D-Fos, a target gene of Decapentaplegic signalling with a critical role during Drosophila endoderm induction

Transcription

1 Development 124, (1997) Printed in Great Britain The Company of Biologists Limited 1997 DEV D-Fos, a target gene of Decapentaplegic signalling with a critical role during Drosophila endoderm induction Jens Riese 1, Gabi Tremml 2, * and Mariann Bienz 1, 1 MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK 2 Zoological Institute, University of Zürich, Winterthurerstr. 190, 8057 Zürich, Switzerland *Present address: Department of Human Genetics, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021, USA Author for correspondence ( mb2@mrc-lmb.cam.ac.uk) SUMMARY The Drosophila endoderm is patterned by the signals Decapentaplegic and Wingless secreted from the visceral mesoderm. This induction culminates in a precise pattern of spatially restricted expression of labial, a selector gene with a role in cell type specification in the larval midgut. Here, we show that Decapentaplegic signalling induces elevated expression of the Drosophila AP-1 transcription factor D-Fos in a slightly broader endodermal region than labial. This induction occurs in parallel to, and independently of, that of labial. Furthermore, we present evidence that D-Fos is required for labial induction in the embryo as well as for maintenance of labial expression through larval stages; and that D-Fos is critical for cellular differentiation in the larval gut. We propose that Decapentaplegic, by inducing D-Fos, broadly defines an endodermal region which thus becomes predisposed to express labial, and that D-Fos cooperates with signal-activated response factors to confer the precise pattern of labial expression in this region. Key words: D-Fos, labial, decapentaplegic, endoderm induction, cell signalling, Drosophila INTRODUCTION Positional information in the Drosophila embryo is often conferred cell-autonomously by prelocalised transcription factors. For example, homeotic genes are expressed in all germ layers in unique domains along the body axis (Akam, 1987). The positions and widths of these domains are determined directly by localised transcription factors, the products of segmentation genes, which act through cis-regulatory control regions of their homeotic target genes (Qian et al., 1991; Müller and Bienz, 1992; Shimell et al., 1994). An exception is the endoderm which possesses no intrinsic anterior-posterior positional information (Lawrence, 1992). Localised expression of the only homeotic gene expressed in this germ layer, labial (lab), relies on positional cues from the adhering visceral mesoderm (Bienz, 1996). The inductive process which culminates in the endodermal expression of lab is initiated by the homeotic gene Ultrabithorax (Ubx) (Fig. 1; Bienz, 1996, and references therein). Ubx is expressed in parasegment (ps) 7 of the visceral mesoderm where it directly stimulates expression of decapentaplegic (dpp), a TGF-β-like growth factor (Padgett et al., 1987). Secreted Dpp stimulates the expression of wingless (wg), a Wnt-protein encoding gene (Rijsewijk et al., 1987), in the adjacent ps8 of the visceral mesoderm. Both Dpp and Wg act on the subjacent endoderm to control localised expression of lab: Dpp stimulates lab expression, whereas Wg stimulates or represses lab expression, depending on its level (Fig. 1). Finally, lab specifies the differentiation of copper cells (Hoppler and Bienz, 1994), highly specialised cells found in one particular section of the larval midgut (Fig. 1; Poulson, 1950). A second gene whose expression in the endoderm is localised to a similar section of the embryonic midgut is D- Fos, the Drosophila homolog of c-fos (formerly called dfra; Perkins et al., 1990). D-Fos and D-Jun are the only members of the AP-1 transcription factor family currently known in flies (Perkins et al., 1990). To form transcriptionally active complexes, proteins of this family dimerise with each other and also with members of the related ATF/CREB family of proteins (e.g. Hai and Curran, 1991; reviewed by Lalli and Sassone- Corsi, 1994). In Drosophila, both homo- and heterodimers of D-Fos and D-Jun can activate transcription through AP-1 binding sites in vitro (Perkins et al., 1990). AP-1 binding sites function as signal response sequences in various cellular and viral promoters (e.g. Angel et al., 1987; Bohmann et al., 1988), raising the possibility that AP-1 transcription factors could mediate the response to extracellular signals during development. Indeed, D-Jun has been implicated in EGF-induced photoreceptor determination during Drosophila eye development (Bohmann et al., 1994; Treier et al., 1995). We decided to study the control and function of D-Fos during endoderm induction. In particular, we were interested in the regulatory relationship between the two genes D-Fos and lab. We show that D-Fos expression is stimulated by Dpp in parallel to, and independent of, lab. We also present evidence, based on experiments with a dominant-negative form of D-Fos, that D-Fos is required for lab expression, from its induction onwards through larval development, and for differentiation of

2 3354 J. Riese, G. Tremml and M. Bienz copper cells. We discuss the role of D-Fos as a regulator of lab and its relationship to previously identified signal response factors in the midgut (Eresh et al., 1997; Riese et al., 1997). MATERIALS AND METHODS Production of D-Fos antiserum To generate an antiserum against D-Fos, a 910 bp fragment of D-Fos (corresponding to residues 1751 to 2652, i.e. from amino acid 328 to the stop codon, of the cdna sequence; Perkins et al., 1990) was generated from genomic Drosophila DNA by PCR, using the primers TTGAATTCGCTCCGACATGCTGAGCG and TTAAGCTTCGCG- GTTTCCTTCCGTTG. This PCR fragment was inserted as an EcoRI/HindIII fragment into bluescript cut with NotI/XbaI (all sites filled in). A 660 bp fragment was cut out with BamHI (cutting at codon 416 of the D-Fos coding sequence) and inserted into the bacterial expression vector pgex-2t (Pharmacia) cut with BamHI, creating an in-frame fusion of the D-Fos coding sequence with that of glutathiontransferase. For details of protein expression and purification, and of antiserum preparation from injected rats, see Tremml (1991). D-Fos rat antiserum was preabsorbed against Drosophila embryos at a 1:100 dilution, and subsequently used to stain embryos at a further dilution of 1:100. ps Fly strains The following mutant fly strains were used: lab vd1 (Diederich et al., 1989), dpp s4 (Immerglück et al., 1990), wg cx4 (Baker, 1987), the temperature-sensitive allele wg IL114 (Nüsslein-Volhard et al., 1984; to visceral remove wg function after the onset of germ mesoderm band shortening, embryos were shifted to 25 C after 24 hours at 15 C), and shn TD5 (Nüsslein-Volhard et al., 1984; Arora et al., 1995; Grieder et al., 1995). endoderm For mesodermal expression of UAS constructs, we used the driver line 24B.GAL4 (Staehling-Hampton and Hoffmann, 1994), for endodermal expression 48Y.GAL4 (Martin-Bermuda et al., 1997), and for timed ubiquitous expression a strong hs.gal4 line (see Eresh et al., 1997). 48Y.GAL4 mediates strong and even expression in the endoderm, in the primordia from stage 9 onwards and throughout embryogenesis, but it also mediates expression in some other cells, most notably weak expression in peripheral cells adhering to the spindle-shaped visceral mesodermal cells (our unpublished anterior midgut observations; see also Martin-Bermuda et al., 1997). To ascertain that the observed effects were due to endodermal (rather than mesodermal) expression, we expressed all constructs with the comparatively stronger mesodermal driver 24B.GAL4 as a control. No copper cell defects were observed with any of the bzip nor with any of the fulllength constructs expressed in this way. The following UAS fly strains were used: UAS.dpp (Staehling-Hampton and Hoffmann, 1994), UAS.wg (Lawrence et al., 1995), UAS.D-Jun, UAS.D-Fos, UAS.dCREBb, UAS.Jbz, UAS.Cbz and UAS.Fbz (Eresh et al., 1997). The following β-galactosidase (lacz) reporter strains were used: -6.3lab (Tremml and Bienz, 1992), C and A (Hartenstein and Jan, 1992; see also Hoppler and Bienz, 1995). Mutant embryos were identified by their gut phenotypes, by changes in reporter gene expression, or by β-gal staining due to marked balancer chromosomes. Analysis of phenotypes and heat shock treatments A rat polyclonal Lab antiserum (Tremml, 1991) and a mouse monoclonal anti-β-galactosidase (β-gal) antibody (Promega) were used for staining of embryos as described by Thüringer et al. (1993). To monitor β-gal activity and copper cell fluorescence in larval guts, we followed the procedures described in Hoppler and Bienz (1994). For embryonic heat shock treatments, we subjected 4- to 8-hour old embryos to 4 consecutive heat shocks at 37 C (20 minutes each, separated by 2 hours at 25 C; plates immersed in a waterbath). For late larval expression, larvae were heat-shocked 4 times for 1 hour at 37 C, separated by 5 hours at 25 C, starting from 36 hours after hatching (analysis 5 hours after the last heat shock). If Cbz was expressed this way, larvae did not survive to be analysed. Two 1 hour heat shocks separated by 5 hours (followed by analysis after a further 5 hours) produced no copper cell defects with neither Cbz nor Fbz Ubx dpp labial wg copper cells and interstitial cells middle migut large flat cells iron cells posterior midgut Fig. 1. Induction of the endoderm by the visceral mesoderm. Schematic representation of the embryonic midgut (top) with its three constrictions (at the ps5/6, ps7/8 and ps9/10 junctions; ps indicated on top) and of the larval midgut (bottom) with its three sections of distinct cell types in the middle midgut (copper and interstitial cells are interspersed in the same section), and their spatial relationship indicated by dashed lines (midguts not to scale). The inductive cascade of genes underlying endoderm induction is outlined within the embryonic midgut. This cascade involves three critical genes expressed in the visceral mesoderm (Ubx and dpp in ps7, wg in ps8; Ubx is nuclear, Dpp and Wg are secreted); the downward-pointing regulatory interactions between these genes are indicated by arrows (for upward-pointing interactions, see Bienz, 1996). This inductive cascade culminates in the precisely defined and graded expression of lab in the second gut lobe (between the first and second constriction); Dpp and low levels of Wg synergise to stimulate lab transcription, whereas high Wg levels further posteriorly repress lab, thereby defining a sharp posterior expression limit of lab. lab is autostimulatory, during induction and through larval development, and specifies copper cells in the larval gut (for further references, see text).

3 The role of D-Fos in endoderm induction 3355 RESULTS D-Fos expression in the endoderm D-Fos RNA levels are strikingly elevated in the embryonic endoderm of the second gut lobe (Perkins et al., 1990). In order to analyse the distribution of D-Fos protein in the embryonic midgut, we raised a polyclonal antiserum against a bacterially expressed C-terminal fragment of this protein. The staining patterns of various embryonic stages and cell layers (including the ectoderm and the midgut) obtained with this antiserum is very similar to that reported for D-Fos RNA (Perkins et al., 1990). This suggests strongly that our serum specifically recognises the D-Fos antigen. D-Fos protein is first detectable in the head mesoderm at stage 9, and from stage 11 onwards in additional tissues including the amnioserosa and the ectoderm (all stages according to Campos-Ortega and Hartenstein, 1985). During stage 13, endodermal cells begin to show weak D-Fos staining, with a slightly higher level in a band of the forming midgut epithelium spanning the fusion junction of the two gut primordia (not shown). This band of elevated D-Fos expression becomes more and more prominent, and remains clearly visible from stage 15 onwards throughout late embryogenesis; it stretches throughout the second gut lobe from the first to the second gut constriction (i.e. through approx. ps6-7; Fig. 2A,B). D-Fos is predominantly, if not exclusively, nuclear in all cell types observed (e.g. Fig. 2C). A higher magnification view shows that D-Fos protein accumulates in all endodermal cells in the second gut lobe (Fig. 2C). This contrasts with lab which is expressed only in a subset of the endodermal cells in this lobe (Fig. 2D; see also Reuter et al., 1990): lab expression is not detectable in the most posterior cells within this lobe and, throughout the lobe, labexpressing cells are interspersed with cells not expressing lab. Note also that D-Fos staining is strongest in the central region of the lobe, fading slightly towards both constrictions (Fig. 2A,B), whereas Lab antibody A staining shows a striking anteroposterior gradient of expression, with highest levels most posterior (Immerglück et al., 1990). hs.gal4), strong D-Fos antibody staining is observed throughout the endoderm (Fig. 3C). Induction of lab expression by Dpp requires schnurri (shn), a gene encoding a putative zinc finger transcription factor (Arora et al., 1995; Grieder et al., 1995). In shn mutants, lab expression is abolished; lab expression cannot be restored even if Dpp (which is absent in shn mutants) is resupplied ubiquitously (Grieder et al., 1995). As expected, we found that there is no band of elevated D-Fos expression in shn mutants (Fig. 3D). However, if Dpp is expressed ubiquitously in shn mutants, D-Fos antibody staining is strong throughout the endoderm (Fig. 3E, compare to C). Thus, while expression of both lab and D-Fos is induced by Dpp signalling in the same section of the embryonic midgut, the genetic basis for this regulation differs. Is D-Fos expression also controlled by Wg signalling? We find that D-Fos induction is slightly reduced in the temperature-sensitive wg IL114 mutants if Wg is inactivated after 8 hours of development (not shown), and D-Fos antibody staining is almost undetectable in wg cx4 mutants (Fig. 3F). However, this apparent requirement for Wg signalling could be indirect since dpp expression is reduced in the absence of Wg signalling (Yu et al., 1996). Indeed, strong D-Fos antibody staining was observed throughout the endoderm if Dpp was expressed ubiquitously in wg cx4 mutant embryos (Fig. 3G), indicating that D- Fos can be expressed efficiently in the absence of wg. Furthermore, if Wg was expressed at high levels throughout the mesoderm of wild-type embryos, D-Fos antibody staining remained strong in a confined region of the endoderm which B D-Fos expression is induced by Dpp signalling Based on their expression patterns it seemed unlikely that lab would regulate D-Fos expression. Indeed, D-Fos antibody staining is unchanged in lab mutants (Fig. 3A). We asked whether D-Fos expression in the endoderm is induced by Dpp signalling. We found that, in dpp s4 mutant embryos, the band of elevated D-Fos expression in the second gut lobe is no longer visible (Fig. 3B). Conversely, when Dpp is expressed ubiquitously (using C Fig. 2. D-Fos protein distribution in the midgut. Dissected embryonic midguts (A,C,D, approx.13-hours old; B, approx. 16-hours old), stained with D-Fos (A,B,C) or Lab antibody (D); C and D, high magnification views; the dashed vertical line markes the ps7/8 boundary. D-Fos staining is visible in all endodermal cells, with clearly elevated levels in the second gut lobe (A,B); each nucleus in this lobe shows substantial, though slightly variable levels of D-Fos staining (C), contrasting with Lab staining which is undetectable in about half of the nuclei within this lobe (arrows in D; the overall gradient of Lab staining throughout its expression domain is not visible in this focal plane, which was chosen to visualise juxtaposed staining and non-staining nuclei). Anterior is to the left, dorsal is up (orientation the same in all figures). D

4 3356 J. Riese, G. Tremml and M. Bienz A B C D E F G H Fig. 3. Control of D-Fos induction in the midgut. 15- to 17-hour old embryos stained with D-Fos antibody; (A) lab vd1 mutant (indistinguishable from wild-type embryos, see Fig. 2A, B); (B) dpp s4 mutant; (C) wild-type embryo expressing ubiquitous Dpp (driven by hs.gal4); (D,E) shn TD5 mutants with (E) or without (D) ubiquitous Dpp; (F,G) wg cx4 mutants with (G) or without (F) ubiquitous Dpp; (H) wild-type embryo expressing high mesodermal Wg levels (driven by 24B.GAL4); D-Fos staining is strong, but still confined roughly to its normal expression domain (see text). The width of elevated D-Fos expression under each condition is indicated by the horizontal bar; lack of a bar signifies absence of D-Fos induction. roughly corresponds to the second gut lobe (Fig. 3H). This contrasts with lab expression which is mostly suppressed under these conditions of high Wg levels (Yu et al., 1996; unpublished results). Clearly, ectopic Wg does not induce D-Fos expression ectopically in the endoderm, nor do the high Wg levels produced by these conditions repress D-Fos in its normal domain. This strongly suggests that D-Fos expression is not controlled by wg either positively or negatively, and that the apparent requirement for wg is likely to be indirect (reflecting reduced Dpp signalling in wg mutants). Equivalent truncations of other bzip proteins have been used successfully to interfere with the function of their endogenous counterparts (e.g. Lloyd et al., 1991; Bohmann et al., 1994). We applied the GAL4 system (Brand and Perrimon, 1993) to express Fbz throughout the endoderm, using the driver line 48Y.GAL4 (Martin-Bermuda et al., 1997), and examined the effects of Fbz on midgut development. In parallel, we expressed in the same way bzip versions of potential dimerisation partners of D-Fos A dominant-negative form of D-Fos interferes with celltype specification in the larval gut D-Fos is strongly expressed in a region of the middle midgut which gives rise to the copper cells, interstitial cells and large flat cells of the larval midgut (Poulson, 1950; Fig. 1). We asked whether D-Fos is required for the differentiation of these cell types. As there are no D- Fos mutants, nor any genomic deletions in the region encoding D- Fos, we chose a dominant-negative approach to interfere with D-Fos function. We used a truncated version of D-Fos (Fbz; Eresh et al., 1997) which consists of the basic region leucine zipper (bzip) domain only. Fbz is expected to act dominant-negatively as it consists merely of the domain which confers DNA binding and dimerisation (see for example review by Lalli and Sassone-Corsi, 1994). Fig. 4. Effects of dominant-negative bzip constructs on copper cells. Midguts dissected from young larvae fed on copper medium for 30 hours (A-D) or for 60 hours (E) after hatching, viewed under UV light. Copper cells (orange fluorescing cells) in the wild type (A); after endodermal expression (with 48Y.GAL4) of Cbz (B) or of Fbz (C;D; in some of the Fbz-expressing larvae, copper cells are completely absent, see text); or after late ubiquitous expression (with hs.gal4) of Fbz (E; first pulse of expression 36 hours after larval hatching). Anterior to the left.

5 The role of D-Fos in endoderm induction 3357 (see Introduction), i.e. of D-Jun (Jbz) and of dcreb-2 (Cbz), as well as full length D-Fos, D-Jun and dcreb-2a (see Eresh et al., 1997; there is only one other CREB relative in Drosophila to date, dcreb-a, which does not appear to be expressed in the gut; Smolik et al., 1992; Eresh et al., 1997). We first examined the effects of Fbz on copper cells, by feeding freshly hatched larvae with copper-containing yeast, dissecting their guts and inspecting their copper cells under UV light (see Materials and Methods). We found that the numbers of copper cells in the Fbz-expressing larvae were strikingly reduced, albeit somewhat variably: in most first instar larvae, the band of copper cells was shortened to a rudimentary domain, of approx % normal length, whereas in about 5% of the Fbz-expressing larvae, copper cells were missing altogether (Fig. 4C,D). Cbz-expressing larvae also showed shortened copper cell domains (Fig. 4B, compare to A), although the degree of interference with copper cell development in this case was significantly milder than in Fbz-expressing larvae. This effect of Cbz on copper cells could simply reflect the observed interference of Cbz on embryonic lab expression (Eresh et al., 1997; see below). We did not observe any copper cell phenotypes after expression of Jbz, nor after overexpression of any of the full-length proteins D-Fos, D-Jun and dcreb-2a. Evidently, the phenotypic effects of the three bzip domains are distinguishable, implying specificity of their action. Note that D-Fos is capable of activating transcription by itself, without the help of D-Jun (Perkins et al. 1990), probably explaining the distinct actions of Fbz and Jbz. To see whether D-Fos has a function in the larval gut, we expressed Fbz with hs.gal4, applying heat shocks at specific times during larval development. If we heat-shocked these larvae for the first time as late as the second larval stage, the numbers of copper cells observed were greatly reduced; often, copper cells were completely suppressed by this treatment (Fig. 4E). This effect was not due to the heat shock nor to GAL4, as control larvae treated the same way were completely normal (not shown). We could not assess the effect of late Cbz expression on copper cells since hs.gal4-mediated Cbz expression under these conditions turned out to be lethal to larvae; sub-lethal doses of heat shocks did not produce any copper cell defects (see Materials and Methods). The Cbz-induced lethality is probably due to a requirement for CREB in tissues other than the gut since the Fbzexpressing larvae which lack copper cells do survive for one or two days. We asked whether Fbz A B C D expression could interfere with the differentiation of other cell types in the middle midgut, e.g. of interstitial or large flat cells (see Fig. 1). We monitored the expression of β-gal markers for interstitial cells and for large flat cells (see Hoppler and Bienz, 1995) after expressing Fbz throughout the endoderm. Examining the Fbz-expressing larvae, we found that the number of cells expressing the interstitial cell marker C5-2-7 was strongly reduced (Fig. 5B, compare to A), reflecting the drastic shortening of the copper cell domain under these conditions (see Fig. 4C). Accordingly, β-gal staining due to the large flat cell marker A extends much further anteriorly in these Fbz-expressing larvae (Fig. 5D, compare to C). This suggests that at least some of the cells in the prospective copper cell domain become large flat cells instead of copper cells or interstitial cells. Fbz interferes with lab expression There are two explanations for why Fbz interferes with cell differentiation in the larval gut: either, D-Fos is required in parallel to, and independently of, lab for copper cell development, or D-Fos acts through lab, by stimulating its expression, to promote copper cell development. To distinguish between these possibilities, we first analysed the expression of a lab/lacz reporter gene (-6.3lab; Tremml and Bienz, 1992) in guts of Fbz-expressing larvae (driver line 48Y.GAL4). In these larvae, the number of β-gal-expressing Fig. 5. Effects of Fbz on other endodermal cells. Midguts stained for β-gal activity dissected from larvae (30 hours after hatching) which bear the interstitial cell marker C5-2-7 (A,B) or the large flat cell marker A (C,D). (A,C) Wild-type midgut; (B,D) midgut after endodermal Fbz expression (with 48Y.GAL4). Arrowheads in A and B indicate the posterior ends of the interstitial cell domains (note that this domain is shortened in B, paralleling a similar shortening of the copper cell domain, see Fig. 4C); arrowheads in (C,D) indicate the anterior ends of the large flat cell domains (widened in D, perhaps as a result of the shortening of the copper/interstitial cell domain in these larvae, see B and Fig. 4C).

6 3358 J. Riese, G. Tremml and M. Bienz A B C D E F G H Fig. 6. Effects of Fbz on lab and on lab reporter gene expression. Larval midguts (A-D) or embryos (E,F, approx. 15-hours old; G,H, approx. 13-hours old) from transformants bearing -6.3lab, stained for β-gal activity (A-D), or with Lab (E,F) or β-gal antibody (G,H). (A,B,E,G) Wild type; (C,D,F,H) after endodermal Fbz expression (with 48Y.GAL4). The shortened lab expression domain in (F) causes a shortened copper cell domain (see also Fig. 4C); note that the staining cells in C are differentiated copper cells, as vizualised at high magnification in D (compare to B). Fbz partially suppresses lab (F, compare to E) and -6.3lab expression (H, compare to G). cells is much reduced (Fig. 6C, compare to A), and the β-galstaining cells could be identified as the remaining copper cells on the basis of their characteristic morphology (Fig. 6D, compare to B). As observed before (see above), about 5% of the larvae did not show any β-gal staining or any cells remotely reminiscent of copper cells (not shown). This indicates that D- Fos acts upstream of lab. We also examined lab and -6.3lab expression in Fbzexpressing embryos (driver line 48Y.GAL4). We found that far fewer endodermal cells express lab in these embryos compared to the wild type (Fig. 6F, compare to E). This was true even at early embryonic stages, shortly after the onset of Dppmediated induction (Fig. 6H, compare to G). Since β-gal is very stable, we would expect to see at least transient β-gal staining in all cells that potentially express lab. As this is clearly not the case, it follows that Fbz must have an effect on lab induction as early as we can detect it. Similar results were obtained with Cbz which also interfered with embryonic, and to some extent with larval -6.3lab expression (not shown; see also Eresh et al., 1997). Jbz had no effect on lab nor on -6.3lab expression when expressed the same way. These results suggest an early function of D-Fos during lab induction. DISCUSSION Our work identifies D-Fos as a target gene of dpp during endoderm induction in the Drosophila embryo: D-Fos protein visceral mesoderm endoderm labial dpp D-Fos wg Fig. 7. Regulatory hierarchy between Dpp, D-Fos and lab during endoderm induction: a summary. Dpp is secreted from the visceral mesoderm and induces D-Fos and lab in the subjacent endoderm; the two inductive steps are distinct and parallel. Dpp also stimulates wg expression in the visceral mesoderm which synergises with Dpp to induce lab in the endoderm. Lab is required for its own induction. According to our evidence, D-Fos is required in parallel to Dpp and to Wg signalling, and also to Lab itself, for lab induction. We propose that D-Fos cooperates with Lab and/or with the signal response factors that are activated directly by the two signals to stimulate lab transcription. As a result of this complex cooperation, the pattern of lab expression is narrower and more precisely defined than the broader induction pattern of D-Fos expression. Note also that D-Fos, like Lab itself, is still required to maintain lab expression during larval development, long after the inducing signals have disappeared, suggesting a function of D-Fos in memorising the signal-induced active state of lab transcription.

7 The role of D-Fos in endoderm induction 3359 levels are induced locally in the midgut epithelium by Dpp signalling, in parallel to induction of lab expression in the same region of this cell layer. Furthermore, we show that a dominantnegative version of D-Fos interferes with lab expression in the embryonic and larval midgut epithelium and, apparently as a consequence, affects cell-type specification in the larval gut. This argues for a continuous requirement of D-Fos in inducing and maintaining lab expression in the endoderm. We propose that Dpp primarily induces D-Fos expression in this germ layer, and that D-Fos cooperates with the signal response factors activated by Dpp and/or by Wg to induce lab within a region of the midgut epithelium broadly defined by high D-Fos levels (Fig. 7; see below). Differences in Dpp-mediated induction of D-Fos and lab High levels of D-Fos protein are induced by Dpp signalling in the second lobe of the embryonic midgut epithelium. These high protein levels evidently parallel high levels of D-Fos RNA in the same domain (Perkins et al., 1990), implying that the induction by Dpp occurs at the level of RNA accumulation. Despite extensive searching through the cis-regulatory upstream and intervening sequences of D-Fos, enhancers mediating endoderm expression were not found (Hoppler, 1993). Nevertheless, we think it likely that the Dpp-mediated induction of D-Fos expression reflects a transcriptional stimulation. lab expression is also induced by Dpp signalling to high expression levels in the same section of the embryonic endoderm (Immerglück et al., 1990; Reuter et al., 1990; Panganiban et al., 1990; Newfeld et al., 1996). In this case, the Dpp-mediated induction is known to occur at the transcriptional level (Chouinard and Kaufman, 1991; Tremml and Bienz, 1992; Eresh et al., 1997). However, endodermal induction of D-Fos is distinct from that of lab in a number of key aspects, as follows. First of all, the two genes are induced in distinct sets of cells: D-Fos is induced, as far as we can tell, in all endodermal cells that are juxtaposed to the Dpp-expressing visceral mesoderm cells, whereas lab is induced only in a subset of these cells. Also, the band of D-Fos-expressing cells is wider, especially posteriorly, than the band of lab-expressing cells. Secondly, D- Fos induction is less steep than lab induction: D-Fos expression is stimulated only moderately from a low constitutive expression level throughout the endoderm, whereas lab expression is highly stimulated (from low expression levels in the endoderm primordia), and there is no detectable lab expression elsewhere in the endoderm. These differences in induction patterns reflect different genetic requirements. lab is not only stimulated by Dpp, but is also controlled both positively and negatively by wg, depending on Wg levels (Immerglück et al., 1990; Hoppler and Bienz, 1995), whereas D-Fos expression does not appear to be controlled directly by Wg signalling. The lack of this control by Wg probably explains why D-Fos expression is wider than lab expression, why D-Fos is not graded from anterior to posterior like Lab, and perhaps also why D-Fos is not induced as steeply as lab. Notably, the pattern of lab expression in wg mutants (Immerglück et al., 1990) is reminiscent of D-Fos expression in the wild type. A surprising difference was revealed by the shn mutant embryos. lab expression is abolished in shn mutants, even if Dpp is supplied exogenously in the mutant embryos, ascribing a function downstream of Dpp signalling to the zinc finger-containing Shn protein (Arora et al., 1995; Grieder et al., 1995). In contrast, we found that D-Fos induction is just as strong in shn mutants (with resupplied Dpp) as in the wild type, if not stronger. Clearly, endodermal cells do not require shn to induce D-Fos. D-Fos induction in the endoderm is therefore the first process known to depend on dpp but not on shn, suggesting that Shn is not an obligatory effector of all Dpp signalling. In summary, D-Fos induction is less complex than lab induction both in terms of pattern and genetic requirements. The D-Fos expression domain with its blurred limits is less well defined than the lab expression domain. The numerous differences between D-Fos and lab induction strongly indicate that, fundamentally, the two genes are induced in parallel, and separately, by Dpp signalling (though see below, and Fig. 7). A continuous function of D-Fos in controlling lab expression lab is clearly not required for endodermal D-Fos expression. Conversely, we have presented evidence that D-Fos is required for lab expression in the embryonic and larval midgut. Thus, lab appears to be a target gene of D-Fos in the midgut. According to our evidence, D-Fos is required for lab expression from the onset of induction by Dpp and Wg signalling. This raises the possibility that D-Fos is itself a signalling response factor; recall also that c-fos target sequences are frequently signal response sequences (see Introduction). If so, D-Fos could mediate the response of lab to Wg or to Dpp. The former is very unlikely since a transcription factor related to T cell factor (dtcf) appears to be dedicated to mediate the Wg response in the midgut (Riese et al., 1997; van de Wetering et al., 1997). However, the latter is possible: the Dpp response sequence in the midgut is a CRE (Eresh et al., 1997), and D- Fos is potentially a bzip protein that can act through a CRE (Hai and Curran, 1991). In fact, the CRE is the only obvious candidate for a D-Fos target sequence within the minimal lab enhancer which contains no matches to the AP1 binding site consensus sequence (Tremml, 1991) to which D-Fos is known to bind (Perkins et al., 1990). And although we failed to detect interference of Fbz with 5CRE-mediated expression (Eresh et al., 1997), this does not rule out the possibility that D-Fos acts through the CREs in the lab enhancer, especially if it interacted with another DNA-binding protein to do so. Most likely, Fbz mimics only partial loss-of-function of D-Fos; it may retain, for example, the ability to interact with a partner protein. Analysis of D-Fos mutants will be required to resolve this question as to whether or not D-Fos targets the CREs in the lab enhancer to mediate lab induction. Finally, it remains possible that D-Fos mediates lab induction by a distinct as yet unknown signal. Regardless of whether D-Fos protein itself is activated by signalling, it is likely that D-Fos cooperates with signal response factors to induce lab transcription. Another putative partner of D-Fos during this process is Lab protein itself (Fig. 7) which is required for lab induction (Tremml and Bienz, 1992). Our results provide strong evidence for a late and continuous function of D-Fos in maintaining lab expression in the embryonic and larval midgut epithelium. Even as late as the

8 3360 J. Riese, G. Tremml and M. Bienz second larval stage, Fbz can cause loss of -6.3lab expression in the larval gut. It also causes loss of copper cells at this stage, i.e. after their terminal differentiation. Maintenance of lab expression and of differentiated copper cells requires continuous lab function; lab is therefore autostimulatory throughout larval development (Hoppler and Bienz, 1994). Our observed effect of Fbz on copper cells may be indirect, reflecting the stimulatory function of D-Fos on lab. The same may apply to the other cell types that are affected by Fbz, the interstitial cells and the large flat cells, which are affected similarly by loss of, or by overriding, lab expression (Hoppler and Bienz, 1995). D- Fos may thus cooperate with Lab protein to stimulate lab transcription from the early inductive stage in the embryo through larval development. A role of D-Fos in predisposing endodermal cells to induce and maintain lab expression? Our analysis shows that Dpp induces D-Fos in a broad domain of the endoderm within which lab is induced more steeply and more sharply. It thus appears as if D-Fos predisposes endodermal cells to express high levels of Lab and, ultimately, to differentiate into copper cells. This predisposition may depend on the D-Fos protein levels being high (recall that there are low levels of D-Fos throughout the endoderm), and/or on D-Fos being activated by a local signal (see above). Why would there be such a need for predisposition? Regulatory interactions have an intrinsically limited reliability and specificity, and their being safeguarded against random fluctuations appears necessary and important (see for example Ptashne, 1986). Safeguarding would appear to be especially important when the regulatory states of selector genes are concerned: not only are these genes required throughout development for the differentiation of the structures they normally specify, but these genes can also respecify the fates of other cells if inappropriately expressed in these cells (Lawrence, 1992). For example, lab is a selector gene which is required for copper cells until, and even beyond, their terminal differentiation and which produces ectopic copper cells if expressed inappropriately (Hoppler and Bienz, 1994). D-Fos may predispose endodermal cells for lab induction and expression, to ensure maintenance of lab expression in pre-copper and in copper cells throughout embryonic and larval development, but also indirectly to safeguard against fortuitous lab induction in inappropriate endodermal cells. Finally, lab expression is initially induced by dpp and wg, but these genes signal only transiently in the embryo, yet the active state of lab induced by these signals is remembered, and propagated, throughout embryonic and larval development. D-Fos may contribute to the memory of pre-copper and copper cells that allows them to maintain the active state of the lab gene independently of the signals that initiated it. Stepwise refinement of positional information We have presented evidence that endoderm induction involves the parallel induction of two genes which have, or acquire, a hierarchical regulatory relationship with respect to one another. Moreover, the pattern of induction of the controlling gene (D- Fos) is broader and less precise than that of the controlled gene (lab). This is reminiscent of the early embryonic patterning events where morphogen gradients of transcription factors loosely define the expression domains of segmentation genes whose products cooperate with the former to control the more precise expression of target genes (Ip et al., 1992; see also Introduction). In that case, the graded positional information is conferred from within cells, while it is conferred extracellularly by signals during endoderm induction. Nevertheless, the same principle appears to be at work: precise patterning is not effected solely by one critical determinant, but is achieved in a complex process involving parallel and interdependent action of multiple positional inputs. We are very grateful to Nick Brown for giving us the fly strain 48Y.GAL4 which was invaluable for this work. We also thank Dirk Bohmann and David Jackson for discussion of unpublished results, Julie Ahringer and Paul Badenhorst for help and discussion, and Matthew Freeman and Stefan Hoppler for comments on the manuscript. This work was initially supported by the Swiss National Science Foundation (grant nr to M. B.), and subsequently by the Boehringer Ingelheim Fonds and by the Medical Research Council (studentship to J. R.). REFERENCES Akam, M. (1987). The molecular basis for metameric pattern in the Drosophila embryo. Development 102, Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rahmsdorf, H. J., Jonat, C., Herrlich, P. and Karin, M. (1987). Phorbol ester-inducible genes containing a common cis element recognized by a TPA-modulated transacting factor. Cell 49, Arora, K., Dai, H., Kazuko, S. G., Jamal, J., O Connor, M. B., Letsou, A. and Warrior, R. (1995). The Drosophila schnurri gene acts in the Dpp/TGFβ signaling pathway and encodes a transcription factor homologous to the human MBP family. Cell 81, Baker, N. E. (1987). Molecular cloning of sequences from wingless, a segment polarity gene in Drosophila: the spatial distribution of a transcript in embryos. EMBO J. 6, Bienz, M. (1996). Induction of the endoderm in Drosophila. Semin. Cell Dev. Biol. 7, Bohmann, D., Admon, A., Turner, A. and Tijan, R. (1988). Transcriptional regulation by the AP-1 family of enhancer-binding proteins: a nuclear target for signal transduction. Cold Spring Harbour Symp. Quant. Biol. 53, Bohmann, D., Ellis, M. C., Staszewski, L. M. and Mlodzik, M. (1994). Drosophila Jun mediates Ras-dependent photoreceptor determination. Cell 78, Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, Campos-Ortega, J. A. and Hartenstein, V. (1985). The Embryonic Development of Drosophila melanogaster. Berlin: Springer Verlag. Chouinard, S. and Kaufman, T. C. (1991). Control of expression of the homeotic labial (lab) locus of Drosophila melanogaster: evidence for both positive and negative autogenous regulation. Development 113, Diederich, R. J., Merrill, V. K., Pultz, M. A. and Kaufman, T. C. (1989). Isolation, structure, and expression of labial, a homeotic gene of the Antennapedia Complex involved in Drosophila head development. Genes Dev. 3, Eresh, S., Riese, J., Jackson, D. B., Bohmann, D. and Bienz, M. (1997). A CREB binding site as target for decapentaplegic signalling during Drosophila endoderm induction. EMBO J. 16, Grieder, N. C., Nellen, D., Burke, R., Basler, K. and Affolter, M. (1995). Schnurri is required for Drosophila dpp signaling and encodes a zinc finger protein similar to the mammalian transcription factor PRDII-BF1. Cell 81, Hai, T. and Curran, T. (1991). Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. Proc. Natl. Acad. Sci. USA 88, Hartenstein, V. and Jan, Y. N. (1992). Studying Drosophila embryogenesis with P-lacZ enhancer trap lines. Roux s Arch. Dev. Biol. 201,

9 The role of D-Fos in endoderm induction 3361 Hoppler, S. (1993). Function of a Homeotic Gene in the Endoderm of Drosophila. Ph.D. thesis, University of Zürich. Hoppler, S. and Bienz, M. (1994). Specification of a single cell type by a Drosophila homeotic gene. Cell 76, Hoppler, S. and Bienz, M. (1995). Two different thresholds of wingless signalling with distinct developmental consequences in the Drosophila midgut. EMBO J. 14, Immerglück, K., Lawrence, P. A. and Bienz, M. (1990). Induction across germ layers in Drosophila mediated by a genetic cascade. Cell 62, Ip, Y. T., Levine, M. and Small, S. J. (1992). The bicoid and dorsal morphogens use a similar strategy to make stripes in the Drosophila embryo. J. Cell Sci. 16 Supplement, Lalli, E. and Sassone-Corsi, P. (1994). Signal transduction and gene regulation: The nuclear response to camp. J. Biol. Chem. 260, Lawrence, P. A. (1992). The Making of a Fly: the Genetics of Animal Design. Blackwell Scientific Publications, Oxford and Boston. Lawrence, P. A., Bodmer, R. and Vincent, J.- P. (1995). Segmental patterning of heart precursors in Drosophila. Development 121, Lloyd, A., Yancheva, N. and Wasylyk, B. (1991). Transformation suppressor activity of a jun transcription factor lacking its activation domain. Nature 352, Martin-Bermudo, M. D., Dunin-Borkowski, O. M. and Brown, N. H. (1997). Specificity of PS integrin function during embryogenesis resides in the α subunit extracellular domain. EMBO J., in press. Müller, J. and Bienz, M. (1992). Sharp anterior boundary of homeotic gene expression conferred by the fushi tarazu protein. EMBO J. 11, Newfeld, S. J., Chartoff, E. H., Graff, J. M., Melton, D. A. and Gelbart, W. M. (1996). Mothers against dpp encodes a conserved cytoplasmic protein required in DPP/TGF-β responsive cells. Development Nüsslein-Volhard, C., Wieschaus, E. and Kluding, H. (1984). Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. I. Zygotic loci on the second chromosome. Roux s Arch. Dev. Biol. 193, Padgett, R. W., St. Johnston, R. D. and Gelbart, W. M. (1987). A transcript from a Drosophila pattern gene predicts a protein homologous to the transforming growth factor-β family. Nature 325, Panganiban, G. E. F., Reuter, R., Scott, M. P. and Hoffmann, F. M. (1990). A Drosophila growth factor homolog, decapentaplegic, regulates homeotic gene expression within and across germ layers during midgut morphogenesis. Development 110, Perkins, K. K., Admon, A., Patel, N. and Tjian, R. (1990). The Drosophila Fos-related AP-1 protein is a developmentally regulated transcription factor. Genes Dev. 4, Poulson, D. F. (1950). Histogenesis, organogenesis, and differentiation in the embryo of Drosophila melanogaster Meigen. In The Biology of Drosophila (ed. M. Demerec), pp Hafner, New York. Ptashne, M. (1986). A Genetic Switch. Blackwell, Cambridge, MA; Cell, Cambridge, MA). Qian, S., Capovilla, M. and Pirrotta, V. (1991). The bx region enhancer, a distinct cis-control element of the Drosophila Ubx gene and its regulation by hunchback and other segmentation genes. EMBO J. 10, Reuter, R., Panganiban, G. E. F., Hoffmann, F. M. and Scott, M. P. (1990). Homeotic genes regulate the spatial expression pf putative growth factors in the visceral mesoderm of Drosophila embryos. Development 110, Riese, J., Yu, X., Munnerlyn, A., Eresh, S., Hsu, S.-C., Grosschedl, R. and Bienz, M. (1997). LEF-1, a nuclear factor coordinating signalling inputs from wingless and decapentaplegic. Cell 88, Rijsewijk, F., Schuermann, M., Wagenaar, E., Parren, P., Weigel, D. and Nusse, R. (1987). The Drosophila homolog of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless. Cell 50, Shimell, M. J., Simon, J., Bender W. and O Connor, M. B. (1994). Enhancer point mutation results in a homeotic transformation in Drosophila. Science 264, Smolik, S. M., Rose, R. E. and Goodman, R. H. (1992). A cyclic AMPresponsive element-binding transcriptional activator in Drosophila melanogaster, dcreb-a, is a member of the leucine zipper family. Mol. Cell. Biol. 12, Staehling-Hampton, K. and Hoffmann, F. M. (1994). Ectopic decapentaplegic in the Drosophila midgut alters the expression of five homeotic genes, dpp, and wingless, causing specific morphological defects. Dev. Biol. 164, Thüringer, F., Cohen, S. M. and Bienz, M. (1993). Dissection of an indirect autoregulatory response of a homeotic Drosophila gene. EMBO J. 12, Treier, M., Bohmann, D. and Mlodzik, M. (1995). JUN cooperates with the ETS domain protein pointed to induce photoreceptor R7 fate in the Drosophila eye. Cell 83, Tremml, G. (1991). Interaktionen homeotischer Gene in inneren Keimblattern des Drosophila Embryos. Ph.D. Thesis, University of Zürich. Tremml, G. and Bienz, M. (1992). Induction of labial expression in the Drosophila endoderm: response elements for dpp signalling and for autoregulation. Development 116, van de Wetering, M., Cavallo, R., Dooijes, D., van Beest, M., van Es, J., Loureiro, J., Ypma, A., Hursh, D., Jones, T., Bejsovec, A., Peifer, M., Mortin, M. and Clevers, H. (1997). Armadillo coactivates transcription driven by the product of the Drosophila segment polarity gene dtcf. Cell 88, Yu, X., Hoppler, S., Eresh, S. and Bienz, M. (1996). decapentaplegic, a target gene of the wingless signalling pathway in the Drosophila midgut. Development 122, (Accepted 30 June 1997)