CSEP 527 Computational Biology. RNA: Function, Secondary Structure Prediction, Search, Discovery
|
|
- Randolph Barton
- 5 years ago
- Views:
Transcription
1 SEP 527 omputational Biology RN: Function, Secondary Structure Prediction, Search, Discovery
2 The Message ells make lots of RN noncoding RN Functionally important, functionally diverse Structurally complex New tools required alignment, discovery, search, scoring, etc. 2
3 Rough Outline Today Noncoding RN Examples RN structure prediction 3
4 RN DN: DeoxyriboNucleic cid RN: RiboNucleic cid Like DN, except: dds an OH on ribose (backbone sugar) racil () in place of thymine (T),, as before pairs with H 3 thymine uracil 4
5 RN Secondary Structure: RN makes helices too Base pairs 5 3 sually single stranded 5
6 Fig. 2. The arrows show the situation as it seemed in Solid arrows represent probable transfers, dotted arrows possible transfers. The absent arrows (compare Fig. 1) represent the impossible transfers postulated by the central dogma. They are the three possible arrows starting from protein. 6
7 Ribosomes Watson, ilman, Witkowski, & Zoller,
8 Ribosomes 1974 Nobel prize to Romanian biologist eorge Palade ( ) for discovery in mid 50 s proteins 3-4 RNs (half the mass) atalytic core is RN Of course, mrns and trns (messenger & transfer RNs) are critical too tomic structure of the 50S Subunit from Haloarcula marismortui. Proteins are shown in blue and the two RN strands in orange and yellow. The small patch of green in the center of the subunit is the active site. - Wikipedia 8
9 Transfer RN The adapter coupling mrn to protein synthesis. Discovered in the mid-1950s by Mahlon Hoagland ( , left), Mary Stephenson, and Paul Zamecnik ( ; Lasker award winner, right). 9
10 Bacteria Triumph of proteins 80% of genome is coding DN Functionally diverse receptors motors catalysts regulators (Monod & Jakob, Nobel prize 1965) 10
11 Proteins atalyze Biochemistry: Met Pathways 11
12 Proteins Regulate Biochemistry: The MET Repressor SM DN Protein lberts, et al, 3e. 12
13 lberts, et al, 3e. Not the only way! Protein way Riboswitch alternative SM rundy & Henkin, Mol. Microbiol 1998 Epshtein, et al., PNS 2003 Winkler et al., Nat. Struct. Biol
14 lberts, et al, 3e. Not the only way! Protein way Riboswitch alternatives SM-II SM-I orbino et al., enome Biol rundy, Epshtein, Winkler et al., 1998,
15 lberts, et al, 3e. Not the only way! Protein way Riboswitch alternatives SM-III SM-I SM-II Fuchs et al., NSMB 2006 rundy, Epshtein, Winkler et al., 1998, 2003 orbino et al., enome Biol
16 lberts, et al, 3e. Not the only way! Protein way Riboswitch alternatives SM-III SM-I SM-II SM-IV rundy, Epshtein, Winkler et al., 1998, 2003 orbino et al., enome Biol Fuchs et al., NSMB 2006 Weinberg et al., RN
17 lberts, et al, 3e. Not the only way! Protein way Riboswitch alternatives SM-III SM-I SM-II SM-IV rundy, Epshtein, Winkler et al., 1998, 2003 orbino et al., enome Biol Fuchs et al., NSMB 2006 Weinberg et al., RN 2008 Meyer, etal., BM enomics
18 nd in other bacteria, a riboswitch senses SH (SH) 18
19 ncrn Example: Riboswitches TR structure that directly senses/binds small molecules & regulates mrn widespread in prokaryotes some in eukaryotes & archaea, one in a phage ~ 20 ligands known; multiple nonhomologous solutions for some dozens to hundreds of instances of each on/off; transcription/translation; splicing; combinatorial control all found since ~2003; most via bioinformatics 19
20 20
21 New ntibiotic Targets? Old drugs, new understanding: TPP riboswitch ~ pyrithiamine lysine riboswitch ~ L-aminoethylcysteine, DL-4-oxalysine FMN riboswitch ~ roseoflavin Potential advantages - no (known) human riboswitches, but often multiple copies in bacteria, so potentially efficacious with few side effects? 21
22 ncrn Example: T-boxes 22
23 23
24 sed by Mfinder Found by scan hloroflexus aurantiacus eobacter metallireducens eobacter sulphurreducens hloroflexi δ -Proteobacteria Symbiobacterium thermophilum 24
25 ncrn Example: 6S medium size (175nt) structured highly expressed in E. coli in certain growth conditions sequenced in 1971; function unknown for 30 years 25
26 6S mimics an open promoter Bacillus/ lostridium ctinobacteria E.coli Barrick et al. RN 2005 Trotochaud et al. NSMB 2005 Willkomm et al. NR
27 Summary: RN in Bacteria Widespread, deeply conserved, structurally sophisticated, functionally diverse, biologically important uses for ncrn throughout prokaryotic world. Regulation of MNY genes involves RN In some species, we know identities of more riboregulators than protein regulators Dozens of classes & thousands of new examples in just the last 5-10 years 27
28 Vertebrate ncrns mrn, trn, rrn, of course PLS: snrn, spliceosome, snorn, teleomerase, microrn, RNi, SEIS, IRE, piwi-rn, XIST (X-inactivation), ribozymes, 28
29 MicroRN 1st discovered 1992 in. elegans 2nd discovered 2000, also. elegans and human, fly, everything between basically all multi-celled plants & animals nucleotides literally fell off ends of gels Hundreds now known in human may regulate 1/3-1/2 of all genes development, stem cells, cancer, infectious disease, 29
30 sirn 2006 Nobel Prize Fire & Mello Short Interfering RN lso discovered in. elegans Possibly an antiviral defense, shares machinery with mirn pathways llows artificial repression of most genes in most higher organisms Huge tool for biology & biotech 30
31 ncrn Example: Xist large ( 12kb) largely unstructured RN required for X-inactivation in mammals (Remember calico cats?) 31
32 Human Predictions Evofold S Pedersen, Bejerano, Siepel, K Rosenbloom, K Lindblad-Toh, ES Lander, J Kent, W Miller, D Haussler, "Identification and classification of conserved RN secondary structures in the human genome." PLoS omput. Biol., 2, #4 (2006) e33. 48,479 candidates (~70% FDR?) RNz S Washietl, IL Hofacker, M Lukasser, Hutenhofer, PF Stadler, "Mapping of conserved RN secondary structures predicts thousands of functional noncoding RNs in the human genome." Nat. Biotechnol., 23, #11 (2005) ,000 structured RN elements 1,000 conserved across all vertebrates. ~1/3 in introns of known genes, ~1/6 in TRs ~1/2 located far from any known gene FOLDLIN E Torarinsson, M Sawera, JH Havgaard, M Fredholm, J orodkin, "Thousands of corresponding human and mouse genomic regions unalignable in primary sequence contain common RN structure." enome Res., 16, #7 (2006) candidates from (of 100,000) pairs Mfinder Torarinsson, Yao, Wiklund, Bramsen, Hansen, Kjems, Tommerup, Ruzzo and orodkin. omparative genomics beyond sequence based alignments: RN structures in the ENODE regions. enome Research, Feb 2008, 18(2): PMID: candidates in ENODE alone (better FDR, but still high) 32
33 Bottom line? significant number of one-off examples Extremely wide-spread ncrn expression t a minimum, a vast evolutionary substrate New technology (e.g., RNseq) exposing more How do you recognize an interesting one? lue: onserved secondary structure 33
34 RN Secondary Structure: can be fixed while sequence evolves - 34
35 Why is RN hard to deal with? : Structure often more important than sequence 35
36 Structure Prediction
37 RN Structure Primary Structure: Sequence Secondary Structure: Pairing Tertiary Structure: 3D shape 37
38 RN Pairing Watson-rick Pairing - - ~ 3 kcal/mole ~ 2 kcal/mole ~1 kcal/mole Wobble Pair - Non-canonical Pairs (esp. if modified) 38
39 trn 3d Structure 39
40 trn - lt. Representations a.a. 3 5 nticodon loop nticodon loop 40
41 trn - lt. Representations nticodon loop nticodon loop 41
42 Definitions Sequence 5 r 1 r 2 r 3... r n 3 in {,,, T/} Secondary Structure is a set of pairs i j s.t. i < j-4, and no sharp turns if i j & i j are two different pairs with i i, then j < i, or i < i < j < j 2nd pair follows 1st, or is nested within it; no pseudoknots. 42
43 RN Secondary Structure: Examples base pair 4 ok sharp turn crossing 43
44 Nested Precedes Pseudoknot 44
45 pproaches to Structure Prediction Maximum Pairing + works on single sequences + simple - too inaccurate Minimum Energy + works on single sequences - ignores pseudoknots - only finds optimal fold Partition Function + finds all folds - ignores pseudoknots 45
46 Nussinov: Max Pairing B(i,j) = # pairs in optimal pairing of r i... r j B(i,j) = 0 for all i, j with i j-4; otherwise B(i,j) = max of: B(i,j-1) max { B(i,k-1)+1+B(k+1,j-1) i k < j-4 and r k -r j may pair} R Nussinov, B Jacobson, "Fast algorithm for predicting the secondary structure of single-stranded RN." PNS
47 Optimal pairing of r i... r j Two possibilities j npaired: Find best pairing of r i... r j-1 j i j-1 j Paired (with some k): Find best r i... r k-1 + best r k+1... r j-1 plus 1 Why is it slow? Why do pseudoknots matter? j i j-1 k-1 k k+1 47
48 Nussinov: omputation Order B(i,j) = # pairs in optimal pairing of r i... r j B(i,j) = 0 for all i, j with i j-4; otherwise B(i,j) = max of: B(i,j-1) max { B(i,k-1)+1+B(k+1,j-1) i k < j-4 and r k -r j may pair} K= Time: O(n 3 ) 48
49 Which Pairs? sual dynamic programming trace-back tells you which base pairs are in the optimal solution, not just how many 49
50 omputing one cell: OPT[2,18] =? n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) ase 1: ? no. ase 2: B 18 unpaired? lways a possibility; then OPT[2,18] 3 $ * 0 if i j 4 OPT(i, 0 0 j) 0 = 0 % 0 0 $ OPT[i, j -1] ' max 0 0 % & 1+ 0 max 0 0 t (OPT[i,t ] OPT[t , 0 0 j 1] 0 ( otherwise &* ) ((...))(...)...
51 omputing one cell: OPT[2,18] =? n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) $ 0 if i j * OPT(i, j) = % 0 0 $ OPT[i, j -1] ' max 0 0 % 1+ 0 max ( otherwise &* & t (OPT[i,t 1] + OPT[t +1, j 1] ) ase 3, 2 t <18-4: t = 2: no pair
52 omputing one cell: OPT[2,18] =? n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) $ 0 if i j * OPT(i, j) = % 0 0 $ OPT[i, j -1] ' max 0 0 % 1+ 0 max ( otherwise &* & t (OPT[i,t 1] + OPT[t +1, j 1] ) ase 3, 2 t <18-4: t = 3: no pair
53 omputing one cell: OPT[2,18] =? n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) $ 0 if i j * OPT(i, j) = % 0 0 $ OPT[i, j -1] ' max 0 0 % 1+ 0 max ( otherwise &* & t (OPT[i,t 1] + OPT[t +1, j 1] ) ase 3, 2 t <18-4: t = 4: yes pair OPT[2,18] (...(((...))))
54 omputing one cell: OPT[2,18] =? n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) ase 3, 2 t <18-4: t = 5: yes pair OPT[2,18] (..(((...)))) $ 0 if i j * OPT(i, j) = % 0 0 $ OPT(i, OPT[i, j -1) -1] ' max% ( otherwise &* & 1+ max t (OPT(i,t (OPT[i,t 1) 1] + OPT[t OPT(t +1, j 1] 1) )
55 omputing one cell: OPT[2,18] =? n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) ase 3, 2 t <18-4: t = 6: yes pair OPT[2,18] (.(((...)))) $ 0 if i j * OPT(i, j) = % 0 0 $ OPT(i, OPT[i, j -1) -1] ' max% ( otherwise &* & 1+ max t (OPT(i,t (OPT[i,t 1) 1] + OPT[t OPT(t +1, j 1] 1) )
56 omputing one cell: OPT[2,18] =? n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) ase 3, 2 t <18-4: t = 7: yes pair OPT[2,18] ((((...)))) $ 0 if i j * OPT(i, j) = % 0 0 $ OPT(i, OPT[i, j -1) -1] ' max% ( otherwise &* & 1+ max t (OPT(i,t (OPT[i,t 1) 1] + OPT[t OPT(t +1, j 1] 1) )
57 omputing one cell: OPT[2,18] =? n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) $ 0 if i j * OPT(i, j) = % 0 0 $ OPT[i, j -1] ' max 0 0 % 1+ 0 max ( otherwise &* & t (OPT[i,t 1] + OPT[t +1, j 1] ) ase 3, 2 t <18-4: t = 8: no pair
58 omputing one cell: OPT[2,18] =? n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) $ 0 if i j * OPT(i, j) = % 0 0 $ OPT[i, j -1] ' max 0 0 % 1+ 0 max ( otherwise &* & t (OPT[i,t 1] + OPT[t +1, j 1] ) ase 3, 2 t <18-4: t = 11: yes pair OPT[2,18] ((...))(...) (not shown: t=9,10, 12,13)
59 n= 20 ( ( (.... ) ) ) ( ( (.... ) ) ) omputing one cell: OPT[2,18] = 4 Overall, Max = 4 several ways, e.g.:..(...(((...)))) tree shows trace back: square = case 3 octagon = case 1 $ 0 if i j * OPT(i, j) = % 0 0 $ OPT[i, j -1] ' max 0 0 % 1+ 0 max ( otherwise &* & t (OPT[i,t 1] + OPT[t +1, j 1] )
60 pproaches to Structure Prediction Maximum Pairing + works on single sequences + simple - too inaccurate Minimum Energy + works on single sequences - ignores pseudoknots - only finds optimal fold Partition Function + finds all folds - ignores pseudoknots
61 Pair-based Energy Minimization E(i,j) = energy of pairs in optimal pairing of r i... r j E(i,j) = for all i, j with i j-4; otherwise E(i,j) = min of: E(i,j-1) energy of k-j pair min { E(i,k-1) + e(r k, r j ) + E(k+1,j-1) i k < j-4 } Time: O(n 3 )
62 Loop-based Energy Minimization Detailed experiments show it s more accurate to model based on loops, rather than just pairs Loop types Hairpin loop 2. Stack 3. Bulge 4 4. Interior loop 5. Multiloop 5
63 Zuker: Loop-based Energy, I W(i,j) = energy of optimal pairing of r i... r j V(i,j) = as above, but forcing pair i j W(i,j) = V(i,j) = for all i, j with i j-4 W(i,j) = min( W(i,j-1), min { W(i,k-1)+V(k,j) i k < j-4 } )
64 Zuker: Loop-based Energy, II hairpin stack bulge/ interior multiloop V(i,j) = min(eh(i,j), es(i,j)+v(i+1,j-1), VBI(i,j), VM(i,j)) VM(i,j) = min { W(i,k)+W(k+1,j) i < k < j } VBI(i,j) = min { ebi(i,j,i,j ) + V(i, j ) bulge/ interior i < i < j < j & i -i+j-j > 2 } Time: O(n 4 ) O(n 3 ) possible if ebi(.) is nice
65 Energy Parameters Q. Where do they come from? 1. Experiments with carefully selected synthetic RNs 2. Learned algorithmically from trusted alignments/structures [ndronescu et al., 2007]
66 Single Seq Prediction ccuracy Mfold, Vienna,... [Nussinov, Zuker, Hofacker, Mcaskill] Latest estimates suggest ~50-75% of base pairs predicted correctly in sequences of up to ~300nt Definitely useful, but obviously imperfect 50
67 pproaches to Structure Prediction Maximum Pairing + works on single sequences + simple - too inaccurate Minimum Energy + works on single sequences - ignores pseudoknots - only finds optimal fold Partition Function + finds all folds - ignores pseudoknots
68 pproaches, II omparative sequence analysis + handles all pairings (potentially incl. pseudoknots) - requires several (many?) aligned, appropriately diverged sequences Stochastic ontext-free rammars Roughly combines min energy & comparative, but no pseudoknots Physical experiments (x-ray crystallography, NMR) Next Lecture
69 Summary RN has important roles beyond mrn Many unexpected recent discoveries Structure is critical to function True of proteins, too, but they re easier to find from sequence alone due, e.g., to codon structure, which RNs lack RN secondary structure can be predicted (to useful accuracy) by dynamic programming Next: RN motifs (seq + 2-ary struct) wellcaptured by covariance models 51
The Double Helix. CSE 417: Algorithms and Computational Complexity! The Central Dogma of Molecular Biology! DNA! RNA! Protein! Protein!
The Double Helix SE 417: lgorithms and omputational omplexity! Winter 29! W. L. Ruzzo! Dynamic Programming, II" RN Folding! http://www.rcsb.org/pdb/explore.do?structureid=1t! Los lamos Science The entral
More informationRNA Secondary Structure. CSE 417 W.L. Ruzzo
RN Secondary Structure SE 417 W.L. Ruzzo The Double Helix Los lamos Science The entral Dogma of Molecular Biology DN RN Protein gene Protein DN (chromosome) cell RN (messenger) Non-coding RN Messenger
More informationGenome 559 Wi RNA Function, Search, Discovery
Genome 559 Wi 2009 RN Function, Search, Discovery The Message Cells make lots of RN noncoding RN Functionally important, functionally diverse Structurally complex New tools required alignment, discovery,
More informationModeling and Searching for Non-Coding RNA
Modeling and Searching for Non-oding RN W.L. Ruzzo http://www.cs.washington.edu/homes/ruzzo http://www.cs.washington.edu/homes/ruzzo/ courses/gs541/09sp ENOME 541 protein and DN sequence analysis to determine
More informationSearching for Noncoding RNA
Searching for Noncoding RN Larry Ruzzo omputer Science & Engineering enome Sciences niversity of Washington http://www.cs.washington.edu/homes/ruzzo Bio 2006, Seattle, 8/4/2006 1 Outline Noncoding RN Why
More informationRNA Secondary Structure Prediction
RN Secondary Structure Prediction Perry Hooker S 531: dvanced lgorithms Prof. Mike Rosulek University of Montana December 10, 2010 Introduction Ribonucleic acid (RN) is a macromolecule that is essential
More informationproteins are the basic building blocks and active players in the cell, and
12 RN Secondary Structure Sources for this lecture: R. Durbin, S. Eddy,. Krogh und. Mitchison, Biological sequence analysis, ambridge, 1998 J. Setubal & J. Meidanis, Introduction to computational molecular
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri RNA Structure Prediction Secondary
More informationRNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17
RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17 Dr. Stefan Simm, 01.11.2016 simm@bio.uni-frankfurt.de RNA secondary structures a. hairpin loop b. stem c. bulge loop d. interior loop e. multi
More informationA Method for Aligning RNA Secondary Structures
Method for ligning RN Secondary Structures Jason T. L. Wang New Jersey Institute of Technology J Liu, JTL Wang, J Hu and B Tian, BM Bioinformatics, 2005 1 Outline Introduction Structural alignment of RN
More information98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006
98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006 8.3.1 Simple energy minimization Maximizing the number of base pairs as described above does not lead to good structure predictions.
More informationConserved RNA Structures. Ivo L. Hofacker. Institut for Theoretical Chemistry, University Vienna.
onserved RN Structures Ivo L. Hofacker Institut for Theoretical hemistry, University Vienna http://www.tbi.univie.ac.at/~ivo/ Bled, January 2002 Energy Directed Folding Predict structures from sequence
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationRNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology"
RNA Search and! Motif Discovery" Genome 541! Intro to Computational! Molecular Biology" Day 1" Many biologically interesting roles for RNA" RNA secondary structure prediction" 3 4 Approaches to Structure
More informationRNA secondary structure prediction. Farhat Habib
RNA secondary structure prediction Farhat Habib RNA RNA is similar to DNA chemically. It is usually only a single strand. T(hyamine) is replaced by U(racil) Some forms of RNA can form secondary structures
More informationA graph kernel approach to the identification and characterisation of structured non-coding RNAs using multiple sequence alignment information
graph kernel approach to the identification and characterisation of structured noncoding RNs using multiple sequence alignment information Mariam lshaikh lbert Ludwigs niversity Freiburg, Department of
More informationIntroduction to molecular biology. Mitesh Shrestha
Introduction to molecular biology Mitesh Shrestha Molecular biology: definition Molecular biology is the study of molecular underpinnings of the process of replication, transcription and translation of
More informationIn Genomes, Two Types of Genes
In Genomes, Two Types of Genes Protein-coding: [Start codon] [codon 1] [codon 2] [ ] [Stop codon] + DNA codons translated to amino acids to form a protein Non-coding RNAs (NcRNAs) No consistent patterns
More informationModeling and Searching for Non-Coding RNA
Modeling and Searching for Non-oding RN W.L. Ruzzo http://www.cs.washington.edu/homes/ruzzo The entral Dogma DN RN Protein gene Protein DN (chromosome) cell RN (messenger) lassical RNs mrn trn rrn snrn
More information2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
More informationUNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
More informationROC TPR FPR
HW5 2 3 TPR 0.0 0.2 0.4 0.6 0.8 1.0 291 411 537 669 807 957 1098 1269 1506 1971 8703 171 51 RO TPR = True Positive Rate = Sensitivity = Recall = TP/(TP+FN) FPR = False Positive Rate = 1 Specificity = FP/(FP+TN)
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More informationImpact Of The Energy Model On The Complexity Of RNA Folding With Pseudoknots
Impact Of The Energy Model On The omplexity Of RN Folding With Pseudoknots Saad Sheikh, Rolf Backofen Yann Ponty, niversity of Florida, ainesville, S lbert Ludwigs niversity, Freiburg, ermany LIX, NRS/Ecole
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2007
Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution
More informationCombinatorial approaches to RNA folding Part I: Basics
Combinatorial approaches to RNA folding Part I: Basics Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2015 M. Macauley (Clemson)
More informationPredicting RNA Secondary Structure
7.91 / 7.36 / BE.490 Lecture #6 Mar. 11, 2004 Predicting RNA Secondary Structure Chris Burge Review of Markov Models & DNA Evolution CpG Island HMM The Viterbi Algorithm Real World HMMs Markov Models for
More informationReading Assignments. A. Genes and the Synthesis of Polypeptides. Lecture Series 7 From DNA to Protein: Genotype to Phenotype
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationGENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications
1 GENE ACTIVITY Gene structure Transcription Transcript processing mrna transport mrna stability Translation Posttranslational modifications 2 DNA Promoter Gene A Gene B Termination Signal Transcription
More informationMETHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
More informationL3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus
L3.1: Circuits: Introduction to Transcription Networks Cellular Design Principles Prof. Jenna Rickus In this lecture Cognitive problem of the Cell Introduce transcription networks Key processing network
More informationHonors Biology Reading Guide Chapter 11
Honors Biology Reading Guide Chapter 11 v Promoter a specific nucleotide sequence in DNA located near the start of a gene that is the binding site for RNA polymerase and the place where transcription begins
More informationCopyright (c) 2007 IEEE. Personal use of this material is permitted. However, permission to use this material for any other purposes must be obtained
Copyright (c) 2007 IEEE. Personal use of this material is permitted. However, permission to use this material for any other purposes must be obtained from the IEEE by sending an email to pubs-permissions@ieee.org.
More informationComputational RNA Secondary Structure Design:
omputational RN Secondary Structure Design: Empirical omplexity and Improved Methods by Rosalía guirre-hernández B.Sc., niversidad Nacional utónoma de México, 996 M. Eng., niversidad Nacional utónoma de
More informationComputational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
More informationModeling and Searching for Non-Coding RNA
Modeling and Searching for Non-oding RN W.L. Ruzzo http://www.cs.washington.edu/homes/ruzzo Outline Why RN? Examples of RN biology omputational hallenges Modeling Search Inference The entral Dogma DN RN
More informationRNA Structure Inference & Database Search
RN Structure & Database School of Electrical Engineering and omputer Science niversity of Ottawa Version of October 20, 2015 www.eecs.uottawa.ca/ turcotte/teaching/bnf-5106/ RN Structure & Database 1
More informationGrand Plan. RNA very basic structure 3D structure Secondary structure / predictions The RNA world
Grand Plan RNA very basic structure 3D structure Secondary structure / predictions The RNA world very quick Andrew Torda, April 2017 Andrew Torda 10/04/2017 [ 1 ] Roles of molecules RNA DNA proteins genetic
More information5. From the genetic code to enzyme action
Introductory biophysics A. Y. 2017-18 5. From the genetic code to enzyme action Edoardo Milotti Dipartimento di Fisica, Università di Trieste The structure of DNA Images from https://pdb101.rcsb.org/motm/23
More informationRNA Abstract Shape Analysis
ourse: iegerich RN bstract nalysis omplete shape iegerich enter of Biotechnology Bielefeld niversity robert@techfak.ni-bielefeld.de ourse on omputational RN Biology, Tübingen, March 2006 iegerich ourse:
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationFrom gene to protein. Premedical biology
From gene to protein Premedical biology Central dogma of Biology, Molecular Biology, Genetics transcription replication reverse transcription translation DNA RNA Protein RNA chemically similar to DNA,
More informationRNA Protein Interaction
Introduction RN binding in detail structural analysis Examples RN Protein Interaction xel Wintsche February 16, 2009 xel Wintsche RN Protein Interaction Introduction RN binding in detail structural analysis
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationEarly History up to Schedule. Proteins DNA & RNA Schwann and Schleiden Cell Theory Charles Darwin publishes Origin of Species
Schedule Bioinformatics and Computational Biology: History and Biological Background (JH) 0.0 he Parsimony criterion GKN.0 Stochastic Models of Sequence Evolution GKN 7.0 he Likelihood criterion GKN 0.0
More informationRecitaLon CB Lecture #10 RNA Secondary Structure
RecitaLon 3-19 CB Lecture #10 RNA Secondary Structure 1 Announcements 2 Exam 1 grades and answer key will be posted Friday a=ernoon We will try to make exams available for pickup Friday a=ernoon (probably
More information-CH 2. -S-CH 3 How do I know this?
What is the major functional difference of Theta vs. Rolling-ircle replication, specifically in regards to the tandem linear repeats found in the R- replication. You won t be responsible for this. Rolling-circle
More informationTowards a Comprehensive Annotation of Structured RNAs in Drosophila
Towards a Comprehensive Annotation of Structured RNAs in Drosophila Rebecca Kirsch 31st TBI Winterseminar, Bled 20/02/2016 Studying Non-Coding RNAs in Drosophila Why Drosophila? especially for novel molecules
More informationDe novo prediction of structural noncoding RNAs
1/ 38 De novo prediction of structural noncoding RNAs Stefan Washietl 18.417 - Fall 2011 2/ 38 Outline Motivation: Biological importance of (noncoding) RNAs Algorithms to predict structural noncoding RNAs
More informationQuantitative modeling of RNA single-molecule experiments. Ralf Bundschuh Department of Physics, Ohio State University
Quantitative modeling of RN single-molecule experiments Ralf Bundschuh Department of Physics, Ohio State niversity ollaborators: lrich erland, LM München Terence Hwa, San Diego Outline: Single-molecule
More informationLesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression
13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium
More informationThe Riboswitch is functionally separated into the ligand binding APTAMER and the decision-making EXPRESSION PLATFORM
The Riboswitch is functionally separated into the ligand binding APTAMER and the decision-making EXPRESSION PLATFORM Purine riboswitch TPP riboswitch SAM riboswitch glms ribozyme In-line probing is used
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationRNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U. Bases can only pair with one other base. wobble pairing. 23 Hydrogen Bonds more stable
RNA STRUCTURE RNA Basics RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U wobble pairing Bases can only pair with one other base. 23 Hydrogen Bonds more stable RNA Basics transfer RNA (trna) messenger
More informationLab III: Computational Biology and RNA Structure Prediction. Biochemistry 208 David Mathews Department of Biochemistry & Biophysics
Lab III: Computational Biology and RNA Structure Prediction Biochemistry 208 David Mathews Department of Biochemistry & Biophysics Contact Info: David_Mathews@urmc.rochester.edu Phone: x51734 Office: 3-8816
More informationRNA Catalysis, Structure and Folding Chair: E. Westhof RNA Meeting 2008 Berlin. Density courtesy David Shechner
RNA Catalysis, Structure and Folding Chair: E. Westhof RNA Meeting 2008 Berlin Density courtesy David Shechner Catalysis implies very precise chemistry: Bringing several atoms at the correct distances
More informationBi 8 Lecture 11. Quantitative aspects of transcription factor binding and gene regulatory circuit design. Ellen Rothenberg 9 February 2016
Bi 8 Lecture 11 Quantitative aspects of transcription factor binding and gene regulatory circuit design Ellen Rothenberg 9 February 2016 Major take-home messages from λ phage system that apply to many
More informationDUPLICATED RNA GENES IN TELEOST FISH GENOMES
DPLITED RN ENES IN TELEOST FISH ENOMES Dominic Rose, Julian Jöris, Jörg Hackermüller, Kristin Reiche, Qiang LI, Peter F. Stadler Bioinformatics roup, Department of omputer Science, and Interdisciplinary
More informationUsing SetPSO to determine RNA secondary structure
Using SetPSO to determine RNA secondary structure by Charles Marais Neethling Submitted in partial fulfilment of the requirements for the degree of Master of Science (Computer Science) in the Faculty of
More informationRelated Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
More informationWarm Up. What are some examples of living things? Describe the characteristics of living things
Warm Up What are some examples of living things? Describe the characteristics of living things Objectives Identify the levels of biological organization and explain their relationships Describe cell structure
More informationATP. P i. trna. 3 Appropriate trna covalently bonds to amino acid, displacing AMP. Computer model Hydrogen bonds
mino acid attachment site nticodon Hydrogen bonds mino acid T i denosine i i denosine minoacyl-trn synthetase (enzyme) trn 1 ctive site binds the amino acid and T. 2 T loses two groups and bonds to the
More informationChapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes
Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2
More informationDNA/RNA Structure Prediction
C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Master Course DNA/Protein Structurefunction Analysis and Prediction Lecture 12 DNA/RNA Structure Prediction Epigenectics Epigenomics:
More informationUE Praktikum Bioinformatik
UE Praktikum Bioinformatik WS 08/09 University of Vienna 7SK snrna 7SK was discovered as an abundant small nuclear RNA in the mid 70s but a possible function has only recently been suggested. Two independent
More informationGCD3033:Cell Biology. Transcription
Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors
More informationEVALUATION OF RNA SECONDARY STRUCTURE MOTIFS USING REGRESSION ANALYSIS
EVLTION OF RN SEONDRY STRTRE MOTIFS SIN RERESSION NLYSIS Mohammad nwar School of Information Technology and Engineering, niversity of Ottawa e-mail: manwar@site.uottawa.ca bstract Recent experimental evidences
More informationGenomics and bioinformatics summary. Finding genes -- computer searches
Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence
More informationChapter 17. From Gene to Protein. Biology Kevin Dees
Chapter 17 From Gene to Protein DNA The information molecule Sequences of bases is a code DNA organized in to chromosomes Chromosomes are organized into genes What do the genes actually say??? Reflecting
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationSugars, such as glucose or fructose are the basic building blocks of more complex carbohydrates. Which of the following
Name: Score: / Quiz 2 on Lectures 3 &4 Part 1 Sugars, such as glucose or fructose are the basic building blocks of more complex carbohydrates. Which of the following foods is not a significant source of
More informationA Novel Statistical Model for the Secondary Structure of RNA
ISBN 978-1-8466-93-3 Proceedings of the 5th International ongress on Mathematical Biology (IMB11) Vol. 3 Nanjing, P. R. hina, June 3-5, 11 Novel Statistical Model for the Secondary Structure of RN Liu
More informationThe Gene The gene; Genes Genes Allele;
Gene, genetic code and regulation of the gene expression, Regulating the Metabolism, The Lac- Operon system,catabolic repression, The Trp Operon system: regulating the biosynthesis of the tryptophan. Mitesh
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationMATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME
MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:
More informationFlow of Genetic Information
presents Flow of Genetic Information A Montagud E Navarro P Fernández de Córdoba JF Urchueguía Elements Nucleic acid DNA RNA building block structure & organization genome building block types Amino acid
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More informationCopyright Mark Brandt, Ph.D A third method, cryogenic electron microscopy has seen increasing use over the past few years.
Structure Determination and Sequence Analysis The vast majority of the experimentally determined three-dimensional protein structures have been solved by one of two methods: X-ray diffraction and Nuclear
More informationInitiation of translation in eukaryotic cells:connecting the head and tail
Initiation of translation in eukaryotic cells:connecting the head and tail GCCRCCAUGG 1: Multiple initiation factors with distinct biochemical roles (linking, tethering, recruiting, and scanning) 2: 5
More informationCHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
More informationThe wonderful world of RNA informatics
December 9, 2012 Course Goals Familiarize you with the challenges involved in RNA informatics. Introduce commonly used tools, and provide an intuition for how they work. Give you the background and confidence
More informationASSESSING TRANSLATIONAL EFFICIACY THROUGH POLY(A)- TAIL PROFILING AND IN VIVO RNA SECONDARY STRUCTURE DETERMINATION
ASSESSING TRANSLATIONAL EFFICIACY THROUGH POLY(A)- TAIL PROFILING AND IN VIVO RNA SECONDARY STRUCTURE DETERMINATION Journal Club, April 15th 2014 Karl Frontzek, Institute of Neuropathology POLY(A)-TAIL
More informationBig Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Tuesday, December 27, 16
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Enduring understanding 3.B: Expression of genetic information involves cellular and molecular
More informationWhat Organelle Makes Proteins According To The Instructions Given By Dna
What Organelle Makes Proteins According To The Instructions Given By Dna This is because it contains the information needed to make proteins. assemble enzymes and other proteins according to the directions
More informationRNA Search and! Motif Discovery"
RN Search and! Motif Discovery" Lecture 9! SEP 590! utumn 2008" Outline" Whirlwind tour of ncrn search & discovery" RN motif description (ovariance Model Review)" lgorithms for searching" Rigorous & heuristic
More informationCOMP 598 Advanced Computational Biology Methods & Research. Introduction. Jérôme Waldispühl School of Computer Science McGill University
COMP 598 Advanced Computational Biology Methods & Research Introduction Jérôme Waldispühl School of Computer Science McGill University General informations (1) Office hours: by appointment Office: TR3018
More informationNcRNA Homology Search Using Hamming Distance Seeds
NcRN Homology Search Using Hamming Distance Seeds Osama ljawad Dept. of omputer Science and Engineering Michigan State University East Lansing, MI 48824 aljawado@msu.edu Yanni Sun Dept. of omputer Science
More informationLecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
More informationBiology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
More informationWelcome to Class 21!
Welcome to Class 21! Introductory Biochemistry! Lecture 21: Outline and Objectives l Regulation of Gene Expression in Prokaryotes! l transcriptional regulation! l principles! l lac operon! l trp attenuation!
More informationRNA Folding and Interaction Prediction: A Survey
RNA Folding and Interaction Prediction: A Survey Syed Ali Ahmed Graduate Center, City University of New York New York, NY November 19, 2015 Abstract The problem of computationally predicting the structure
More informationBerg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1:
Berg Tymoczko Stryer Biochemistry Sixth Edition Chapter 1: Biochemistry: An Evolving Science Tips on note taking... Remember copies of my lectures are available on my webpage If you forget to print them
More informationBio Microbiology - Spring 2013 Study Guide 14.
Bio 230 - Microbiology - Spring 2013 Study Guide 14 http://www.swarthmore.edu/natsci/cpurrin1/evolk12/slm/origindayimages/06soup.jpg Working Backwards to the Age of the Earth Radioactive decay is consistent
More informationBiophysics Lectures Three and Four
Biophysics Lectures Three and Four Kevin Cahill cahill@unm.edu http://dna.phys.unm.edu/ 1 The Atoms and Molecules of Life Cells are mostly made from the most abundant chemical elements, H, C, O, N, Ca,
More informationEukaryotic vs. Prokaryotic genes
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationBoolean models of gene regulatory networks. Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016
Boolean models of gene regulatory networks Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016 Gene expression Gene expression is a process that takes gene info and creates
More informationDANNY BARASH ABSTRACT
JOURNAL OF COMPUTATIONAL BIOLOGY Volume 11, Number 6, 2004 Mary Ann Liebert, Inc. Pp. 1169 1174 Spectral Decomposition for the Search and Analysis of RNA Secondary Structure DANNY BARASH ABSTRACT Scales
More informationWhat can sequences tell us?
Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more
More information