Regulatory Region of the Divergent Klebsiella pneumoniae

Transcription

1 JOURNAL OF BACTEROLOGY, Sept. 1985, p /85/ $02.00/0 Copyright C 1985, American Society for Microbiology Vol. 163, No. 3 Regulatory Region of the Divergent Klebsiella pneumoniae lac Operon WLSON E. BUVNGER AND MONCA RLEY* Biochemistry Department, State University of New York at Stony Brook, Stony Brook, New York Received 4 February 1985/Accepted 28 May 1985 The chromosomal DNA that lies between the lad and lacz genes of Klebsiella pneumoniae constitutes a 196-base pair intercistronic region that contains regulatory sequences for both genes. The probable locations of specific regulatory elements for both lac and lacz genes were determined by analogy with the corresponding Escherichia coli sequences. A recombinational event in ancestral DNA evidently has inverted the transcriptional direction of lac in K. pneumoniae relative to the transcriptional direction of lac in E. coli. One end of the inversion was located within a 19-base pair sequence in the K. pneumoniae regulatory region. Sequences partially homologous to these 19 base pairs were found n two locations on either side of the E. coli lac gene. The nucleotide sequence of the lac regulatory region in K. pneumoniae exhibits more than one possibility for folded tertiary structures. The spatial relationships of transcriptional binding sites differ in two possible structures. Associations of regulatqry and transcriptional proteins with the DNA might affect conformation of the regulatory sequences and, as a consequence, transcription of the lac genes. Most of the chromosomal lac operon of Klebsiella pneumoniae was cloned as a 4.8-kilobase Hind fragment in the vector pbr322 (11). n the accompanying paper we describe nucleotide sequence determination of a functional lac gene, the complete lacz gene, and part of the lacy gene (2). The transcriptional directions of these three genes were determined by locating regions of hotollgy to the corresponding Escherichia coli lac genes. The location and orientation of the genes showed that the K. pneumoniae lac genes are organized in a divergent fashion (2). The lac gene lies head to head with the lacz gene and is transcribed from the opposite strand of the DNA in relation to the lacz and lacy genes. The sequence of the intercistronic region that lies between the lac and lacz genes was also determined and is reported here. This region consists of 196 base pairs (bp) that contain the information needed to initiate expression of both the lac gene and the lacz gene. This intercistronic sequence was analyzed in relation to E. coli lac operon regulatory sequences and in terms of evolutionary relationships. Potential alternate conformational forms of the DNA were explored and are discussed below. MATERALS AND METHODS The procedures used for isolating plasmid DNA, cloning the Pst fragments, preparing sets of deletion derivatives, and determining nucleotide sequences of both strands of the DNA, as well as the sequence-managing programs and the origin of the file containing the nucleotide sequence of the E. coli lac operon, are described in the accompanying paper (2). To examine the potential for folded structure and to calculate free energy contents, the algorithm for folding RNA of Zuker and Steigler (17) was used as adapted by Jacobson et al. (8) and was run on a Univac model 1100 computer. RESULTS The intercistronic region that lies between the coding regions of the K. pneumoniae lac and lacz genes was * Corresponding author. 858 determined to be 196 bp long and to be contained within a 1.2-kilobase Pst subclone derived from the 4.8-kilobase Hind parental DNA. To locate potential regulatory sites, the nucleotides of the intercistronic region were aligned and compared with the sequence that in E. coli lies between the 3' terminus of the lac gene coding region and the 5' beginning of the lacz coding region (Fig. 1). Similarly, the complementary strand of the same K. pneumoniae sequence was aligned with the DNA that lies upstream from the 5' end of the sense strand of the E. coli loc gene (Fig. 2). n neither case did the K. pneumoniae and E. coli sequences prove to be perfectly colinear. For the regulatory sequences of the lacz and lac genes, we found seven locations where a point-to-point comparison suggested that there are gaps of one to three nucleotides each. An analysis of the aligned nucleotides showed that both sets of regulatory sequences in the K. pneumoniae intercistronic DNA are 40 to 45% conserved overall relative to the corresponding E. coli regions. This was about the same level of conservation that we found in comparisons of the K. pneumoniae and E. coli lac structural genes, but was less than the level of conservation found for the respective lacz and lac Y genes (2). Given the level of conservation of the K. pneumoniae intercistronic DNA relative to the corresponding E. coli sequences, it seemed likely that the regulatory signals and binding sites that control expression of the K. pneumoniae lacz and lac genes exist at loci that are homologous to and essentially colinear with the sites found in E. coli DNA (Fig. 1 and 2). Scanning the K. pneumoniae sequences revealed that plausible regulatory sites could be identified at sites that were either precisely colinear with the E. coli sites or were displaced by 1 or 2 bp. One exception was the placement of the putative Shine-Dalgarno sequence of the lacz gene, which appears to be displaced by at least 5 bp. The tentative assignments of the -10 and -35 promoter regions for both lac and lacz genes, the Shine-Dalgarno sequences for both genes, and the presumptive camp receptor protein (CRP) and lac repressor binding sites are all indicated in Fig. 3. Within the K. pneumoniae intercistronic region, we found

2 VOL. 163, 1985 REGULATON OF K. PNEUMONAE lac OPERON K P CTTTTCTCCTCAGTAA K p TAACAATGTCGTGCGCTAACATTTTAT6TTTAACGCGCGACAAAAAACAGCGCTTCGCCC EC CGCAACG KP EC. \ \\ \\ CAATTAATGT6AGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGG CRP K P CCCGATAACGTTAACCATCCTGTTTAGCGAAC6ACAATTTCTGACTTACCGGGGTTTAAT Z 11 / /// //// E C CTCG TATGTTGTGTGGAATTGTGAGCG GATAACAATTTCACACAGGAAACAGCTATGACC Z -10 operator S-D FG. 1. Relationship between K. pneumoniae and E. coli regulatory sequences 5' of the lacz gene. The sequences of the nucleotides that lie between the lac and lacz genes of both K. pneumoniae and E. coli are shown. Conserved nucleotides are linked by lines. A group of slanted lines indicates displacement by one nucleotide, implying that one addition and one deletion have occurred on either side of the group. Gaps were introduced opposite unpaired nucleotides. The locations of specific features of the E. coli sequence are indicated by underlining and are labeled. The E. coli nucleotides that pair with the 19-bp junction region of K. pneumoniae are indicated by dots (see text). The E. coli sequence was determined by Calos (3). The nucleotide positions are indicated by numbers that refer to the total sequence of the 4.8-kilobase Hind fragment of K. pneumoniae DNA and relate to the strand that carries the sense coding sequence of the lacz gene. The beginning of the lacz coding region is indicated with the letter Z. KP, K. pneumoniae; EC, E. coli. 19 nucleotides (identified in Fig. 3) that exhibit partial homology with E. coli DNA, both with sequences at the 5' end of the lacz regulatory region (dotted in Fig. 1) and, in the opposite strand, with sequences at the 5' end of the lac regulatory sequences (dotted in Fig. 2). Alignment of both of the E. coli sequences with the 19 nucleotides of K. pneumoniae required introduction of a 3-bp gap in both E. coli sequences, at the same position relative to the K. pneumoniae nucleotides in both sequences. The operator regions of both the E. coli lac and gal operons were compared with the corresponding K. pneumoniae lac DNA (Fig. 4). Single nucleotide gaps were introduced to improve alignment of like nucleotides. When this alignment was used, the nucleotides of the K. pneumoniae lac operator region were about 60% conserved relative to the E. coli lac operator region and 66% conserved relative to the corresponding E. coli gal operator DNA. These levels of conservation are higher than the levels for the intercistronic region as a whole and are about the same as the levels for the lacz and lac Y structural genes of K. pneumoniae and E. coli (2). An examination of only the 17-bp sequence that corresponds to the E. coli operator (Fig. 4) yielded a value of 76% conservation for the K. pneumoniae sequence relative to the corresponding E. coli sequences of either the lac or the gal 3555 K p ATTAAACCCCGGTAAG K P TCAGAAATTGTCGTTCGCTAAACAGGATGGTTAACGTTATCGGGTAATTTGTTTT6TCCA KP GCAATLTCGGGGGBAACGAAATTAACAGACGATCACGAAAGCGGGGGCGAAGCGCTGTTT l EC GACACCAT CGAATGGCGCAAA K P TTTGTCGCGCGTTAAACATAAAATGTTAGCGCACGACATTGTTATTACTBAGGAGAAAAG \\\\\ /// 11 E C ACCTTTCGCGGTATGGCATGATA GCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAAT -10 S-D FG. 2. Relationship between K. pneumoniae and E. coli regulatory sequences 5' of the lac gene. The K. pneumoniae sequences that lie between the lac and lacz genes are shown as the region 5' of the lac gene and thus as the complementary strand of the DNA shown in Fig. 1. The nucleotide positions are indicated by numbers that refer to the total sequence of the 4.8-kilobase fragment; the numbers indicate the residues of the strand that carries the sense coding sequence of the lacd gene. The E. coli sequence was determined by Dickson et al. (6). For an explanation of symbols and designations see the legend to Fig. 1. The 5' end of the lacd coding region is indicated with the letter. KP, K. pneumoniae; EC, E. coli.

3 860 BUVNGER AND RLEY J. BACTEROL * $ * * * * iacaatgtcgt6cgctaacattttatgtttaac6cgcgacaaa CTTTTCTCCTCAGTAATA GAAAAGAGGAGTCATTAT-TGTTACABCACGCGATTGTAAAATACAAATTGCGCGCTGTTT S-D -10 z a rtgc X ;lo * CRP * AAACAGCGCTTCGCCCCCGCTTTCGTGATCGTCTGTTAATTTCGATTCCCCCGAGAT TTTGTCGCGAAGCGGGGGCGAAAGCACTAGCAGACAATTAAAGCTAAGGGGGCTCTAACG & op TGGACAAAACAAATTACCCGATAACGTTAACCATCCTGTTTAGCGAACGACAATTTCTGAC ACCTGTTTTGTTTAATGGGCTATTGCAATTGGTAGGACAAATCGCTTGCTGTTAAAGACTG 190 * S-D TTACCGGGGTTTAAT AATGGCCCCAAATTA Z z FG. 3. The 196-bp lac-lacz intercistronic region of K. pneumoniae DNA. Both strands of the DNA are shown and are numbered separately from surrounding sequences. The regulatory sequences for both K. pneumoniae lac and lacz genes are indicated by horizontal lines at the tentative positions that were located by analogy with the corresponding E. coli sequences. The locations of the distal ends of the two regions of homology with E. coli DNA, one upstream from the E. coli lacz gene and one upstream from the E. coli lac gene, are shown by short vertical lines and horizontal arrows. The 19-bp overlap in the two regions of homology is indicated by a cross-hatched box. One end of the segment that was inverted in an ancestor of either E. coli or K. pneumoniae probably is located within this 19-bp sequence (see text). For further explanation see the legends to Fig. 1 and 2. OP, Operator. operator sequences. However, despite this high level of conservation of the nucleotide sequence, there was a failure in K. pneumoniae to conserve the strong symmetry characteristic of the E. coli operator. Similarly, the presumed camp-crp binding site of K. pneumoniae contains little conserved symmetry. However, the four nucleotides GTGA are present and align with nucleotides which in the E. coli lac and gal operons are part of the characteristically conserved TGTGA sequence (15). A computer analysis in which we used a folding program to examine pairing relationships of the nucleotide sequence of a single strand of the 196-bp K. pneumoniae regulatory region disclosed several imperfect inverted repeat sequences capable of forming interrupted palindromic structures. This study revealed more than one opportunity for folding in the sequence. n one folding pattern, the complete intercistronic region comprised a single hairpin loop (Fig. 5). This structure was calculated to have a favorable free energy relative to a random coil (AG = kcal/mol). An alternate folded structure composed of four smaller hair pin loops (Fig. 6) was energetically almost equivalent (AG = kcal/mol). DSCUSSON Since the K. pneumoniae lac operon has a divergent structure, with the lacz and lac genes transcribed from opposite strands, whereas in the E. coli lac operon the lacz and lac genes are transcribed successively in the same direction, an inversion must have occurred in the course of the evolutionary divergence of the K. pneumoniae and E. coli lac genes. t should be possible to locate the endpoints of the inversion by inspecting the relationships between the E. coli and K. pneumoniae nucleotide sequences on either side of the lac gene. The 19 bp in the K. pneumoniae intercistronic region (Fig. 3, cross-hatched box) are partially homologous with two physically separated sets of nucleotides from the 5' ends of both the E. coli lacz and lacd regulatory sequences. These loci appear to delineate one of the ends of the inversion in K. pneumoniae and both ends of the inversion in E. coli. The sites in E. coli are the two 16-bp sequences that lie at the extreme 5' ends of the lacd and lacz genes, as shown in Fig. 1 and 2. n both of the 16-bp E. coli sequences there are 3-bp gaps at the same positions relative to the 19-bp K. pneumoniae sequence. The ancient inversion event could have occurred in an ancestral genome that had either the E. coli configuration or the K. pneumoniae configuration. Looking at the event as if it occurred in a DNA organized as in E. coli, the inversion appears to have entailed recombination at some point within the 16 nucleotides that begin 62 bp upstream from the lac coding region and at the physically separated homologous EC 90/ MACG A T T CT: TGTGTA[ CGA[jCCACTAA,TTTATTC C KP /ac ACG TTAACCALCi TGTTTAG CGAA CGAC AA'TTTCTG AC EC/Ac ATG TTGTGTGGAA TTGTG AG CGGATAAC AATTTC AC Aj FG. 4. Comparison of the operator regions of the lac operons of K. pneumoniae and E. coli and the gal operon of E. coli. Gaps were introduced to maximize similarities between the sequences. Conserved sequences are shown in boxes. The E. coli lac operator sequence is indicated by vertical dashed lines. The lac operator sequence was determined by Dickson et al. (6), and the gal operator sequence was determined by Musso et al. (12). EC, E. coli; KP, K. pneumoniae.

4 VOL. 163, 1985 CRP CG T T TT T-A T Tc-C C-G 1 T- -TA C CG A /A/--~A' G CA A A T AT CCCTA AT CG-CCCATTpeaAo c C G A TA GAT C-G T-A Gc C G TA- AAT-A c AAT- A- T T G-C ral~- T regin. F..oledstucurfrGh he srucure aseneatdbusn K. opneratonielcregltr f...ctttt T~ ACTT oprtheororm AAT** FG. 5. Folded structure for the K. pneumoniae lac regulatory region. The structure was generated by using the program of Jacobson et al. (8), and the free energy content was calculated to be kcal/mol. Putative regulatory sequences of the lacz gene are enclosed by continuous lines, and putative regulatory sequences of the lac gene are enclosed by dashed lines. The nucleotide coordinates and symbols used are those used in Fig. 1. point within the related 16 nucleotides that begin 112 bp upstream from the coding region of the lacz gene. This event would have created a new junction which is located in the K. pneumoniae chromosome within the 19-bp segment that is indicated in Fig. 3 and another new junction that should be located in the K. pneumoniae genome downstream from the lac gene, beyond the end of the nucleotide sequences that have been determined to date. The nucleotides that are presumed to comprise the K. pneumoniae lac operator sequence are more highly conserved relative to E. coli than are other parts of the intercistronic region. n fact, the presumed K. pneumoniae operator sequence is more conserved relative to the E. coli REGULATON OF K. PNEUMONAE lac OPERON 861 lac operator (Fig. 4) than the two lacz genes are to each other (2). However, despite the high level of conservation, the bases that differ in the K. pneumoniae operator are bases that are important for symmetry and palindromic character. The K. pneumoniae operator has very little symmetry, an unexpected finding in view of the studies that indicate that the palindromic symmetry in the E. coli lac operator is important with respect to tightness of binding of the lac repressor protein (16). The K. pneumoniae lac genes are arranged head to head. There are other divergent Klebsiella operons. One example is the organization of the pentitol operons (4, 13). The rbt operon that encodes ribitol dehydrogenase and D- ribulokinase is positioned head to head with the dal operon that encodes D-arabitol dehydrogenase and D-xylulokinase. The two operons are separated by a 3.5-kilobase control region and are transcribed in opposite directions. Another example which more closely resembles the arrangement of the lac genes is the histidine utilization gene cluster, hut, which consists of more than one transcriptional unit (1). n one of these units, the transcription of the hutu and huth genes is controlled by a divergent regulatory region with oppositely faced promoters disposed so that RNA polymerase binding and transcription in each direction are mutually exclusive. This was shown through nucleotide sequencing and in vitro transcription experiments which revealed that the two oppositely oriented -35 sequences are interspersed and that the camp-crp binding site overlaps an oppositely oriented Pribnow box (14). Overt overlap of the presumed regulatory binding sites of the lac and lacz genes was not found in the K. pneumoniae intercistronic region, although the camp-crp binding sequence lies close to the -35 sequence for the lac gene (Fig. 3), raising the possibility that one effect of camp-crp binding could be to interfere with transcription of the lac repressor gene. A role for DNA cruciform structures in regulation of bacterial genes has not been demonstrated. Palindromic and quasipalindromic sequences in DNA seem to play a role both in suppression of frameshift mutations (5) and in generation of deletions (7). n studies on configurations of inverted repeat sequences, cruciform structures have been shown to form when the repeated sequences reside in negatively supercoiled circular DNA (11). Losses of energy of nucleotide pairing at the base of symmetrical hairpins and at mispairings within the hairpins have the effect of destabilizing a cruciform structure relative to a linear duplex, but these factors can be compensated either by superhelical density or by interaction of specific nucleotide sequences with specific binding proteins. A computer analysis of a single strand of the 196-bp sequence of the K. pneumoniae intercistronic region showed that in theory there are opportunities for achieving more than one cruciform configuration. These opportunities entail self-annealing within the single strands of this sequence. One possible structure is shown in Fig. 5. n this form, part of the camp-crp binding sequence is paired with part of the -35 sequence of the lacz gene, and the regulatory sequences that immediately precede the lacz gene are base paired with the opposite end of the intercistronic region that carries the sequences that immediately precede the lac coding region. An alternate folded arrangement is shown in Fig. 6. Here the camp-crp binding site is paired with nearly two-thirds of the -35 sequence of the lac gene and only a part of the -35 sequence of the lacz gene, a folding and pairing pattern that is distinct from that shown in Fig. 5. The two postulated

5 862 BUVNGER AND RLEY J. BACTEROL. CTTTT1QLCTCCTCGTAATAACAA AA A- Z 1063 ~~ ~ ~ ~~ ls FG. 6. Alternate folded structure for the K. pneumoniae lac regulatory region. The structure was generated by using the program of Jacobson et al. (8). Segments of the sequence were evaluated sequentially as follows (in terms of the numbering shown in Fig. 3): 1 through 97, 98 through 126, and 127 through 196. The free energy of the structure was calculated to be kcal/mol, and the free energies of the individual hairpins (from left to right) were determined to be -16.4, -10.0, -4.2, and -17 kcal/mol. The regulatory sequences, the locations of coding regions, and the nucleotide coordinates are indicated as described in the legend to Fig. 5. folding patterns might play different roles in regulation of gene expression. Alternate structures might affect the strength of repressor binding to the operator sequence. nitiation of transcription of the lacz and lac genes might be affected by differences in the two structures with respect to proximity of the camp-crp binding site to the RNA polymerase binding sequences. Alternative, mutually exclusive folded structures of RNA transcripts provide the foundations for attenuation mechanisms for regulation of expression of procaryotic biosynthetic genes (9). Perhaps similar mechanisms either at the DNA level or at the mrna level exist for the regulation of expression of some catabolic operons. Future in vitro mutagenesis, transcription, and protection studies should provide needed experimental information on these points. ACKNOWLEDGMENTS We thank both Dan Davison and Ann Jacobson for helping us to use the secondary structure computer programs. This work was supported by Public Health Service grant GM28926 from the National nstitutes of Health. LTERATURE CTED 1. Boylan, S. A., L. J. Eades, K. A. Janssen, M.. Lomax, and R. A. Bender A restriction enzyme cleavage map of the histidine utilization (hut) genes of K. pneumoniae and deletions lacking regions of hut DNA. Mol. Gen. Genet. 193: Buvinger, W. E., and M. Riley Nucleotide sequence of Klebsiella pneumoniae lac genes. J. Bacteriol. 163: Calos, M. P DNA sequence for a low-level promoter of the lac repressor gene and an "up" promoter mutation. Nature (London) 274: Charnetz, W. T., and R. P. Mortlock Close genetic linkage of the determinants of the ribitol and D-arabitol pathways in Klebsiella aerogenes. J. Bacteriol. 119: de Boer, J. G., and L. S. Ripley Demonstration of the production of frameshift and base-substitution mutations by quasipalindromic DNA sequences. Proc. Natl. Acad. Sci. U.S.A. 81: Dickson, R. C., J. Abelson, W. M. Barnes, and W. S. Reznikoff Genetic regulation: the lac control region. Science 187: Glickman, B. W., and L. S. Ripley Structural intermediates of deletion mutagenesis: a role for palindromic DNA. Proc. Natl. Acad. Sci. U.S.A. 81: Jacobson, A. B., L. Good, J. Simonetti, and M. Zuker Some simple computational methods to improve the folding of large RNAs. Nucleic Acids Res. 12: Kolter, R., and C. Yanofsky Attenuation in amino acid biosynthetic operons. Annu. Rev. Genet. 16: Lilley, D. M. J., and B. Kemper Cruciform-resolvase interactions in supercoiled DNA. Cell 36: MacDonald, C., and M. Riley Cloning chromosomal lac genes of K. pneumoniae. Gene 24: Musso, R., R. DiLauro, M. Rosenberg, and B. de Crombrugghe Nucleotide sequence of the operator-promoter region of the galactose operon of E. coli. Proc. Natl. Acad. Sci. U.S.A. 74: Neuberger, M. S., and B. S. Hartley nvestigations into the Klebsiella aerogenes pentitol operons using specialized transducing phages Xp rbt and Xp rbt dal. J. Mol. Biol. 132: Nieuwkoop, A. J., S. A. Boylan, and R. A. Bender Regulation of hutuh operon expression by the catabolite activator protein-cyclic AMP complex in Klebsiella aerogenes. J. Bacteriol. 159: Rosenberg, M., and D. Court Regulatory sequences involved in the promotion and termination of RNA transcription. Annu. Rev. Genet. 13: Sadler, J. R., H. Sasmor, and J. L. Betz. A perfectly symmetric lac operator binds the lac repressor very tightly. Proc. Natl. Acad. Sci. U.S.A. 80: Zucker, M., and P. Steigler Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 9: