Expanded View Figures

Extensive identification and analysis of conserved small ORFs in animals

Mackowiak et al. Genome Biology (2015) 16:179 DOI 10.1186/s13059-015-0742-x RESEARCH Open Access Extensive identification and analysis of conserved small ORFs in animals Sebastian D. Mackowiak 1, Henrik

Genome 559 Wi RNA Function, Search, Discovery

Genome 559 Wi 2009 RN Function, Search, Discovery The Message Cells make lots of RN noncoding RN Functionally important, functionally diverse Structurally complex New tools required alignment, discovery,

AS A SERVICE TO THE RESEARCH COMMUNITY, GENOME BIOLOGY PROVIDES A 'PREPRINT' DEPOSITORY

http://genomebiology.com/2002/3/12/preprint/0011.1 This information has not been peer-reviewed. Responsibility for the findings rests solely with the author(s). Deposited research article MRD: a microsatellite

Sequence comparison: Score matrices

Sequence comparison: Score matrices http://facultywashingtonedu/jht/gs559_2013/ Genome 559: Introduction to Statistical and omputational Genomics Prof James H Thomas FYI - informal inductive proof of best

Introduction to Hidden Markov Models for Gene Prediction ECE-S690

Introduction to Hidden Markov Models for Gene Prediction ECE-S690 Outline Markov Models The Hidden Part How can we use this for gene prediction? Learning Models Want to recognize patterns (e.g. sequence

Sequence comparison: Score matrices. Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas

Sequence comparison: Score matrices Genome 559: Introduction to Statistical and omputational Genomics Prof James H Thomas FYI - informal inductive proof of best alignment path onsider the last step in

Supplemental Information

Molecular Cell, Volume 52 Supplemental Information The Translational Landscape of the Mammalian Cell Cycle Craig R. Stumpf, Melissa V. Moreno, Adam B. Olshen, Barry S. Taylor, and Davide Ruggero Supplemental

The genomes of recombinant inbred lines

The genomes of recombinant inbred lines Karl W Broman Department of Biostatistics Johns Hopkins University http://www.biostat.jhsph.edu/~kbroman C57BL/6 2 1 Recombinant inbred lines (by sibling mating)

Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and

Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and counterclockwise for the inner row, with green representing coding

Bias in RNA sequencing and what to do about it

Bias in RNA sequencing and what to do about it Walter L. (Larry) Ruzzo Computer Science and Engineering Genome Sciences University of Washington Fred Hutchinson Cancer Research Center Seattle, WA, USA

Intro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye!

Today Gene regulation Synteny Good bye! Gene regulation What governs gene transcription? Genes active under different circumstances. Gene regulation What governs gene transcription? Genes active under

Sequence comparison: Score matrices. Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas

Sequence comparison: Score matrices Genome 559: Introduction to Statistical and omputational Genomics Prof James H Thomas Informal inductive proof of best alignment path onsider the last step in the best

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed

Supplementary Information

Supplementary Information Supplementary Figure 1. Schematic pipeline for single-cell genome assembly, cleaning and annotation. a. The assembly process was optimized to account for multiple cells putatively

RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17

RNA-Strukturvorhersage Strukturelle Bioinformatik WS16/17 Dr. Stefan Simm, 01.11.2016 simm@bio.uni-frankfurt.de RNA secondary structures a. hairpin loop b. stem c. bulge loop d. interior loop e. multi

Density Curves and the Normal Distributions. Histogram: 10 groups

Density Curves and the Normal Distributions MATH 2300 Chapter 6 Histogram: 10 groups 1 Histogram: 20 groups Histogram: 40 groups 2 Histogram: 80 groups Histogram: 160 groups 3 Density Curve Density Curves

A Method for Aligning RNA Secondary Structures

Method for ligning RN Secondary Structures Jason T. L. Wang New Jersey Institute of Technology J Liu, JTL Wang, J Hu and B Tian, BM Bioinformatics, 2005 1 Outline Introduction Structural alignment of RN

ASSESSING TRANSLATIONAL EFFICIACY THROUGH POLY(A)- TAIL PROFILING AND IN VIVO RNA SECONDARY STRUCTURE DETERMINATION

ASSESSING TRANSLATIONAL EFFICIACY THROUGH POLY(A)- TAIL PROFILING AND IN VIVO RNA SECONDARY STRUCTURE DETERMINATION Journal Club, April 15th 2014 Karl Frontzek, Institute of Neuropathology POLY(A)-TAIL

Figure S1: Similar to Fig. 2D in paper, but using Euclidean distance instead of Spearman distance.

Supplementary analysis 1: Euclidean distance in the RESS As shown in Fig. S1, Euclidean distance did not adequately distinguish between pairs of random sequence and pairs of structurally-related sequence.

Sequence analysis and comparison

The aim with sequence identification: Sequence analysis and comparison Marjolein Thunnissen Lund September 2012 Is there any known protein sequence that is homologous to mine? Are there any other species

Genomics and bioinformatics summary. Finding genes -- computer searches

Genomics and bioinformatics summary 1. Gene finding: computer searches, cdnas, ESTs, 2. Microarrays 3. Use BLAST to find homologous sequences 4. Multiple sequence alignments (MSAs) 5. Trees quantify sequence

Single nucleotide variants in transcription factors associate more tightly with phenotype than with gene expression

Washington University School of Medicine Digital Commons@Becker Open Access Publications 2014 Single nucleotide variants in transcription factors associate more tightly with phenotype than with gene expression

Haploid & diploid recombination and their evolutionary impact

Haploid & diploid recombination and their evolutionary impact W. Garrett Mitchener College of Charleston Mathematics Department MitchenerG@cofc.edu http://mitchenerg.people.cofc.edu Introduction The basis

Supplemental Data. Hou et al. (2016). Plant Cell /tpc

Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence

SUPPLEMENTARY INFORMATION

SUPPLMTARY IFORMATIO a doi:10.108/nature10402 b 100 nm 100 nm c SAXS Model d ulers assigned to reference- Back-projected free class averages class averages Refinement against single particles Reconstructed

Web-based Supplementary Materials for BM-Map: Bayesian Mapping of Multireads for Next-Generation Sequencing Data

Web-based Supplementary Materials for BM-Map: Bayesian Mapping of Multireads for Next-Generation Sequencing Data Yuan Ji 1,, Yanxun Xu 2, Qiong Zhang 3, Kam-Wah Tsui 3, Yuan Yuan 4, Clift Norris 1, Shoudan

Supplementary Tables and Figures

Supplementary Tables Supplementary Tables and Figures Supplementary Table 1: Tumor types and samples analyzed. Supplementary Table 2: Genes analyzed here. Supplementary Table 3: Statistically significant

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11

The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding

Identification of 3 0 gene ends using transcriptional and genomic conservation across vertebrates

Morgan et al. BMC Genomics 2012, 13:708 METHODOLOGY ARTICLE Open Access Identification of 3 0 gene ends using transcriptional and genomic conservation across vertebrates Marcos Morgan 1,2*, Alessandra

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods

Sequence alignment methods. Pairwise alignment. The universe of biological sequence analysis

he universe of biological sequence analysis Word/pattern recognition- Identification of restriction enzyme cleavage sites Sequence alignment methods PstI he universe of biological sequence analysis - prediction

Divergence of regulatory networks governed by the orthologous transcription factors FLC and PEP1 in Brassicaceae species

Divergence of regulatory networks governed by the orthologous transcription factors FLC and PEP1 in Brassicaceae species Julieta L. Mateos a,1,2, Vicky Tilmes a,1, Pedro Madrigal b,3, Edouard Severing

Conserved RNA Structures. Ivo L. Hofacker. Institut for Theoretical Chemistry, University Vienna.

onserved RN Structures Ivo L. Hofacker Institut for Theoretical hemistry, University Vienna http://www.tbi.univie.ac.at/~ivo/ Bled, January 2002 Energy Directed Folding Predict structures from sequence

(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.

1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the

Technologie w skali genomowej 2/ Algorytmiczne i statystyczne aspekty sekwencjonowania DNA

Technologie w skali genomowej 2/ Algorytmiczne i statystyczne aspekty sekwencjonowania DNA Expression analysis for RNA-seq data Ewa Szczurek Instytut Informatyki Uniwersytet Warszawski 1/35 The problem

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN

Understanding relationship between homologous sequences

Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective

Comparing whole genomes

BioNumerics Tutorial: Comparing whole genomes 1 Aim The Chromosome Comparison window in BioNumerics has been designed for large-scale comparison of sequences of unlimited length. In this tutorial you will

Getting statistical significance and Bayesian confidence limits for your hidden Markov model or score-maximizing dynamic programming algorithm,

Getting statistical significance and Bayesian confidence limits for your hidden Markov model or score-maximizing dynamic programming algorithm, with pairwise alignment of sequences as an example 1,2 1

Gene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji

Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC

*Equal contribution Contact: (TT) 1 Department of Biomedical Engineering, the Engineering Faculty, Tel Aviv

Supplementary of Complementary Post Transcriptional Regulatory Information is Detected by PUNCH-P and Ribosome Profiling Hadas Zur*,1, Ranen Aviner*,2, Tamir Tuller 1,3 1 Department of Biomedical Engineering,

More Codon Usage Bias

.. CSC448 Bioinformatics Algorithms Alexander Dehtyar.. DA Sequence Evaluation Part II More Codon Usage Bias Scaled χ 2 χ 2 measure. In statistics, the χ 2 statstic computes how different the distribution

An empirical strategy to detect bacterial transcript structure from directional RNA-seq transcriptome data

Wang et al. BMC Genomics (215) 16:359 DOI 1.1186/s12864-15-1555-8 RESEARCH ARTICLE Open Access An empirical strategy to detect bacterial transcript structure from directional RNA-seq transcriptome data

Supporting Information

Supporting Information Weghorn and Lässig 10.1073/pnas.1210887110 SI Text Null Distributions of Nucleosome Affinity and of Regulatory Site Content. Our inference of selection is based on a comparison of

STATISTICS 4, S4 (4769) A2

(4769) A2 Objectives To provide students with the opportunity to explore ideas in more advanced statistics to a greater depth. Assessment Examination (72 marks) 1 hour 30 minutes There are four options

Theoretical distribution of PSSM scores

Regulatory Sequence Analysis Theoretical distribution of PSSM scores Jacques van Helden Jacques.van-Helden@univ-amu.fr Aix-Marseille Université, France Technological Advances for Genomics and Clinics (TAGC,

Bustamante et al., Supplementary Nature Manuscript # 1 out of 9 Information #

Bustamante et al., Supplementary Nature Manuscript # 1 out of 9 Details of PRF Methodology In the Poisson Random Field PRF) model, it is assumed that non-synonymous mutations at a given gene are either

3. SEQUENCE ANALYSIS BIOINFORMATICS COURSE MTAT

3. SEQUENCE ANALYSIS BIOINFORMATICS COURSE MTAT.03.239 25.09.2012 SEQUENCE ANALYSIS IS IMPORTANT FOR... Prediction of function Gene finding the process of identifying the regions of genomic DNA that encode

Tandem repeat 16,225 20,284. 0kb 5kb 10kb 15kb 20kb 25kb 30kb 35kb

Overview Fosmid XAAA112 consists of 34,783 nucleotides. Blat results indicate that this fosmid has significant identity to the 2R chromosome of D.melanogaster. Evidence suggests that fosmid XAAA112 contains

Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss

Supplementary Information for Hurst et al.: Causes of trends of amino acid gain and loss Methods Identification of orthologues, alignment and evolutionary distances A preliminary set of orthologues was

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY

Formalizing the gene centered view of evolution

Chapter 1 Formalizing the gene centered view of evolution Yaneer Bar-Yam and Hiroki Sayama New England Complex Systems Institute 24 Mt. Auburn St., Cambridge, MA 02138, USA yaneer@necsi.org / sayama@necsi.org

Предсказание и анализ промотерных последовательностей. Татьяна Татаринова

Предсказание и анализ промотерных последовательностей Татьяна Татаринова Eukaryotic Transcription 2 Initiation Promoter: the DNA sequence that initially binds the RNA polymerase The structure of promoter-polymerase

Quantifying sequence similarity

Quantifying sequence similarity Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, February 16 th 2016 After this lecture, you can define homology, similarity, and identity

Supplementary Figure 1. Nature Genetics: doi: /ng.3848

Supplementary Figure 1 Phenotypes and epigenetic properties of Fab2L flies. A- Phenotypic classification based on eye pigment levels in Fab2L male (orange bars) and female (yellow bars) flies (n>150).

Jungreis et al. Supplementary Materials

Supplemental Text S1: What we mean by functional To understand what we mean when we refer to functional readthrough candidates, it is helpful to review the nature of the signal detected by PhyloSF. PhyloSF

Tree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny

A phylogenetic view on RNA structure evolution

3 2 9 4 7 3 24 23 22 8 phylogenetic view on RN structure evolution 9 26 6 52 7 5 6 37 57 45 5 84 63 86 77 65 3 74 7 79 8 33 9 97 96 89 47 87 62 32 34 42 73 43 44 4 76 58 75 78 93 39 54 82 99 28 95 52 46

Introduction to Bioinformatics

CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics

Ø Set of mutually exclusive categories. Ø Classify or categorize subject. Ø No meaningful order to categorization.

Statistical Tools in Evaluation HPS 41 Dr. Joe G. Schmalfeldt Types of Scores Continuous Scores scores with a potentially infinite number of values. Discrete Scores scores limited to a specific number

(c) Find the product moment correlation coefficient between s and t.

1. A clothes shop manager records the weekly sales figures, s, and the average weekly temperature, t C, for 6 weeks during the summer. The sales figures were coded so that s w = 1000 The data are summarised

Genômica comparativa. João Carlos Setubal IQ-USP outubro /5/2012 J. C. Setubal

Genômica comparativa João Carlos Setubal IQ-USP outubro 2012 11/5/2012 J. C. Setubal 1 Comparative genomics There are currently (out/2012) 2,230 completed sequenced microbial genomes publicly available

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison

10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:

arxiv:physics/ v1 [physics.bio-ph] 8 Feb 2000 Formalizing the gene centered view of evolution

arxiv:physics/0002016v1 [physics.bio-ph] 8 Feb 2000 Formalizing the gene centered view of evolution Y. Bar-Yam New England Complex Systems Institute 24 Mt. Auburn St., Cambridge MA Department of Molecular

Comparative analysis of RNA- Seq data with DESeq2

Comparative analysis of RNA- Seq data with DESeq2 Simon Anders EMBL Heidelberg Two applications of RNA- Seq Discovery Eind new transcripts Eind transcript boundaries Eind splice junctions Comparison Given

GEP Annotation Report

GEP Annotation Report Note: For each gene described in this annotation report, you should also prepare the corresponding GFF, transcript and peptide sequence files as part of your submission. Student name:

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and

21 ST CENTURY LEARNING CURRICULUM FRAMEWORK PERFORMANCE RUBRICS FOR MATHEMATICS PRE-CALCULUS

21 ST CENTURY LEARNING CURRICULUM FRAMEWORK PERFORMANCE RUBRICS FOR MATHEMATICS PRE-CALCULUS Table of Contents Functions... 2 Polynomials and Rational Functions... 3 Exponential Functions... 4 Logarithmic

Lecture 18 June 2 nd, Gene Expression Regulation Mutations

Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase

Quantitative Bioinformatics

Chapter 9 Class Notes Signals in DNA 9.1. The Biological Problem: since proteins cannot read, how do they recognize nucleotides such as A, C, G, T? Although only approximate, proteins actually recognize

Ensembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are:

Comparative genomics and proteomics Species available Ensembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are: Vertebrates: human, chimpanzee, mouse, rat,

Annotation of Drosophila grimashawi Contig12

Annotation of Drosophila grimashawi Contig12 Marshall Strother April 27, 2009 Contents 1 Overview 3 2 Genes 3 2.1 Genscan Feature 12.4............................................. 3 2.1.1 Genome Browser:

Searching for Noncoding RNA

Searching for Noncoding RN Larry Ruzzo omputer Science & Engineering enome Sciences niversity of Washington http://www.cs.washington.edu/homes/ruzzo Bio 2006, Seattle, 8/4/2006 1 Outline Noncoding RN Why

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.

Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.

Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on

Z score indicates how far a raw score deviates from the sample mean in SD units. score Mean % Lower Bound

1 EDUR 8131 Chat 3 Notes 2 Normal Distribution and Standard Scores Questions Standard Scores: Z score Z = (X M) / SD Z = deviation score divided by standard deviation Z score indicates how far a raw score

SURVEY AND SUMMARY Multiple roles of the coding sequence 5 end in gene expression regulation

Published online 12 December 2014 Nucleic Acids Research, 2015, Vol. 43, No. 1 13 28 doi: 10.1093/nar/gku1313 SURVEY AND SUMMARY Multiple roles of the coding sequence 5 end in gene expression regulation

Tools and Algorithms in Bioinformatics

Tools and Algorithms in Bioinformatics GCBA815, Fall 2015 Week-4 BLAST Algorithm Continued Multiple Sequence Alignment Babu Guda, Ph.D. Department of Genetics, Cell Biology & Anatomy Bioinformatics and

Using Base Pairing Probabilities for MiRNA Recognition. Yet Another SVM for MiRNA Recognition: yasmir

0. Using Base Pairing Probabilities for MiRNA Recognition Yet Another SVM for MiRNA Recognition: yasmir Daniel Pasailă, Irina Mohorianu, Liviu Ciortuz Department of Computer Science Al. I. Cuza University,

Solutions exercises of Chapter 7

Solutions exercises of Chapter 7 Exercise 1 a. These are paired samples: each pair of half plates will have about the same level of corrosion, so the result of polishing by the two brands of polish are

Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:

m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail

Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters

Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters Ionas Erb 1, Erik van Nimwegen 2 * 1 Bioinformatics and Genomics program, Center for Genomic

Supporting Information

Supporting Information Das et al. 10.1073/pnas.1302500110 < SP >< LRRNT > < LRR1 > < LRRV1 > < LRRV2 Pm-VLRC M G F V V A L L V L G A W C G S C S A Q - R Q R A C V E A G K S D V C I C S S A T D S S P E

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the

The Union and Intersection for Different Configurations of Two Events Mutually Exclusive vs Independency of Events

Section 1: Introductory Probability Basic Probability Facts Probabilities of Simple Events Overview of Set Language Venn Diagrams Probabilities of Compound Events Choices of Events The Addition Rule Combinations

6 Introduction to Population Genetics

70 Grundlagen der Bioinformatik, SoSe 11, D. Huson, May 19, 2011 6 Introduction to Population Genetics This chapter is based on: J. Hein, M.H. Schierup and C. Wuif, Gene genealogies, variation and evolution,

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

UE Praktikum Bioinformatik

UE Praktikum Bioinformatik WS 08/09 University of Vienna 7SK snrna 7SK was discovered as an abundant small nuclear RNA in the mid 70s but a possible function has only recently been suggested. Two independent

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall

Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example

GENETICS - CLUTCH CH.22 EVOLUTIONARY GENETICS.

!! www.clutchprep.com CONCEPT: OVERVIEW OF EVOLUTION Evolution is a process through which variation in individuals makes it more likely for them to survive and reproduce There are principles to the theory

Practical Bioinformatics

5/2/2017 Dictionaries d i c t i o n a r y = { A : T, T : A, G : C, C : G } d i c t i o n a r y [ G ] d i c t i o n a r y [ N ] = N d i c t i o n a r y. h a s k e y ( C ) Dictionaries g e n e t i c C o

Algorithms in Bioinformatics FOUR Pairwise Sequence Alignment. Pairwise Sequence Alignment. Convention: DNA Sequences 5. Sequence Alignment

Algorithms in Bioinformatics FOUR Sami Khuri Department of Computer Science San José State University Pairwise Sequence Alignment Homology Similarity Global string alignment Local string alignment Dot

How to detect paleoploidy?

Genome duplications (polyploidy) / ancient genome duplications (paleopolyploidy) How to detect paleoploidy? e.g. a diploid cell undergoes failed meiosis, producing diploid gametes, which selffertilize

Dr. Amira A. AL-Hosary

Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

Genetic Engineering and Creative Design

Genetic Engineering and Creative Design Background genes, genotype, phenotype, fitness Connecting genes to performance in fitness Emergent gene clusters evolved genes MIT Class 4.208 Spring 2002 Evolution

RNA Abstract Shape Analysis

ourse: iegerich RN bstract nalysis omplete shape iegerich enter of Biotechnology Bielefeld niversity robert@techfak.ni-bielefeld.de ourse on omputational RN Biology, Tübingen, March 2006 iegerich ourse:

Sara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject)

Bioinformática Sequence Alignment Pairwise Sequence Alignment Universidade da Beira Interior (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) 1 16/3/29 & 23/3/29 27/4/29 Outline

6 Introduction to Population Genetics

Grundlagen der Bioinformatik, SoSe 14, D. Huson, May 18, 2014 67 6 Introduction to Population Genetics This chapter is based on: J. Hein, M.H. Schierup and C. Wuif, Gene genealogies, variation and evolution,

Tools and Algorithms in Bioinformatics

Tools and Algorithms in Bioinformatics GCBA815, Fall 2013 Week3: Blast Algorithm, theory and practice Babu Guda, Ph.D. Department of Genetics, Cell Biology & Anatomy Bioinformatics and Systems Biology