring insecticide insensitivity in Ace-paralogous acetylcholinesterase. Pestic. Biochem. Physiol. 85: Kozaki, T., T. Shono, T. Tomita and Y. Kono (2001) Fenitroxon insensitive acetylcholinesterases of the housefly, Musca domestica associated with point mutations. Insect Biochem. Mol. Biol. 31: Kozaki, T., T. Tomita, K. Taniai, M. Yamakawa and Y. Kono (2002) Expression of two acetylcholinesterase genes from organophosphate sensitive- and insensitive-houseflies, Musca domestica L. (Diptera: Muscidae), using a baculovirus insect cell system. Appl. Entomol. Zool. 37: Li, F. and Z.-J. Han (2002) Two different genes encoding acetylcholinesterase existing in cotton aphid (Aphis gossypii). Genome 45: Mamiya, A., Y. Ishikawa and Y. Kono (1997) Acetylcholinesterase in insecticide resistant Culex tritaeniorhynchus: characteristics accompanying insensitivity to inhibitors. Appl. Entomol. Zool. 32: Mizuno, H., T. Tomita, S. Kasai, O. Komagata, S. Imanishi and Y. Kono (2006) cdna identification and gene expression of two types of acetylcholinesterases in a cultured cell line of Aedes albopictus, compared to mosquito whole body extracts. Appl. Entomol. Zool. 41: Mutero, A., M. Pralavorio, J. M. Bride and D. Fournier (1994) Resistance-associated point mutations in insecticideinsensitive acetylcholinesterase. Proc. Natl. Acad. Sci. USA 91: Nabeshima, T., T. Kozaki, T. Tomita and Y. Kono (2003) An amino acid substitution on the second acetylcholinesterase in the pirimicarb-resistant strains of the peach potato aphid, Myzus persicae. Biochem. Biophys. Res. Commun. 307: Nabeshima, T., A. Mori, T. Kozaki, Y. Iwata, O. Hidoh, S. Harada, S. Kasai, D. W. Severson, Y. Kono and T. Tomita (2004) An amino acid substitution attributable to insecticide-insensitivity of acetylcholinesterase in a Japanese encephalitis vector mosquito, Culex tritaeniorhynchus. Biochem. Biophys. Res. Commun. 313: Oh, S.-H., T. Kozaki, H. Mizuno, T. Tomita and Y. Kono

7 Biochemical Properties of Recombinant Acetylcholinesterases 373 (2006) Expression of Ace-paralogous acetylcholinesterase of Culex tritaeniorhynchus with an amino acid substitution conferring insecticide insensitivity in baculovirus-insect cell system. Pestic. Biochem. Physiol. 85: Russell, R. J., C. Claudianos, P. M. Campbell, I. Horne, T. D. Sutherland and J. G. Oakeshott (2004) Two major classes of target site insensitivity mutations confer resistance to organophosphate and carbamate insecticides. Pestic. Biochem. Physiol. 79: Smissaert, H. R. (1964) Cholinesterase inhibition in spider mites susceptible and resistant to organophosphate. Science 143: Toda, S., S. Komazaki, T. Tomita and Y. Kono (2004) Two amino acid substitutions in acetylcholinesterase associated with pirimicarb and organophosphorous insecticide resistance in the cotton aphid, Aphis gossypii Glover (Homoptera: Aphididae). Insect Mol. Biol. 13: Voss, G. and F. Matsumura (1964) Resistance to organophosphorus compounds in the two-spotted spider mite: two different mechanisms of resistance. Nature 202: Walsh, S. B., T. A. Dolden, G. D. Moores, M. Kristensen, T. Lewis, A. L. Devonshire and M. S. Williamson (2001) Identification and characterization of mutations in housefly (Musca domestica) acetylcholinesterase involved in insecticide resistance. Biochem. J. 359: Weill, M., G. Lutfalla, K. Mogensen, F. Chandre, A. Berthomieu, C. Berticat, N. Pasteur, A. Philips, P. Fort and M. Raymond (2003) Comparative genomics: insecticide resistance in mosquito vectors. Nature 423: Weill, M., C. Malcolm, F. Chandre, K. Mogensen, A. Berthomieu, M. Marquine and M. Raymond (2004) The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Mol. Biol. 13: 1 7.