Intro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye!

Size: px
Start display at page:

Download "Intro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye!"

Transcription

1 Today Gene regulation Synteny Good bye!

2 Gene regulation What governs gene transcription? Genes active under different circumstances.

3 Gene regulation What governs gene transcription? Genes active under different circumstances. Transcription factors bind to transcription factor binding sites (TFBS).

4 Gene regulation What governs gene transcription? Genes active under different circumstances. Transcription factors bind to transcription factor binding sites (TFBS). TFBS also known as regulatory elements (RE)

5 Gene regulation What governs gene transcription? Genes active under different circumstances. Transcription factors bind to transcription factor binding sites (TFBS). TFBS also known as regulatory elements (RE) TFBS can be grouped in regulatory modules.

6 Gene regulation What governs gene transcription? Genes active under different circumstances. Transcription factors bind to transcription factor binding sites (TFBS). TFBS also known as regulatory elements (RE) TFBS can be grouped in regulatory modules. cis-regulatory elements appear before the gene

7 Gene regulation Core promoter: about 35 bp prior to TSS, includes TATA box

8 Gene regulation Core promoter: about 35 bp prior to TSS, includes TATA box Upstream promoter: bp prior to TSS, activates transcription

9 Gene regulation Core promoter: about 35 bp prior to TSS, includes TATA box Upstream promoter: bp prior to TSS, activates transcription Enhancers in a book: Up to 2000 bp before TSS.

10 Gene regulation Core promoter: about 35 bp prior to TSS, includes TATA box Upstream promoter: bp prior to TSS, activates transcription Enhancers in a book: Up to 2000 bp before TSS. These experiments showed that, on average, the sequence -300 to -50 bp of the TSS positively contributes to core promoter activity. Interestingly, putative negative elements were identified to -500 bp upstream of the TSS for 55 % of genes tested. (Cooper et al, Genome Res, 2005)

11

12 Promoter and TSS Hard to recognize a TSS Many attempts, little success Recent understanding: several TSS may exist

13 Correctness of TSS prediction Fickett & Hatzigeorgiou, 1997

14 Regulatory elements Binding sites for transcription factors Motifs, about 10 bp wide Represent using PSSMs Search strategy: use PSSM and look upstream (2 kb 5 kb) from gene.

15

16 Finding regulatory elements: ConSite Problem: Overpredicting TFBS Solution: Comparative genomics. Use nearby species, look at conservation.

17 Finding regulatory elements Need: de novo motif discovery Solution: Phylogenetic footprinting

18 Finding regulatory elements Need: de novo motif discovery Solution: Phylogenetic footprinting The mathematics: Gibbs sampling Popular software: MEME What it does: Iteratively improve a motif from naive start point

19 Case study: motifs for TPX2 genes Input: five sequences, 3000 nt long Motif 1, E = , width 39 bp Pt At Mt Zm Os TGCATGAGAGGGAGATTTAATCAGAAAGTTTGGTGCATGAGAGC TGCATGAGTGGGAGGTTTAATCAGAAAGTTTGTTGCATGAGAGC TGATTGAGAAGGAAATTTAATCAGAAAGTTTGGTGCAAGAGAGC -----GATCGGGATATATACTCAGAAGTTTGAGTCCCACCGCCC -----GACGGCAACGTCTCATCAGATGGTTGGTAGTAACACCAC Motif 2, E = , width 28 bp Pt At Mt Zm Os TTGAGCATGTTTGTGATGTAGCAACAGA TAAAGCTTGTTGCTGATGTAGCAACAGA TAGAGCATGTTTGTGATGTAGCAACAGA TAGAGCTAGCTAGCTAGGTGGTCGCAAA TGGGGATGGCTGGTGAAGTGGCAGATTA

20 Case study: upstream analysis ATG ATG ATG ATG ATG

21 Comparative Genomics: Synteny Synteny: Preserved gene order

22 Comparative Genomics: Synteny Synteny: Preserved gene order Syntenic regions: Orthologous regions with genes in synteny

23 Comparative Genomics: Synteny Synteny: Preserved gene order Syntenic regions: Orthologous regions with genes in synteny Applications: Species phylogeny Understandning evolution Gene finding, regulatory elements Support for orthology

24 Synteny background Macro-genomic mutations: Transpositions Segment moved Reversals/inversions Segment reversed Transversals End segment reversed

25 Populus chromosomes Science, 2006

26 Mouse chromosomes Nature, 2002

27 Synteny explained by reversals PNAS, 2003

28 Synteny explained by reversals PNAS, 2003

29 Computational problems How recognize orthologous regions? How recognize a syntenic region?

30 Computational problems How recognize orthologous regions? How recognize a syntenic region?

31 Computational problems How many mutations separate two regions? Which phylogeny explains synteny best?

32 Computational problems How many mutations separate two regions? Which phylogeny explains synteny best? Human Nematode Sea urchin 5 1 Fruit fly mtgenome, reversals

33 Synteny in day-to-day work Are these two really orthologous?

34 Synteny in day-to-day work Are these two really orthologous? Where is my gene? I cannot find it!

35 Synteny in day-to-day work Are these two really orthologous? Where is my gene? I cannot find it! Solutions 1. Look at neighbor genes 2. Look at synteny map

36 Case study: Testatin

37 Case study: Testatin

38 Case study: Testatin

39 Case study: functional pseudogenes? Target:

40 Case study: functional pseudogenes? Must avoid:

41 Filtering with synteny Require two predicted pseudogenes to be from the same syntenic region.

42

43 For the exam No pre-registration Part 1: 15 p, bonus points apply Minimum 10 points. Part 2: 15 p, no bonus points Pass exam at 15 points.

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example

More information

12-5 Gene Regulation

12-5 Gene Regulation 12-5 Gene Regulation Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 1 of 26 12-5 Gene Regulation Gene Regulation: An Example Gene

More information

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison

10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison 10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:

More information

Deciphering regulatory networks by promoter sequence analysis

Deciphering regulatory networks by promoter sequence analysis Bioinformatics Workshop 2009 Interpreting Gene Lists from -omics Studies Deciphering regulatory networks by promoter sequence analysis Elodie Portales-Casamar University of British Columbia www.cisreg.ca

More information

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11

The Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11 The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding

More information

Transcription Regulation and Gene Expression in Eukaryotes FS08 Pharmacenter/Biocenter Auditorium 1 Wednesdays 16h15-18h00.

Transcription Regulation and Gene Expression in Eukaryotes FS08 Pharmacenter/Biocenter Auditorium 1 Wednesdays 16h15-18h00. Transcription Regulation and Gene Expression in Eukaryotes FS08 Pharmacenter/Biocenter Auditorium 1 Wednesdays 16h15-18h00. Promoters and Enhancers Systematic discovery of transcriptional regulatory motifs

More information

Chapter 20. Initiation of transcription. Eukaryotic transcription initiation

Chapter 20. Initiation of transcription. Eukaryotic transcription initiation Chapter 20. Initiation of transcription Eukaryotic transcription initiation 2003. 5.22 Prokaryotic vs eukaryotic Bacteria = one RNA polymerase Eukaryotes have three RNA polymerases (I, II, and III) in

More information

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites

Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Evolutionary analysis of the well characterized endo16 promoter reveals substantial variation within functional sites Paper by: James P. Balhoff and Gregory A. Wray Presentation by: Stephanie Lucas Reviewed

More information

Alignment. Peak Detection

Alignment. Peak Detection ChIP seq ChIP Seq Hongkai Ji et al. Nature Biotechnology 26: 1293-1300. 2008 ChIP Seq Analysis Alignment Peak Detection Annotation Visualization Sequence Analysis Motif Analysis Alignment ELAND Bowtie

More information

Genome Rearrangements In Man and Mouse. Abhinav Tiwari Department of Bioengineering

Genome Rearrangements In Man and Mouse. Abhinav Tiwari Department of Bioengineering Genome Rearrangements In Man and Mouse Abhinav Tiwari Department of Bioengineering Genome Rearrangement Scrambling of the order of the genome during evolution Operations on chromosomes Reversal Translocation

More information

Comparative genomics of gene families in relation with metabolic pathways for gene candidates highlighting

Comparative genomics of gene families in relation with metabolic pathways for gene candidates highlighting Comparative genomics of gene families in relation with metabolic pathways for gene candidates highlighting Delphine Larivière & David Couvin Under the supervision of Dominique This, Jean-François Dufayard

More information

Chapter 7: Regulatory Networks

Chapter 7: Regulatory Networks Chapter 7: Regulatory Networks 7.2 Analyzing Regulation Prof. Yechiam Yemini (YY) Computer Science Department Columbia University The Challenge How do we discover regulatory mechanisms? Complexity: hundreds

More information

BMC Evolutionary Biology

BMC Evolutionary Biology BMC Evolutionary Biology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Divergence in cis-regulatory

More information

Whole-genome analysis of GCN4 binding in S.cerevisiae

Whole-genome analysis of GCN4 binding in S.cerevisiae Whole-genome analysis of GCN4 binding in S.cerevisiae Lillian Dai Alex Mallet Gcn4/DNA diagram (CREB symmetric site and AP-1 asymmetric site: Song Tan, 1999) removed for copyright reasons. What is GCN4?

More information

Towards Reverse Engineering of Genetic Regulatory Networks

Towards Reverse Engineering of Genetic Regulatory Networks Towards Reverse Engineering of Genetic Regulatory Networks Zelmina Lubovac, Björn Olsson [zelmina,bjorne]@ida.his.se Department of Computer Science, University of Skövde, Box 408, SE-541 28 Skövde, Sweden

More information

Gene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji

Gene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC

More information

Graph Alignment and Biological Networks

Graph Alignment and Biological Networks Graph Alignment and Biological Networks Johannes Berg http://www.uni-koeln.de/ berg Institute for Theoretical Physics University of Cologne Germany p.1/12 Networks in molecular biology New large-scale

More information

De novo identification of motifs in one species. Modified from Serafim Batzoglou s lecture notes

De novo identification of motifs in one species. Modified from Serafim Batzoglou s lecture notes De novo identification of motifs in one species Modified from Serafim Batzoglou s lecture notes Finding Regulatory Motifs... Given a collection of genes that may be regulated by the same transcription

More information

INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA

INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA INTERACTIVE CLUSTERING FOR EXPLORATION OF GENOMIC DATA XIUFENG WAN xw6@cs.msstate.edu Department of Computer Science Box 9637 JOHN A. BOYLE jab@ra.msstate.edu Department of Biochemistry and Molecular Biology

More information

An Optimal System for Evolutionary Cell Biology: the genus Paramecium

An Optimal System for Evolutionary Cell Biology: the genus Paramecium An Optimal System for Evolutionary Cell Biology: the genus Paramecium Presence of a transcriptionally silent germline (micronucleus) and an expression-active somatic macronucleus. Geographically ubiquitous,

More information

Genome-wide analysis of the MYB transcription factor superfamily in soybean

Genome-wide analysis of the MYB transcription factor superfamily in soybean Du et al. BMC Plant Biology 2012, 12:106 RESEARCH ARTICLE Open Access Genome-wide analysis of the MYB transcription factor superfamily in soybean Hai Du 1,2,3, Si-Si Yang 1,2, Zhe Liang 4, Bo-Run Feng

More information

Identification and annotation of promoter regions in microbial genome sequences on the basis of DNA stability

Identification and annotation of promoter regions in microbial genome sequences on the basis of DNA stability Annotation of promoter regions in microbial genomes 851 Identification and annotation of promoter regions in microbial genome sequences on the basis of DNA stability VETRISELVI RANGANNAN and MANJU BANSAL*

More information

Chapter 8. Regulatory Motif Discovery: from Decoding to Meta-Analysis. 1 Introduction. Qing Zhou Mayetri Gupta

Chapter 8. Regulatory Motif Discovery: from Decoding to Meta-Analysis. 1 Introduction. Qing Zhou Mayetri Gupta Chapter 8 Regulatory Motif Discovery: from Decoding to Meta-Analysis Qing Zhou Mayetri Gupta Abstract Gene transcription is regulated by interactions between transcription factors and their target binding

More information

How much non-coding DNA do eukaryotes require?

How much non-coding DNA do eukaryotes require? How much non-coding DNA do eukaryotes require? Andrei Zinovyev UMR U900 Computational Systems Biology of Cancer Institute Curie/INSERM/Ecole de Mine Paritech Dr. Sebastian Ahnert Dr. Thomas Fink Bioinformatics

More information

Computation-Based Discovery of Cis-Regulatory. Modules by Hidden Markov Model

Computation-Based Discovery of Cis-Regulatory. Modules by Hidden Markov Model Computation-Based Discovery of Cis-Regulatory Modules by Hidden Markov Model Jing Wu and Jun Xie Department of Statistics Purdue University 150 N. University Street West Lafayette, IN 47907 Tel: 765-494-6032

More information

Evolution by duplication

Evolution by duplication 6.095/6.895 - Computational Biology: Genomes, Networks, Evolution Lecture 18 Nov 10, 2005 Evolution by duplication Somewhere, something went wrong Challenges in Computational Biology 4 Genome Assembly

More information

17 Non-collinear alignment Motivation A B C A B C A B C A B C D A C. This exposition is based on:

17 Non-collinear alignment Motivation A B C A B C A B C A B C D A C. This exposition is based on: 17 Non-collinear alignment This exposition is based on: 1. Darling, A.E., Mau, B., Perna, N.T. (2010) progressivemauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS One 5(6):e11147.

More information

REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E

REVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,

More information

Lesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression

Lesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression 13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium

More information

Comparative Bioinformatics Midterm II Fall 2004

Comparative Bioinformatics Midterm II Fall 2004 Comparative Bioinformatics Midterm II Fall 2004 Objective Answer, part I: For each of the following, select the single best answer or completion of the phrase. (3 points each) 1. Deinococcus radiodurans

More information

GENOME-WIDE ANALYSIS OF CORE PROMOTER REGIONS IN EMILIANIA HUXLEYI

GENOME-WIDE ANALYSIS OF CORE PROMOTER REGIONS IN EMILIANIA HUXLEYI 1 GENOME-WIDE ANALYSIS OF CORE PROMOTER REGIONS IN EMILIANIA HUXLEYI Justin Dailey and Xiaoyu Zhang Department of Computer Science, California State University San Marcos San Marcos, CA 92096 Email: daile005@csusm.edu,

More information

Предсказание и анализ промотерных последовательностей. Татьяна Татаринова

Предсказание и анализ промотерных последовательностей. Татьяна Татаринова Предсказание и анализ промотерных последовательностей Татьяна Татаринова Eukaryotic Transcription 2 Initiation Promoter: the DNA sequence that initially binds the RNA polymerase The structure of promoter-polymerase

More information

Introduction to Bioinformatics

Introduction to Bioinformatics CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics

More information

Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona

Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona (tgabaldon@crg.es) http://gabaldonlab.crg.es Homology the same organ in different animals under

More information

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide

AP Bio Module 16: Bacterial Genetics and Operons, Student Learning Guide Name: Period: Date: AP Bio Module 6: Bacterial Genetics and Operons, Student Learning Guide Getting started. Work in pairs (share a computer). Make sure that you log in for the first quiz so that you get

More information

Inferring Protein-Signaling Networks

Inferring Protein-Signaling Networks Inferring Protein-Signaling Networks Lectures 14 Nov 14, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20 Johnson Hall (JHN) 022 1

More information

What DNA sequence tells us about gene regulation

What DNA sequence tells us about gene regulation What DNA sequence tells us about gene regulation The PhyloGibbs-MP approach Rahul Siddharthan The Institute of Mathematical Sciences, Chennai 600 113 http://www.imsc.res.in/ rsidd/ 03/11/2007 Rahul Siddharthan

More information

Genomes and Their Evolution

Genomes and Their Evolution Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007

Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007 Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2007

Bio 1B Lecture Outline (please print and bring along) Fall, 2007 Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution

More information

Comparative genomics: Overview & Tools + MUMmer algorithm

Comparative genomics: Overview & Tools + MUMmer algorithm Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first

More information

Phylogenetic Gibbs Recursive Sampler. Locating Transcription Factor Binding Sites

Phylogenetic Gibbs Recursive Sampler. Locating Transcription Factor Binding Sites A for Locating Transcription Factor Binding Sites Sean P. Conlan 1 Lee Ann McCue 2 1,3 Thomas M. Smith 3 William Thompson 4 Charles E. Lawrence 4 1 Wadsworth Center, New York State Department of Health

More information

Genome 541! Unit 4, lecture 3! Genomics assays

Genome 541! Unit 4, lecture 3! Genomics assays Genome 541! Unit 4, lecture 3! Genomics assays Much easier to follow with slides. Good pace.! Having the slides was really helpful clearer to read and easier to follow the trajectory of the lecture.!!

More information

Ensembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are:

Ensembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are: Comparative genomics and proteomics Species available Ensembl focuses on metazoan (animal) genomes. The genomes currently available at the Ensembl site are: Vertebrates: human, chimpanzee, mouse, rat,

More information

Motifs and Logos. Six Introduction to Bioinformatics. Importance and Abundance of Motifs. Getting the CDS. From DNA to Protein 6.1.

Motifs and Logos. Six Introduction to Bioinformatics. Importance and Abundance of Motifs. Getting the CDS. From DNA to Protein 6.1. Motifs and Logos Six Discovering Genomics, Proteomics, and Bioinformatics by A. Malcolm Campbell and Laurie J. Heyer Chapter 2 Genome Sequence Acquisition and Analysis Sami Khuri Department of Computer

More information

Carri-Lyn Mead Thursday, January 13, 2005 Terry Fox Laboratory, Dr. Dixie Mager

Carri-Lyn Mead Thursday, January 13, 2005 Terry Fox Laboratory, Dr. Dixie Mager Investigating Trends in Transposable Element Insertion within Regulatory Regions Carri-Lyn Mead cmead@bcgsc.ca Thursday, January 13, 2005 Terry Fox Laboratory, Dr. Dixie Mager Outline Transposable Element

More information

RNA Synthesis and Processing

RNA Synthesis and Processing RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that

More information

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan

CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Giri Narasimhan CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 254; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs15.html Describing & Modeling Patterns

More information

Chromosomal rearrangements in mammalian genomes : characterising the breakpoints. Claire Lemaitre

Chromosomal rearrangements in mammalian genomes : characterising the breakpoints. Claire Lemaitre PhD defense Chromosomal rearrangements in mammalian genomes : characterising the breakpoints Claire Lemaitre Laboratoire de Biométrie et Biologie Évolutive Université Claude Bernard Lyon 1 6 novembre 2008

More information

Potato Genome Analysis

Potato Genome Analysis Potato Genome Analysis Xin Liu Deputy director BGI research 2016.1.21 WCRTC 2016 @ Nanning Reference genome construction???????????????????????????????????????? Sequencing HELL RIEND WELCOME BGI ZHEN LLOFRI

More information

Divergence of regulatory networks governed by the orthologous transcription factors FLC and PEP1 in Brassicaceae species

Divergence of regulatory networks governed by the orthologous transcription factors FLC and PEP1 in Brassicaceae species Divergence of regulatory networks governed by the orthologous transcription factors FLC and PEP1 in Brassicaceae species Julieta L. Mateos a,1,2, Vicky Tilmes a,1, Pedro Madrigal b,3, Edouard Severing

More information

Three types of RNA polymerase in eukaryotic nuclei

Three types of RNA polymerase in eukaryotic nuclei Three types of RNA polymerase in eukaryotic nuclei Type Location RNA synthesized Effect of α-amanitin I Nucleolus Pre-rRNA for 18,.8 and 8S rrnas Insensitive II Nucleoplasm Pre-mRNA, some snrnas Sensitive

More information

Bi 8 Lecture 11. Quantitative aspects of transcription factor binding and gene regulatory circuit design. Ellen Rothenberg 9 February 2016

Bi 8 Lecture 11. Quantitative aspects of transcription factor binding and gene regulatory circuit design. Ellen Rothenberg 9 February 2016 Bi 8 Lecture 11 Quantitative aspects of transcription factor binding and gene regulatory circuit design Ellen Rothenberg 9 February 2016 Major take-home messages from λ phage system that apply to many

More information

Eukaryotic Gene Expression

Eukaryotic Gene Expression Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes

More information

Network motifs in the transcriptional regulation network (of Escherichia coli):

Network motifs in the transcriptional regulation network (of Escherichia coli): Network motifs in the transcriptional regulation network (of Escherichia coli): Janne.Ravantti@Helsinki.Fi (disclaimer: IANASB) Contents: Transcription Networks (aka. The Very Boring Biology Part ) Network

More information

PhyloGibbs: A Gibbs Sampling Motif Finder That Incorporates Phylogeny

PhyloGibbs: A Gibbs Sampling Motif Finder That Incorporates Phylogeny PhyloGibbs: A Gibbs Sampling Motif Finder That Incorporates Phylogeny Rahul Siddharthan 1,2, Eric D. Siggia 1, Erik van Nimwegen 1,3* 1 Center for Studies in Physics and Biology, The Rockefeller University,

More information

CSE 527 Autumn Lectures 8-9 (& part of 10) Motifs: Representation & Discovery

CSE 527 Autumn Lectures 8-9 (& part of 10) Motifs: Representation & Discovery CSE 527 Autumn 2006 Lectures 8-9 (& part of 10) Motifs: Representation & Discovery 1 DNA Binding Proteins A variety of DNA binding proteins ( transcription factors ; a significant fraction, perhaps 5-10%,

More information

A Case Study -- Chu et al. The Transcriptional Program of Sporulation in Budding Yeast. What is Sporulation? CSE 527, W.L. Ruzzo 1

A Case Study -- Chu et al. The Transcriptional Program of Sporulation in Budding Yeast. What is Sporulation? CSE 527, W.L. Ruzzo 1 A Case Study -- Chu et al. An interesting early microarray paper My goals Show arrays used in a real experiment Show where computation is important Start looking at analysis techniques The Transcriptional

More information

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

Peter Pristas. Gene regulation in eukaryotes

Peter Pristas. Gene regulation in eukaryotes Peter Pristas BNK1 Gene regulation in eukaryotes Gene Expression in Eukaryotes Only about 3-5% of all the genes in a human cell are expressed at any given time. The genes expressed can be specific for

More information

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday

Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA

More information

DNA Binding Proteins CSE 527 Autumn 2007

DNA Binding Proteins CSE 527 Autumn 2007 DNA Binding Proteins CSE 527 Autumn 2007 A variety of DNA binding proteins ( transcription factors ; a significant fraction, perhaps 5-10%, of all human proteins) modulate transcription of protein coding

More information

Supplemental Information for Pramila et al. Periodic Normal Mixture Model (PNM)

Supplemental Information for Pramila et al. Periodic Normal Mixture Model (PNM) Supplemental Information for Pramila et al. Periodic Normal Mixture Model (PNM) The data sets alpha30 and alpha38 were analyzed with PNM (Lu et al. 2004). The first two time points were deleted to alleviate

More information

Introduction. Gene expression is the combined process of :

Introduction. Gene expression is the combined process of : 1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression

More information

Biology 112 Practice Midterm Questions

Biology 112 Practice Midterm Questions Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,

More information

L3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus

L3.1: Circuits: Introduction to Transcription Networks. Cellular Design Principles Prof. Jenna Rickus L3.1: Circuits: Introduction to Transcription Networks Cellular Design Principles Prof. Jenna Rickus In this lecture Cognitive problem of the Cell Introduce transcription networks Key processing network

More information

CSCE555 Bioinformatics. Protein Function Annotation

CSCE555 Bioinformatics. Protein Function Annotation CSCE555 Bioinformatics Protein Function Annotation Why we need to do function annotation? Fig from: Network-based prediction of protein function. Molecular Systems Biology 3:88. 2007 What s function? The

More information

Visit to BPRC. Data is crucial! Case study: Evolution of AIRE protein 6/7/13

Visit to BPRC. Data is crucial! Case study: Evolution of AIRE protein 6/7/13 Visit to BPRC Adres: Lange Kleiweg 161, 2288 GJ Rijswijk Utrecht CS à Den Haag CS 9:44 Spoor 9a, arrival 10:22 Den Haag CS à Delft 10:28 Spoor 1, arrival 10:44 10:48 Delft Voorzijde à Bushalte TNO/Lange

More information

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking

More information

Lecture 18 June 2 nd, Gene Expression Regulation Mutations

Lecture 18 June 2 nd, Gene Expression Regulation Mutations Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Networks & pathways. Hedi Peterson MTAT Bioinformatics

Networks & pathways. Hedi Peterson MTAT Bioinformatics Networks & pathways Hedi Peterson (peterson@quretec.com) MTAT.03.239 Bioinformatics 03.11.2010 Networks are graphs Nodes Edges Edges Directed, undirected, weighted Nodes Genes Proteins Metabolites Enzymes

More information

Topic 4 - #14 The Lactose Operon

Topic 4 - #14 The Lactose Operon Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic

More information

7.32/7.81J/8.591J: Systems Biology. Fall Exam #1

7.32/7.81J/8.591J: Systems Biology. Fall Exam #1 7.32/7.81J/8.591J: Systems Biology Fall 2013 Exam #1 Instructions 1) Please do not open exam until instructed to do so. 2) This exam is closed- book and closed- notes. 3) Please do all problems. 4) Use

More information

Prediction o f of cis -regulatory B inding Binding Sites and Regulons 11/ / /

Prediction o f of cis -regulatory B inding Binding Sites and Regulons 11/ / / Prediction of cis-regulatory Binding Sites and Regulons 11/21/2008 Mapping predicted motifs to their cognate TFs After prediction of cis-regulatory motifs in genome, we want to know what are their cognate

More information

XIII International PhD Workshop OWD 2011, October 2011

XIII International PhD Workshop OWD 2011, October 2011 XIII International PhD Workshop OWD 2011, 22 25 October 2011 Structure of the promoter region in NF-kappaB dependent genes in view of NF-kappaB transcription factors family Marta Iwanaszko, Silesian University

More information

Chapter 15 Active Reading Guide Regulation of Gene Expression

Chapter 15 Active Reading Guide Regulation of Gene Expression Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,

More information

On the Monotonicity of the String Correction Factor for Words with Mismatches

On the Monotonicity of the String Correction Factor for Words with Mismatches On the Monotonicity of the String Correction Factor for Words with Mismatches (extended abstract) Alberto Apostolico Georgia Tech & Univ. of Padova Cinzia Pizzi Univ. of Padova & Univ. of Helsinki Abstract.

More information

A Phylogenetic Gibbs Recursive Sampler for Locating Transcription Factor Binding Sites

A Phylogenetic Gibbs Recursive Sampler for Locating Transcription Factor Binding Sites A for Locating Transcription Factor Binding Sites Sean P. Conlan 1 Lee Ann McCue 2 1,3 Thomas M. Smith 3 William Thompson 4 Charles E. Lawrence 4 1 Wadsworth Center, New York State Department of Health

More information

GCD3033:Cell Biology. Transcription

GCD3033:Cell Biology. Transcription Transcription Transcription: DNA to RNA A) production of complementary strand of DNA B) RNA types C) transcription start/stop signals D) Initiation of eukaryotic gene expression E) transcription factors

More information

Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters

Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters Transcription Factor Binding Site Positioning in Yeast: Proximal Promoter Motifs Characterize TATA-Less Promoters Ionas Erb 1, Erik van Nimwegen 2 * 1 Bioinformatics and Genomics program, Center for Genomic

More information

Stochastic simulations

Stochastic simulations Stochastic simulations Application to molecular networks Literature overview Noise in genetic networks Origins How to measure and distinguish between the two types of noise (intrinsic vs extrinsic)? What

More information

Transcription factors (TFs) regulate genes by binding to their

Transcription factors (TFs) regulate genes by binding to their CisModule: De novo discovery of cis-regulatory modules by hierarchical mixture modeling Qing Zhou* and Wing H. Wong* *Department of Statistics, Harvard University, 1 Oxford Street, Cambridge, MA 02138;

More information

The Emergence of Modularity in Biological Systems

The Emergence of Modularity in Biological Systems The Emergence of Modularity in Biological Systems Zhenyu Wang Dec. 2007 Abstract: Modularity is a ubiquitous phenomenon in various biological systems, both in genotype and in phenotype. Biological modules,

More information

Stochastic processes and

Stochastic processes and Stochastic processes and Markov chains (part II) Wessel van Wieringen w.n.van.wieringen@vu.nl wieringen@vu nl Department of Epidemiology and Biostatistics, VUmc & Department of Mathematics, VU University

More information

Adaptive Evolution and the Birth of CTCF Binding Sites in the Drosophila Genome

Adaptive Evolution and the Birth of CTCF Binding Sites in the Drosophila Genome Adaptive Evolution and the Birth of CTCF Binding Sites in the Drosophila Genome The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation

More information

6.096 Algorithms for Computational Biology. Prof. Manolis Kellis

6.096 Algorithms for Computational Biology. Prof. Manolis Kellis 6.096 Algorithms for Computational Biology Prof. Manolis Kellis Today s Goals Introduction Class introduction Challenges in Computational Biology Gene Regulation: Regulatory Motif Discovery Exhaustive

More information

Review Phylogenetic implications of the superfast myosin in extraocular muscles

Review Phylogenetic implications of the superfast myosin in extraocular muscles The Journal of Experimental Biology 205, 2189 2201 (2002) Printed in Great Britain The Company of Biologists Limited 2002 JEB4016 2189 Review Phylogenetic implications of the superfast myosin in extraocular

More information

UE Praktikum Bioinformatik

UE Praktikum Bioinformatik UE Praktikum Bioinformatik WS 08/09 University of Vienna 7SK snrna 7SK was discovered as an abundant small nuclear RNA in the mid 70s but a possible function has only recently been suggested. Two independent

More information

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.

Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17. Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:

More information

Emergence of gene regulatory networks under functional constraints

Emergence of gene regulatory networks under functional constraints under functional constraints Institute of Physics, Jagiellonian University, Kraków, Poland in collaboration with Zdzislaw Burda, Andre Krzywicki and Olivier C. Martin 30 November 2012, Leipzig, CompPhys12

More information

Algorithms for Bioinformatics

Algorithms for Bioinformatics These slides are based on previous years slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen These slides use material from http://bix.ucsd.edu/bioalgorithms/slides.php Algorithms for Bioinformatics

More information

Measuring TF-DNA interactions

Measuring TF-DNA interactions Measuring TF-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Regulation of Gene Expression by Transcription Factors TF trans-acting factors TF TF TF TF

More information

Mole_Oce Lecture # 24: Introduction to genomics

Mole_Oce Lecture # 24: Introduction to genomics Mole_Oce Lecture # 24: Introduction to genomics DEFINITION: Genomics: the study of genomes or he study of genes and their function. Genomics (1980s):The systematic generation of information about genes

More information

networks in molecular biology Wolfgang Huber

networks in molecular biology Wolfgang Huber networks in molecular biology Wolfgang Huber networks in molecular biology Regulatory networks: components = gene products interactions = regulation of transcription, translation, phosphorylation... Metabolic

More information

Genome-wide discovery of G-quadruplex forming sequences and their functional

Genome-wide discovery of G-quadruplex forming sequences and their functional *Correspondence and requests for materials should be addressed to R.G. (rohini@nipgr.ac.in) Genome-wide discovery of G-quadruplex forming sequences and their functional relevance in plants Rohini Garg*,

More information

Genome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots

Genome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots Genome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots Sunita Kumari 1, Doreen Ware 1,2 * 1 Cold Spring Harbor Laboratory, Cold Spring Harbor, New

More information

Promoter Sequence Determines the Relationship between Expression Level and Noise

Promoter Sequence Determines the Relationship between Expression Level and Noise Promoter Sequence Determines the Relationship between Expression Level and Noise Lucas. Carey 1., David van Dijk 1,3., Peter M. A. Sloot 2,3, Jaap A. Kaandorp 3, Eran Segal 1 * 1 Department of Computer

More information

Developmental Biology 3230 Midterm Exam 1 March 2006

Developmental Biology 3230 Midterm Exam 1 March 2006 Name Developmental Biology 3230 Midterm Exam 1 March 2006 1. (20pts) Regeneration occurs to some degree to most metazoans. When you remove the head of a hydra a new one regenerates. Graph the inhibitor

More information

Theoretical distribution of PSSM scores

Theoretical distribution of PSSM scores Regulatory Sequence Analysis Theoretical distribution of PSSM scores Jacques van Helden Jacques.van-Helden@univ-amu.fr Aix-Marseille Université, France Technological Advances for Genomics and Clinics (TAGC,

More information