Technology Platform 2018
|
|
- Scott Allison
- 5 years ago
- Views:
Transcription
1 Technology Platform 2018
2 Forward Looking Statements This presentation contains forward-looking statements within the meaning of the "safe harbor" provisions of the Private Securities Litigation Reform Act of 1995, as amended. These forward-looking statements include, but are not limited to, financial guidance for full year 2017 as it relates to revenues, operating expenses, and year end cash balances; the design of clinical trials and expected timing for release of data; the anticipated clinical development milestones and other potential value drivers in the future; the expected benefits of the collaboration with Pfizer, the expanded capability of Sangamo s technologies; the benefits of rebranding and reorganization, the research and development of novel gene-based therapies and the application Sangamo s ZFP technology platform to specific human diseases; corporate partnerships; and the potential of Sangamo s genome editing technology to treat genetic diseases. These statements are based upon our current expectations and speak only as of the date hereof. Our actual results may differ materially and adversely from those expressed in any forward-looking statements as a result of various factors and uncertainties. Factors that could cause actual results to differ include, but are not limited to, the dependence on the success of clinical trials of lead programs, the lengthy and uncertain regulatory approval process, uncertainties related to the timing of initiation and completion of clinical trials, whether clinical trial results will validate and support the safety and efficacy of Sangamo s therapeutics, the ability to establish strategic partnerships and our ability to control expenses and achieve our milestones that generate revenues under our agreements. Further, there can be no assurance that the necessary regulatory approvals will be obtained or that Sangamo and its partners will be able to develop commercially viable gene-based therapeutics. Actual results may differ from those projected in forward-looking statements due to risks and uncertainties that exist in Sangamo s operations and business environments. These risks and uncertainties are described more fully in Sangamo s Annual Reports on Form 10-K and Quarterly Reports on Form 10-Q as filed with the Securities and Exchange Commission. Forward-looking statements contained in this presentation are made as of the date hereof, and Sangamo undertakes no duty to update such information except as required under applicable law. 2
3 We are committed to translating ground-breaking science into genomic therapies that transform patients lives 3
4 Sangamo is investing across four technological platforms for genomic medicines Gene Therapy Genome Editing Cell Therapy Gene Regulation 4
5 Product portfolio diversified across therapeutic area and technology Therapeutic Area Research Preclinical Phase 1/2 Phase 3 Collaborator Inherited Metabolic Diseases MPS I (SB-318) MPS II (SB-913) Fabry Disease (ST-920) Hematology Hemophilia A (SB-525) Hemophilia B (SB-FIX) Beta-thalassemia (ST-400) Sickle Cell Disease (BIVV-003) CNS Diseases Tauopathies ALS/FTLD - C9ORF72 Huntington s Disease Oncology Autologous and Allogeneic CAR/TCR/NKR Immunology Undisclosed Autoimmune Disease Targets Investigator Sponsored Clinical Research HIV (T cell and Stem Cell) Gene Therapy Genome Editing Cell Therapy Gene Regulation 5
6 ZFNs: The platform of choice for therapeutic genome editing T A C C C A A C G C G A A T T A T G A T G G G T T G C G C T T A A T A C ZFN T G C G C T T A A C G C A T G G G T A C G C G A A T T G C G T A C C C A ZFPs Precision Target any desired nucleotide in the genome ZFPs ZFN ZFNs Efficiency Level of modification at the desired target nucleotide Specificity Edit the targeted nucleotide without editing elsewhere in the genome 6
7 Two-finger modules used for design COOH NH 2 Enables more specific binding Allows one-step gene assembly 5 T A C C C A 3 7
8 Modular platform enables rapid assembly two-finger modules: 6 base pair subsites: T A C C C A 3 5 A C G C G A 3 5 A T T G C G 3 six finger ZFP: COOH NH 2 18 base pair target site: 5 T A C C C A A C G C G A A T T G C G 3 8
9 Summary of design components intermodule linkers ZFP-Fok linker module module module 5 3 T A C A T G C C A A C G C G A A T T A T G G C G G C G T G C G C T T A A C G C A T G G G T G G T T G C G C T T A A T A C C G C C G C A C G C G A A T T G C G T A C C C A module module module ZFP-Fok linker intermodule linkers Modules: 1- and 2-finger units that >8000 hexamer / module combinations recognize base sequence Intermodule connect adjacent modules 6 alternatives for skipping 0, 1, or 2 bp linkers: ZFP-Fok linker: links the Fok and ZFP domains 5 alternatives for skipping 5-9 bp 4 alternatives for reversing Fok-ZFP polarity 9
10 Base-skipping linkers yield a further 80-fold increase module module module Standard linkers / no skipping: 1 module configuration A T T A A G C A A C G G T A A A T A G G G G G G G G T G C G A T T A A G A C A T G T G A T A T A A T T C G T T G C C A T T T A T C C C C G G G G A C G C T A A T T C T G T A C A C T A T module module module Linker variants that skip a base: 4 configurations / ZFN = 16 configurations / dimer Baseskipping linkers A T T A A G C A A C G G T A A A T A G G G G G G G G T A A T T C G T T G C C A T T T A T C C C C G G G G A T T A A G C A A C G G T A A A T A G G G G G G G G T A A T T C G T T G C C A T T T A T C C C C G G G G A T T A A G C A A C G G T A A A T A G G G G G G G G T A A T T C G T T G C C A T T T A T C C C C G G G G G T G C G A T T A A G A C A T G T G A T A G A C G C T A A T T C T G T A C A C T A T G T G C G A T T A A G A C A T G T G A T A G A C G C T A A T T C T G T A C A C T A T G T G C G A T T A A G A C A T G T G A T A G A C G C T A A T T C T G T A C A C T A T One skip One skip A T T A A G C A A C G G T A A A T A G G G G G G G G T A A T T C G T T G C C A T T T A T C C C C G G G G G T G C G A T T A A G A C A T G T G A T A G A C G C T A A T T C T G T A C A C T A T Two skips Single + 2 bp skipping: 81 configurations / dimer (not shown) 10
11 Reversing Fok-ZFP Order Increases Design Options 4-fold Standard Fok attachment point Standard ZFN dimer COOH COOH NH 2 T A C CCA A C G C G A A T T A T G A T G GGT T G C G C T T A A T A C T G C G C T T A A C G C A T G GGT A C G C G A A T T G C G T A C CCA Bottom-Top T G C G C T T A A C G C A T G A C G C G A A T T G C G T A C G G T C C A COOH Alternative dimers for same target sequence COOH NH 2 Amino-terminal attachment T A C CCA A C G C G A A T T A T G A T G GGT T G C G C T T A A T A C T G C G C T T A A C G C A T G GGT A C G C G A A T T G C G T A C CCA Top-Top COOH T A C CCA A C G C G A A T T A T G A T G GGT T G C G C T T A A T A C T G C G C T T A A C G C A T G GGT A C G C G A A T T G C G T A C CCA Bottom-Bottom NH 2 T G C G C T T A A C G C A T G G G T COOH NH 2 A C G C G A A T T G C G T A C C C A NH 2 T A C CCA A C G C G A A T T A T G A T G GGT T G C G C T T A A T A C T G C G C T T A A C G C A T G GGT A C G C G A A T T G C G T A C CCA Top-Bottom 11 NH 2
12 Further improvements increase specificity while maintaining high levels of gene modification Removal of conserved, non-specific phosphate contacts from zinc finger proteins increases targeting specificity Modified Fok nuclease-dna contacts significantly reduces off-target cleavage events zinc finger DNA Conserved Arg phosphate contact Elrod-Erickson et al., Structure AAY.pdb 12
13 Phosphate contacts modulate global specificity DNA zinc finger Fok domain Fok domain Conserved Arg phosphate contact Lys phosphate contact 13
14 Recent innovations drive exceptional performance Innovation Result Efficiency Precision Specificity New linkers for configuring DNA-binding modules 300-fold increase in design options for targeting any given sequence Efficiency Precision Specificity New dimer architectures yield higher modification activity Increase DNA editing efficiency to as high as 99.5% Efficiency Precision Specificity Phosphate contact tuning via replacement of key residues Off-target cleavage undetectable (>1000 fold reduction) 14
15 Specificity improved >1000 fold via key substitutions # modified fingers Fok domain substitution % Indels BCL11A Off-target A Off-target C (Arg --> Gln) 6 ug 2 ug 0.5ug 6 ug 2 ug 0.5ug 6 ug 2 ug 0.5ug R416S R33S R416S R33S R416S R33S R416S R33S K142S K525S K142S K525S Parent ZFN Off-target activity reduced > 1000x Notes: Grey font = No evidence of ZFN cleavage Test system: ZFNs targeted to BCL11A erythroid enhancer (Nat Methods 12, 927) CD34 + cells; delivery via RNA transfection (BTX) 15
16 ZFNs offer significantly higher success rate for cleaving close to an arbitrarily chosen base Fraction of bases in globin test region ZFN platform G(N20)GG motif Distance (bp) to nearest cleavage site 16
17 Design density allows Sangamo to select a ZFN optimized for ontarget efficiency and maximal therapeutic effect G A A G a T t A t T T A C G A A G a t A X G a X C C T A T a G T t X T T A C T A G T t a X C T C T G T C T A G t X A A X T T C T A G T t a C T A X T T T G T C T A t G A T T a G T C T A t X T A T A G X T A a T G X G g A A G G G A X A G a T T g G G A g A G G G T A a T G X G X T A A G G G G a T T G X G g A G G G G G C T C G G T A G G G T A a X C A X T T X C A a T G G T A a T A A G G T a T X G A C X C A T A a A T T A a C T X C G G T X A T A a A G G X C A G T T a T C G T G C A A X T X A T X C A T X T G T G C A A a X G T X A X C A X G G T X t T G G C C X A X T G T A A X C t a C T C C A T a T C X C t X T C C A A X a C C T A X C t G C T a T A A C X G C T a X t C C A A C X X C C X T T t A X C A G T X t T C T G A T X A G T t A X G T X X G G g t A A C t G T G g X G t A G T T T t A X G t G T T G C T T T T A T C a C A G G C T X A A G G G T T T G G C C T C T G A T TTGAAGCTAGTCTAGTGCAAGCTAACAGTTGCTTTTATCACAGGCTCCAGGAAGGGTTTGGCCTCTGATTAGGG C T A A C A G X T T G C T T T T A T C A C A G G C X C C A G G 17
18 Structural flexibility provides diverse architectures for targeting any DNA segment ZFN ZFN average (455) Distinct architectures available for design (20 bp window) HiFi Cas HiFi Cas9 average (1.07) Base location in β-globin gene Sickle mutation 18
19 Reactivation of fetal hemoglobin (HbF) to treat beta-thalassemia and sickle cell disease Fetal Hemoglobin (HbF) Adult Hemoglobin (HbA) g β g β γ-globin in HbF raises oxygen affinity, confers anti-sickling effects HbF protects infants from β- thal, SCD manifestations until birth, when γ-globin is downregulated by BCL11A β-globin defects (SCD) and scarcity (β-thal) caused by hundreds of different mutations 19
20 Reactivation of HbF in erythroid lineage achieved by targeted KO in CD34+ stem cells at key nucleotide within BCL11A enhancer Natural genetic variants in BCL11A reactivate HbF, which protects against disease symptoms and increases lifespan in β-thal 1 and SCD patients 2 Erythroid-specific enhancer in BCL11A selectively reactivates HbF in erythroid lineage while preserving normal immune cell functions Precise disruption at key nucleotide maximizes γ-globin expression 3 enhancer sequence BCL11A gene Strategic Advantages for Treating β-thalassemia and SCD Non-viral delivery of ZFN mrna for possibly superior long-term safety Precise disruption of key nucleotide in BCL11A erythroidspecific enhancer, based on naturally protective variations Fetal hemoglobin has natural features (stronger oxygen affinity, anti-sickling properties) found to protect against disease symptoms in patients 1,2 1 Platt et al. Blood (1994) 2 Musallam et al. Blood (2012) 3 Vierstra, J. et al. Nat. Methods (2015) 20
21 % indels Deep understanding of protein DNA interaction allows us to engineer ZFNs with unparalleled specificity High on-target modification (82%) Strategic Advantages Defined engineering refinements to protein structures rapidly generate ZFP constructs with high on-target activity No significant off-target modification seen compared to control Locus rank No detectable off-target activity using state-of-theart, unbiased oligo capture assay and deep sequencing Deep sequencing results for 55 loci identified by state-of-art unbiased oligo capture methods (assay background generally <0.1%) for potential off-target activity. Performed in CD34 hematopoietic stem cells treated with ZFNs at clinical scale. 21
22 Thank you.
This presentation contains forward-looking statements within the meaning of the "safe harbor" provisions of the Private Securities Litigation Reform
This presentation contains forward-looking statements within the meaning of the "safe harbor" provisions of the Private Securities Litigation Reform Act of 1995, as amended. These forward-looking statements
More informationHitting HBV everywhere; why RNAi holds so much potential as a platform therapy in CHB
Hitting HBV everywhere; why RNAi holds so much potential as a platform therapy in CHB Bruce D. Given, M.D. COO, Arrowhead Pharmaceuticals Science of HBV Cure 2018 June 8, 2018 Safe Harbor Statement This
More informationInvestor and Analyst Breakfast
Investor and Analyst Breakfast American Society for Gene & Cell Therapy Annual Meeting Washington, D.C. May 12, 2017 This presentation contains forward-looking statements. All statements other than statements
More informationJefferies Gene Editing/Therapy Summit Matthew Kapusta, Interim Chief Executive Officer OCTOBER 11, 2016
Jefferies Gene Editing/Therapy Summit Matthew Kapusta, Interim Chief Executive Officer OCTOBER 11, 2016 This presentation contains forward-looking statements. All statements other than statements of historical
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationDocument category: There is no restriction on the circulation of this document
GA2-06 Agenda Item 2 Issued: 16 January 2018 CIMMYT Position on gene editing: An example to support the development of a common position on gene editing Purpose This document provides CIMMYT s Position
More informationCellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2
Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized
More informationGSBHSRSBRSRRk IZTI/^Q. LlML. I Iv^O IV I I I FROM GENES TO GENOMES ^^^H*" ^^^^J*^ ill! BQPIP. illt. goidbkc. itip31. li4»twlil FIFTH EDITION
FIFTH EDITION IV I ^HHk ^ttm IZTI/^Q i I II MPHBBMWBBIHB '-llwmpbi^hbwm^^pfc ' GSBHSRSBRSRRk LlML I I \l 1MB ^HP'^^MMMP" jflp^^^^^^^^st I Iv^O FROM GENES TO GENOMES %^MiM^PM^^MWi99Mi$9i0^^ ^^^^^^^^^^^^^V^^^fii^^t^i^^^^^
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationT E S L A T O A C Q U I R E S O L A R C I T Y
T E S L A T O A C Q U I R E S O L A R C I T Y C R E A T I N G T H E W O R L D S L E A D I N G S U S T A I N A B L E E N E R G Y C O M P A N Y I N V E S T O R P R E S E N T A T I O N A u g u s t 1, 2 0
More informationSUPPORTING A THRIVING UK LIFE SCIENCES ECOSYSTEM
SUPPORTING A THRIVING UK LIFE SCIENCES ECOSYSTEM ABOUT THE AMERICAN PHARMACEUTICAL GROUP THE AMERICAN PHARMACEUTICAL GROUP REPRESENTS THE TEN LARGEST US RESEARCH- BASED BIO-PHARMACEUTICAL COMPANIES WITH
More informationWhat binds to Hb in addition to O 2?
Reading: Ch5; 158-169, 162-166, 169-174 Problems: Ch5 (text); 3,7,8,10 Ch5 (study guide-facts); 1,2,3,4,5,8 Ch5 (study guide-apply); 2,3 Remember Today at 5:30 in CAS-522 is the second chance for the MB
More informationBioinformatics Exercises
Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted
More informationEnhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures
Nature Methods Enhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures Yannick Doyon, Thuy D Vo, Matthew C Mendel, Shon G Greenberg, Jianbin Wang, Danny F Xia, Jeffrey
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More informationCHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
More informationLecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
More informationIntroduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
More informationPOLICY ISSUE (INFORMATION)
POLICY ISSUE (INFORMATION) August 12, 2011 SECY-11-0112 FOR: FROM: SUBJECT: The Commissioners Michael R. Johnson, Director /RA/ Office of New Reactors STAFF ASSESSMENT OF SELECTED SMALL MODULAR REACTOR
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More informationLinear Regression (1/1/17)
STA613/CBB540: Statistical methods in computational biology Linear Regression (1/1/17) Lecturer: Barbara Engelhardt Scribe: Ethan Hada 1. Linear regression 1.1. Linear regression basics. Linear regression
More informationChapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
More informationChapter 6- An Introduction to Metabolism*
Chapter 6- An Introduction to Metabolism* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. The Energy of Life
More informationDNA, Chromosomes, and Genes
N, hromosomes, and Genes 1 You have most likely already learned about deoxyribonucleic acid (N), chromosomes, and genes. You have learned that all three of these substances have something to do with heredity
More informationGene regulation I Biochemistry 302. Bob Kelm February 25, 2005
Gene regulation I Biochemistry 302 Bob Kelm February 25, 2005 Principles of gene regulation (cellular versus molecular level) Extracellular signals Chemical (e.g. hormones, growth factors) Environmental
More informationName: SAMPLE EOC PROBLEMS
Name: SAMPLE EOC PROBLEMS 1.Bromothymol blue (BTB) is a ph indicator that is also used to detect carbon dioxide (CO2). BTB is blue when ph is basic and CO2 is low. BTB is yellow when ph is acidic and CO2
More informationRegulation of gene Expression in Prokaryotes & Eukaryotes
Regulation of gene Expression in Prokaryotes & Eukaryotes 1 The trp Operon Contains 5 genes coding for proteins (enzymes) required for the synthesis of the amino acid tryptophan. Also contains a promoter
More informationCSEP 590A Summer Tonight MLE. FYI, re HW #2: Hemoglobin History. Lecture 4 MLE, EM, RE, Expression. Maximum Likelihood Estimators
CSEP 59A Summer 26 Lecture 4 MLE, EM, RE, Expression FYI, re HW #2: Hemoglobin History 1 Alberts et al., 3rd ed.,pg389 2 Tonight MLE: Maximum Likelihood Estimators EM: the Expectation Maximization Algorithm
More informationCSEP 590A Summer Lecture 4 MLE, EM, RE, Expression
CSEP 590A Summer 2006 Lecture 4 MLE, EM, RE, Expression 1 FYI, re HW #2: Hemoglobin History Alberts et al., 3rd ed.,pg389 2 Tonight MLE: Maximum Likelihood Estimators EM: the Expectation Maximization Algorithm
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationTransmembrane Domains (TMDs) of ABC transporters
Transmembrane Domains (TMDs) of ABC transporters Most ABC transporters contain heterodimeric TMDs (e.g. HisMQ, MalFG) TMDs show only limited sequence homology (high diversity) High degree of conservation
More informationGene regulation II Biochemistry 302. February 27, 2006
Gene regulation II Biochemistry 302 February 27, 2006 Molecular basis of inhibition of RNAP by Lac repressor 35 promoter site 10 promoter site CRP/DNA complex 60 Lewis, M. et al. (1996) Science 271:1247
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationCorrelations to Next Generation Science Standards. Life Sciences Disciplinary Core Ideas. LS-1 From Molecules to Organisms: Structures and Processes
Correlations to Next Generation Science Standards Life Sciences Disciplinary Core Ideas LS-1 From Molecules to Organisms: Structures and Processes LS1.A Structure and Function Systems of specialized cells
More informationChapter 7: Covalent Structure of Proteins. Voet & Voet: Pages ,
Chapter 7: Covalent Structure of Proteins Voet & Voet: Pages 163-164, 185-194 Slide 1 Structure & Function Function is best understood in terms of structure Four levels of structure that apply to proteins
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationThe Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11
The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding
More informationCell Differentiation and Meiosis
Cell Differentiation and Meiosis Study guide Compare the processes and products of meiosis I and meiosis II. Compare the overall processes and products of meiosis and mitosis. Explain how non disjunction
More informationChapters 12&13 Notes: DNA, RNA & Protein Synthesis
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,
More informationGene Control Mechanisms at Transcription and Translation Levels
Gene Control Mechanisms at Transcription and Translation Levels Dr. M. Vijayalakshmi School of Chemical and Biotechnology SASTRA University Joint Initiative of IITs and IISc Funded by MHRD Page 1 of 9
More informationBuild a STRUCTURAL concept map of has part starting with cell cycle and using all of the following: Metaphase Prophase Interphase Cell division phase
Build a STRUCTURAL concept map of has part starting with cell cycle and using all of the following: Metaphase Prophase Interphase Cell division phase Telophase S phase G1 phase G2 phase Anaphase Cytokinesis
More informationComputational Biology & Computational Medicine
Computational Biology & Computational Medicine Homayoun Valafar Outline Why proteins? What are proteins? How do we compute them? How do we use computational approaches? Why Proteins? Molecular basis of
More informationInterval (meters) To (meters)
200 Burrard Street, Suite 650 Tel: 604.801.5432 Vancouver, BC V6C 3L6 Fax: 604.662.8829 TSX-V: VG NEWS RELEASE Shallow RC drilling at the WAMA property returns intervals of 4m @ 30.57 g/t Au, 3m @ 19.39
More informationAn extrapolation framework to specify requirements for drug development in children
An framework to specify requirements for drug development in children Martin Posch joint work with Gerald Hlavin Franz König Christoph Male Peter Bauer Medical University of Vienna Clinical Trials in Small
More informationProtein Architecture V: Evolution, Function & Classification. Lecture 9: Amino acid use units. Caveat: collagen is a. Margaret A. Daugherty.
Lecture 9: Protein Architecture V: Evolution, Function & Classification Margaret A. Daugherty Fall 2004 Amino acid use *Proteins don t use aa s equally; eg, most proteins not repeating units. Caveat: collagen
More informationControl Strategies for Small Molecule Components of Antibody-Drug Conjugates
Control Strategies for Small Molecule Components of Antibody-Drug Conjugates Nathan C. Ihle, PhD Executive Director, Process Chemistry Seattle Genetics, Inc WCBP 2012 Antibody-Drug Conjugates: Balancing
More informationSupplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1
Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1 F/F ;mir-17~92 F/F (Pkd1-miR-17~92KO) mice. (A) Q-PCR
More information3/8/ Complex adaptations. 2. often a novel trait
Chapter 10 Adaptation: from genes to traits p. 302 10.1 Cascades of Genes (p. 304) 1. Complex adaptations A. Coexpressed traits selected for a common function, 2. often a novel trait A. not inherited from
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationLarge Scale Mapping Policy for the Province of Nova Scotia
Large Scale Mapping Policy for the Province of Nova Scotia December, 2005 Version 1.0 TABLE OF CONTENTS PAGE BACKGROUND...3 POLICY...5 Policy 1.0 Large Scale Mapping Program...5 Policy 2.0 Service Offering...5
More informationChapter 9 DNA recognition by eukaryotic transcription factors
Chapter 9 DNA recognition by eukaryotic transcription factors TRANSCRIPTION 101 Eukaryotic RNA polymerases RNA polymerase RNA polymerase I RNA polymerase II RNA polymerase III RNA polymerase IV Function
More information16 CONTROL OF GENE EXPRESSION
16 CONTROL OF GENE EXPRESSION Chapter Outline 16.1 REGULATION OF GENE EXPRESSION IN PROKARYOTES The operon is the unit of transcription in prokaryotes The lac operon for lactose metabolism is transcribed
More informationTranslation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
More informationGENETICS - CLUTCH CH.11 TRANSLATION.
!! www.clutchprep.com CONCEPT: GENETIC CODE Nucleotides and amino acids are translated in a 1 to 1 method The triplet code states that three nucleotides codes for one amino acid - A codon is a term for
More informationSupplementary Tables and Figures
Supplementary Tables Supplementary Tables and Figures Supplementary Table 1: Tumor types and samples analyzed. Supplementary Table 2: Genes analyzed here. Supplementary Table 3: Statistically significant
More informationRNA Synthesis and Processing
RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-2018 GENETICS BIO-5009A Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
More informationGene Expression. Molecular Genetics, March, 2018
Gene Expression Molecular Genetics, March, 2018 Gene Expression Control of Protein Levels Bacteria Lac Operon Promoter mrna Inducer CAP Control Trp Operon RepressorOperator Control Attenuation Riboswitches
More informationEuroBioBank/TREAT-NMD Annual Meeting «Membership to the EuroBioBank Network»
EuroBioBank/TREAT-NMD Annual Meeting 2008 «Membership to the EuroBioBank Network» CLIQUEZ ICI POUR SOUS TITRE Anne-Mary Bodin EuroBioBank Project Assistant Jeanne-Hélène di Donato Consultant, 3 C-R Paris,
More informationLooking Back to Move Forward - Designing Next Gen RNAi for HBV. HepDart December 5, 2017
Looking Back to Move Forward - Designing Next Gen RNAi for HBV HepDart December 5, 2017 Safe Harbor Statement This presentation contains forward-looking statements within the meaning of the "safe harbor"
More informationProtein synthesis II Biochemistry 302. Bob Kelm February 25, 2004
Protein synthesis II Biochemistry 302 Bob Kelm February 25, 2004 Two idealized views of the 70S ribosomal complex during translation 70S cavity Fig. 27.25 50S tunnel View with 30S subunit in front, 50S
More informationPROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
More informationPerplexing Observations. Today: Thinking About Darwinian Evolution. We owe much of our understanding of EVOLUTION to CHARLES DARWIN.
Today: Thinking About Darwinian Evolution Part 1: Darwin s Theory Perplexing Observations Mystery of the Black Death?? What is evolution?? And what is this finch doing?!? We owe much of our understanding
More informationAdvanced Topics in RNA and DNA. DNA Microarrays Aptamers
Quiz 1 Advanced Topics in RNA and DNA DNA Microarrays Aptamers 2 Quantifying mrna levels to asses protein expression 3 The DNA Microarray Experiment 4 Application of DNA Microarrays 5 Some applications
More informationPeter Pristas. Gene regulation in eukaryotes
Peter Pristas BNK1 Gene regulation in eukaryotes Gene Expression in Eukaryotes Only about 3-5% of all the genes in a human cell are expressed at any given time. The genes expressed can be specific for
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More informationClustering of Pathogenic Genes in Human Co-regulatory Network. Michael Colavita Mentor: Soheil Feizi Fifth Annual MIT PRIMES Conference May 17, 2015
Clustering of Pathogenic Genes in Human Co-regulatory Network Michael Colavita Mentor: Soheil Feizi Fifth Annual MIT PRIMES Conference May 17, 2015 Topics Background Genetic Background Regulatory Networks
More informationLecture 4: Transcription networks basic concepts
Lecture 4: Transcription networks basic concepts - Activators and repressors - Input functions; Logic input functions; Multidimensional input functions - Dynamics and response time 2.1 Introduction The
More informationJunior Uranium explorer in the Athabasca Basin. Patterson Claims
Junior Uranium explorer in the Athabasca Basin Patterson Claims Cautionary Note Regarding Forward-Looking Statements This Presentation and the exhibits attached herein contain forward-looking statements
More informationLecture 5. How DNA governs protein synthesis. Primary goal: How does sequence of A,G,T, and C specify the sequence of amino acids in a protein?
Lecture 5 (FW) February 4, 2009 Translation, trna adaptors, and the code Reading.Chapters 8 and 9 Lecture 5. How DNA governs protein synthesis. Primary goal: How does sequence of A,G,T, and C specify the
More informationTopic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
More informationDOWNLOAD OR READ : UNANSWERED QUESTIONS CELL BIOLOGY PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : UNANSWERED QUESTIONS CELL BIOLOGY PDF EBOOK EPUB MOBI Page 1 Page 2 unanswered questions cell biology unanswered questions cell biology pdf unanswered questions cell biology Mohini Sharma.
More informationUnderstanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007
Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.
More informationTranscription Regulation And Gene Expression in Eukaryotes UPSTREAM TRANSCRIPTION FACTORS
Transcription Regulation And Gene Expression in Eukaryotes UPSTREAM TRANSCRIPTION FACTORS RG. Clerc March 26. 2008 UPSTREAM TRANSCRIPTION FACTORS Experimental approaches DNA binding domains (DBD) Transcription
More informationJordan University of Science & Technology. Faculty of Arts and Sciences. Department of Applied Biological Sciences
Jordan University of Science & Technology Faculty of Arts and Sciences Department of Applied Biological Sciences Course Title Title & Instructor General Biology Course Number BIO 104 Instructor Office
More informationTopic 1 - The building blocks of. cells! Name:!
B2 - Revision Topic 1 - The building blocks of Lesson cells Name: Topic B2.1 Plant and Animal Cells B2.2 Inside Bacteria B2.3 DNA B2.4 Extracting DNA: PCA B2.5 DNA Discovery B2.6 Genetic Engineering B2.7
More informationEukaryotic vs. Prokaryotic genes
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,
More information4 Examples of enzymes
Catalysis 1 4 Examples of enzymes Adding water to a substrate: Serine proteases. Carbonic anhydrase. Restrictions Endonuclease. Transfer of a Phosphoryl group from ATP to a nucleotide. Nucleoside monophosphate
More informationHonors Biology Reading Guide Chapter 11
Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationRANK. Alternative names. Discovery. Structure. William J. Boyle* SUMMARY BACKGROUND
RANK William J. Boyle* Department of Cell Biology, Amgen, Inc., One Amgen Center Drive, Thousand Oaks, CA 91320-1799, USA * corresponding author tel: 805-447-4304, fax: 805-447-1982, e-mail: bboyle@amgen.com
More informationGENETICS - CLUTCH CH.1 INTRODUCTION TO GENETICS.
!! www.clutchprep.com CONCEPT: HISTORY OF GENETICS The earliest use of genetics was through of plants and animals (8000-1000 B.C.) Selective breeding (artificial selection) is the process of breeding organisms
More information3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
More informationIntroduction to Graphene and XG Sciences
Introduction to Graphene and XG Sciences 1 Forward-looking Statements This presentation contains statements which constitute forward-looking statements within the meaning of Section 27A of the Securities
More informationIsotope Production for Nuclear Medicine
Isotope Production for Nuclear Medicine Eva Birnbaum Isotope Program Manager February 26 th, 2016 LA-UR-16-21119 Isotopes for Nuclear Medicine More than 20 million nuclear medicine procedures are performed
More informationMolecular Biology (9)
Molecular Biology (9) Translation Mamoun Ahram, PhD Second semester, 2017-2018 1 Resources This lecture Cooper, Ch. 8 (297-319) 2 General information Protein synthesis involves interactions between three
More informationOCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
More informationOCR Biology Checklist
Topic 1. Cell level systems Video: Eukaryotic and prokaryotic cells Compare the structure of animal and plant cells. Label typical and atypical prokaryotic cells. Compare prokaryotic and eukaryotic cells.
More informationSignal Transduction Phosphorylation Protein kinases. Misfolding diseases. Protein Engineering Lysozyme variants
Signal Transduction Phosphorylation Protein kinases Misfolding diseases Protein Engineering Lysozyme variants Cells and Signals Regulation The cell must be able to respond to stimuli Cellular activities
More informationAlgorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment
Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot
More informationCorporate Presentation March 2018
Corporate Presentation March 2018 This presentation contains forward-looking statements. All statements other than statements of historical fact are forward-looking statements, which are often indicated
More informationWallbridge Completes Successful Initial Drill Program at Beschefer
Wallbridge Completes Successful Initial Drill Program at Beschefer Toronto, Ontario December 17, 2018 Wallbridge Mining Company Limited (TSX:WM, FWB:WC7) ( Wallbridge or the Company ) is pleased to announce
More informationGenetic transcription and regulation
Genetic transcription and regulation Central dogma of biology DNA codes for DNA DNA codes for RNA RNA codes for proteins not surprisingly, many points for regulation of the process DNA codes for DNA replication
More informationUndergraduate Curriculum in Biology
Fall Courses *114: Principles of Biology *116: Introduction to Anatomy and Physiology I 302: Human Learning and the Brain (o, DS) 336: Aquatic Biology (p/e) 339: Aquatic Biology Lab (L) 351: Principles
More informationMBLG lecture 5. The EGG! Visualising Molecules. Dr. Dale Hancock Lab 715
MBLG lecture 5 Dr. Dale Hancock D.Hancock@mmb.usyd.edu.au Lab 715 The EGG! Visualising Molecules In molecular biology and biochemistry it is better to view molecules as killer pythons rather than smarties.
More informationNEWS RELEASE TSX: ELD NYSE: EGO September 6, Eldorado Announces Drilling Results from KMC Project, Serbia
NEWS RELEASE TSX: ELD NYSE: EGO September 6, 2016 Eldorado Announces Drilling Results from KMC Project, Serbia VANCOUVER, BC, September 6, 2016 Eldorado Gold Corporation, ( Eldorado or the Company ) is
More informationGene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationScience Unit Learning Summary
Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In
More information