Insights on Antibiotic Translocation : Molecular Dynamics Simulations

Size: px
Start display at page:

Download "Insights on Antibiotic Translocation : Molecular Dynamics Simulations"

Transcription

1 I Insights on Antibiotic Translocation : Molecular Dynamics Simulations Amit Kumar, Eric Hajjar,Enrico Spiga, Francesa Collu, Paolo Ruggerone & Matteo Ceccarelli Marseille :

2 Outline METHODS 1. Model to assess translocation : What can we compare with experiments? 2. Interrelation between Experiments and Simulations Metadynamics : Different reaction co ordinates, free energy quantification Validations for simulation runs ( RMSF, RMSD ) Results : Successful stories in light with experimental findings : 1. Carbenicilllin diffusion through WT and D113N_E117Q mutants OmpF 2. Ampicillin with Mutants R132A and D113N 3. Floroquinilones : Comparison between Moxifloxacin and Enrofloxacin 4. Cephalosporins : Comparison between Cefpirome and Cefetamet (preminilary results)

3 Modeling Translocation From Blockage SINGLE MOLECULE EXPERIMENTS : Interruption in ion flow associated with blockage of antibiotic BLM experiment : The Rate constant k, can be obtained by noise analysis in frequency spectra. Free energy model : Every 2 blockage corresponds to 1 translocation. Nestorovich et al. PNAS vol. 99, 15,

4 Interrelation between experimental and simulation data Transition Rate Theory : Energy 7 kb T = 1 ns 14 kb T = 1 μ s 21 kb T = 1 ms A G B Reaction Co ordinate K.E.Cooper et al, J. Membrane Biol (1988)

5 Metadynamics Metadynamics : Accelerates the process to be observable within the reach of Standard MD Simulations. Provides Coarse garined description for the process in phase space defined by a set of reaction ccordinates. Main problem: how to choose the reaction coordinates of a given process? Laio and Parrinello, 99, PNAS 2002

6 Reaction Coordinates Z coordinate : The axis of diffusion is defined as center of mass (com )of the antibiotic with respect to com of system along z. Angle : Defined as Orientation of molecule's dipole with respect to com of system along z. H bond : Defined as number of H bond between the antibiotic and the protein. 0 degree 180 degree

7 Free Energy Surface Evaluation Z coordinate 1. Free Energy construction in the phase space of the chosen Reaction co ordinates. 2. Each Color Corresponds to 1 Kcal/mol. 9 Kcal /mol. Angle 3. High Intensity of the color correspond to strong interactions.

8 Validation of Simulation runs Root Mean square Fluctuations and Converted B factors L2 L1 L3 L4 L5 L6 L7 L8

9 Validation for Simulation Runs (ii) Root Mean Square Deviations

10 Area Calculation along OmpF X Ray Structure : 2OMF (PDB ID ) Z axis Solvent accessible area was calculated using in house built program :Hope for the X Ray structure of OmpF. Good agreement with the well known program Hole1. ( Between Z ( 6:6)Š) Useful to calculate the fluctuation of area (with / without) presence of antibiotic with an effort to correlate with BLM experiments. Area (Ų) O.S.Smart et al, Biophysical Journal (1993)

11 I) The case of Carbenicillin Carbenicillin (CRB) has charge of 2. The diffusion of CRB through ompf is difficult due to the repulsion between the carboxy group and the residues 113 and 117 near the constriction region. On Screening the repulsion : By Mutation of the residues D113 N113 and E117 Q117 can we expect the translocation process for CRB? To answer our question : OmpF Investigated : Wild Type (WT) 2. D113N_E117Q : Double Mutant (DM) 1.

12 Free Energy Surface Evaluation Angle Carbenicillin with Wild Type (WT) mutant no translocation. Carbenicillin with D113N_E117Q mutant translocation

13 Movies For WT and D113N_E117Q OmpF

14 Why No translocation through WT OmpF Mini 1 Z axis The strong minimum at Z = ( 7.8 to 9.8 )Å ang = ( 70 to 90 ) deg Angle The antibiotic makes strong H bonds with residues R42, and switches its H bonded interaction between K80, R168

15 Observation along the trajectory for WT 1. For most part of the total trajectory ( ~20ns) the antibiotic stays in Mini 1. Favorable Interaction of oxygens with K80, 167, 168. Move towards constriction region : Snapshot for a configuration where CRB arrives near constriction region parallel to axis of diffusion, phenyl C Repulsion effect and low entropy due to unfavorable environment. Distance group down. (min z= 3.8Å) Figure C on the right depicts distance between D113 COO (black) and E117 COO (red) Time (20ns)

16 Translocation for CRB with DM Z axis Angle

17 Observation along trajectory of translocation Inventory Interaction map for Minima's near Constriction region : Mini 2 and Mini 3 Mini 2 Mini 3 In the two minima's the oxygens of the antibiotic makes H bonded interactions with the stacked arginines ( Switching between R132, R82, R42, K16 ) and in particular we observe the oxygens making interactions with N113 and Q117.

18 Area Calculation for the Minima's for DM Z axis (Å) Area (Ų) The Mini 2 and Mini 3 which lie near/on the constriction region in presence of antibiotic the area is as low as ~2Ų in the constriction region, closure of pore.

19 Comparing WT with DM Mini 1 which lies very much above the constriction region, the WT and DM have nearly similar interaction. ( mutations has not much effect ). For WT CRB does not arrive near the constriction region, due to repulsion and supported low entropy for CRB created by the residues D113, E117. For DM near constriction region : No repulsion effect + Higher Entropy = Translocation. Interactions with N113 and Q117 essential for translocation.

20 Comparing with experiments for CRB BLM experiments : our partners ( Bremen ) 1. WT > No Blockage > No Translocation. 2. DM > No Blockage > No Translocation. Simulation Results : 1. WT > No Translocation 2. DM > Translocation. Area calculation : in presence of antibiotic area ~2Ų, the pore is blocked perhaps for a timescale not resolved by experiments (~10µs).

21 The effects of Ompf mutants on ampicillin diffusion BASIC RESIDUE MUTATION : R132A change in charge + size ACIDIC RESIDUE MUTATION : D113N change in charge View of Constriction Zone

22 Free Energy Surface Z coordinate Mini Mini Angle

23 SER125 OH Interaction map for mini's near constriction region

24 Observation along trajectory of translocation For Mutation of R132A movement of ampicillin towards A132 finds more space H bonded interaction with residues localized in neighbour hood of A132. The orientation is parallel to axis of diffusion. ( phenyl group down) On Mutation D113N H bonded interactions with stacked arginines ( ) and E117. Orientation perpendicular. Phenyl group slides along the L3 loop Phenyl group top AREA CALCULATIONS area available along Z axis, for the minima of R132a, D113n. Z axis (Å) figure on right represents the sas Area (~ 9 Ų) Area ~ (0 Ų) Area (Ų) for Z= 2 (constriction region) along the simulation time. Area (Ų) figure on right represents the area sliced Simulation time

25 Comparison with Experiments BLM experiments (Bremen) 1. D113N Slight Increase in background noise. 2. R132A No Blockage No translocation Simulation Results 1. D113N Translocation ~ Area ~ 0Ų 2. R132A Translocation Area ~9Ų Liposome swelling assay experiments (Bremen and Porto) : Swelling rate for mutants R132A and D113N more compared to wild type, confirms translocation of ampicillin for the mutants.

26 3) Flouroquinolones Floroquinolones are more bulky and hydrophobic compared to the family of penicillin s. Moxifloxacin Enrofloxacin Moxifloxacin and Enrofloxacin are zwitterionic and charged zero.

27 Free Energy Represenatation MOXIFLOXACIN ENROFLOXACIN 3 Translocation with coo group up. Translocation with coo group down.

28 Comparison with BLM experiments Area calculation for the constriction region all along the trajectory of translocation. Moxifloxacin Enrofloxacin Complete closure and conformational change of the pore during the translocation

29 Comparison with fret experiments 1 E (t ) = R 6 (t ) 1+ 6 R0 (t ) Where R06 is the foster radius (E = 0.5 % ) ; and R6 is the distance between the dipole of Trp and Moxifloxacin. E(t) measures the energy transfer between the trp and the antibiotic.

30 Comparison with Fret experiments Moxifloxacin Tryptophane ETrp61=0.957 ETrp214=0.378 High value for Etrp 61 implies difffusion of Further details see poster on Floroquinolones moxi through OmpF

31 Conclusions and Prespectives for Floroquinolones From Simulations : translocation of Moxifloxacin and Enrofloxacin. Thanks to the flouresence property in Floroquinolones, which allow us to compared diretly with the FRET experiments. We observe a high efficiency of energy transfer between Trp 61 and moxifloxacin. Good agreement with experiments. Complete closure of pore and conformational change is the pore (expansion) to accomadate the bulky antibiotic. (agreement with BLM experiments) We extend the methodology from Moxi to Enro and observe similar interactions between the antibiotic and OmpF during the translocation process. (need overlap integral for Enro (from our partners in Porto to calculate the E(t) )

32 4) Cephalosporins CEFPIROME ( CFR) CEFETAMET ( CFT) Charge 0 Charge ( 1)

33 Free Energy Representation CFT WT CFR WT I Z Coordinate V11 ANGLE

34 Preminilary results for CFT Above the constriction region H bond interactions with the stacked arginines, similar conformation for Mini2, Mini3 and Mini4. H contacts with Met 38 Movie : translocation of Cefetamet (CFT)

35 Work In progress CEPHALOSPORINS Cefpirome WT D113A Completed (Eric s Completed (Eric s talk) Cefepime In progress Cefetamet (chagre 1) Preliminary results Ceftizoxime talk) D121A Analysis to completed In progess In progress (translocation) In progress

36 Acknowledgement 1. Thanks to our Network partners : Experimental data 2. Attilio Vargiu : Valuable help Parameterisation of Antibiotics Computing Facility as CASPUR (Rome), CINECA,CYBERSAR (Cagliari ). Financial support

Eric Hajjar, Amit Kumar, Enrico Spiga, Francesca Collu, Atilio Vargiu, Paolo Ruggerone and Matteo Ceccarelli

Eric Hajjar, Amit Kumar, Enrico Spiga, Francesca Collu, Atilio Vargiu, Paolo Ruggerone and Matteo Ceccarelli University of Cagliari, Dept of Physics CNR-SLACS: Sardinian LAboratory for Computational Materials Science Eric Hajjar, Amit Kumar, Enrico Spiga, Francesca Collu, Atilio Vargiu, Paolo Ruggerone and Matteo

More information

Bacterial Outer Membrane Porins as Electrostatic Nanosieves: Exploring Transport Rules of Small Polar Molecules

Bacterial Outer Membrane Porins as Electrostatic Nanosieves: Exploring Transport Rules of Small Polar Molecules Bacterial Outer Membrane Porins as Electrostatic Nanosieves: Exploring Transport Rules of Small Polar Molecules Harsha Bajaj, Silvia Acosta Gutiérrez, Igor Bodrenko, Giuliano Malloci, Mariano Andrea Scorciapino,

More information

Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached

Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached Supplementary Figure S1. Urea-mediated buffering mechanism of H. pylori. Gastric urea is funneled to a cytoplasmic urease that is presumably attached to HpUreI. Urea hydrolysis products 2NH 3 and 1CO 2

More information

Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D

Computational engineering of cellulase Cel9A-68 functional motions through mutations in its linker region. WT 1TF4 (crystal) -90 ERRAT PROVE VERIFY3D Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 218 Supplementary Material: Computational engineering of cellulase Cel9-68 functional

More information

Structural and mechanistic insight into the substrate. binding from the conformational dynamics in apo. and substrate-bound DapE enzyme

Structural and mechanistic insight into the substrate. binding from the conformational dynamics in apo. and substrate-bound DapE enzyme Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 215 Structural and mechanistic insight into the substrate binding from the conformational

More information

Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways

Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Supplementary information for cloud computing approaches for prediction of ligand binding poses and pathways Morgan Lawrenz 1, Diwakar Shukla 1,2 & Vijay S. Pande 1,2 1 Department of Chemistry, Stanford

More information

Proteins polymer molecules, folded in complex structures. Konstantin Popov Department of Biochemistry and Biophysics

Proteins polymer molecules, folded in complex structures. Konstantin Popov Department of Biochemistry and Biophysics Proteins polymer molecules, folded in complex structures Konstantin Popov Department of Biochemistry and Biophysics Outline General aspects of polymer theory Size and persistent length of ideal linear

More information

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron.

Protein Dynamics. The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Protein Dynamics The space-filling structures of myoglobin and hemoglobin show that there are no pathways for O 2 to reach the heme iron. Below is myoglobin hydrated with 350 water molecules. Only a small

More information

Anatoly B. Kolomeisky Department of Chemistry Center for Theoretical Biological Physics How to Understand Molecular Transport through Channels: The

Anatoly B. Kolomeisky Department of Chemistry Center for Theoretical Biological Physics How to Understand Molecular Transport through Channels: The Anatoly B. Kolomeisy Department of Chemistry Center for Theoretical Biological Physics How to Understand Molecular Transport through Channels: The Role of Interactions Transport Through Channels Oil pumping

More information

Structural Insights from Molecular Dynamics. Simulations of Tryptophan 7-Halogenase and

Structural Insights from Molecular Dynamics. Simulations of Tryptophan 7-Halogenase and Supporting Information Structural Insights from Molecular Dynamics Simulations of Tryptophan 7-Halogenase and Tryptophan 5-halogenase Jon Ainsley 1, Adrian J. Mulholland 2, Gary W. Black 1, Olivier Sparagano

More information

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp

T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y. jgp S u p p l e m e n ta l m at e r i a l jgp Lee et al., http://www.jgp.org/cgi/content/full/jgp.201411219/dc1 T H E J O U R N A L O F G E N E R A L P H Y S I O L O G Y S u p p l e m e n ta l D I S C U S

More information

Biophysics 490M Project

Biophysics 490M Project Biophysics 490M Project Dan Han Department of Biochemistry Structure Exploration of aa 3 -type Cytochrome c Oxidase from Rhodobacter sphaeroides I. Introduction: All organisms need energy to live. They

More information

Other Cells. Hormones. Viruses. Toxins. Cell. Bacteria

Other Cells. Hormones. Viruses. Toxins. Cell. Bacteria Other Cells Hormones Viruses Toxins Cell Bacteria ΔH < 0 reaction is exothermic, tells us nothing about the spontaneity of the reaction Δ H > 0 reaction is endothermic, tells us nothing about the spontaneity

More information

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site Experimental and Computational Mutagenesis to Investigate the Positioning of a General Base within an Enzyme Active Site Jason P. Schwans, Philip Hanoian, Benjamin J. Lengerich, Fanny Sunden, Ana Gonzalez

More information

Voltage Dependence of Conformational Dynamics and Subconducting

Voltage Dependence of Conformational Dynamics and Subconducting Biophysical Journal, Volume 111 Supplemental Information Voltage Dependence of Conformational Dynamics and Subconducting States of VDAC-1 Rodolfo Briones, Conrad Weichbrodt, Licia Paltrinieri, Ingo Mey,

More information

Mid-Term Review Meeting

Mid-Term Review Meeting Mid-Term Review Meeting Marseille, France 09-11 April 2008 SCIENTIFIC PROGRAM Wednesday April 09 18 00 Official opening of the meeting by Project Officer Dr. Florent Bernard 18 15 19 15 Lecture by invited

More information

Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability

Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Proteins are not rigid structures: Protein dynamics, conformational variability, and thermodynamic stability Dr. Andrew Lee UNC School of Pharmacy (Div. Chemical Biology and Medicinal Chemistry) UNC Med

More information

Biology Chemistry & Physics of Biomolecules. Examination #1. Proteins Module. September 29, Answer Key

Biology Chemistry & Physics of Biomolecules. Examination #1. Proteins Module. September 29, Answer Key Biology 5357 Chemistry & Physics of Biomolecules Examination #1 Proteins Module September 29, 2017 Answer Key Question 1 (A) (5 points) Structure (b) is more common, as it contains the shorter connection

More information

Supporting Information How does Darunavir prevent HIV-1 protease dimerization?

Supporting Information How does Darunavir prevent HIV-1 protease dimerization? Supporting Information How does Darunavir prevent HIV- protease dimerization? Danzhi Huang and Amedeo Caflisch a Department of Biochemistry University of Zürich, Winterthurerstrasse 9 CH-7 Zürich, Switzerland

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature17991 Supplementary Discussion Structural comparison with E. coli EmrE The DMT superfamily includes a wide variety of transporters with 4-10 TM segments 1. Since the subfamilies of the

More information

Free energy, electrostatics, and the hydrophobic effect

Free energy, electrostatics, and the hydrophobic effect Protein Physics 2016 Lecture 3, January 26 Free energy, electrostatics, and the hydrophobic effect Magnus Andersson magnus.andersson@scilifelab.se Theoretical & Computational Biophysics Recap Protein structure

More information

Supporting Information for. Models for the Metal Transfer Complex of the N-terminal Region of CusB and. CusF

Supporting Information for. Models for the Metal Transfer Complex of the N-terminal Region of CusB and. CusF Supporting Information for Models for the Metal Transfer Complex of the N-terminal Region of CusB and CusF Melek N. Ucisik, Dhruva K. Chakravorty, and Kenneth M. Merz Jr. * Department of Chemistry and

More information

Supporting Information

Supporting Information Supporting Information The Predicted Ensemble of Low-Energy Conformations of Human Somatostatin Receptor Subtype 5 and the Binding of Antagonists Sijia S. Dong, [a] Ravinder Abrol, [a, b] and William A.

More information

Solutions and Non-Covalent Binding Forces

Solutions and Non-Covalent Binding Forces Chapter 3 Solutions and Non-Covalent Binding Forces 3.1 Solvent and solution properties Molecules stick together using the following forces: dipole-dipole, dipole-induced dipole, hydrogen bond, van der

More information

Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine. JAK2 Selective Mechanism Combined Molecular Dynamics Simulation

Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine. JAK2 Selective Mechanism Combined Molecular Dynamics Simulation Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Supporting Information Enhancing Specificity in the Janus Kinases: A Study on the Thienopyridine

More information

Unfolding CspB by means of biased molecular dynamics

Unfolding CspB by means of biased molecular dynamics Chapter 4 Unfolding CspB by means of biased molecular dynamics 4.1 Introduction Understanding the mechanism of protein folding has been a major challenge for the last twenty years, as pointed out in the

More information

Analysis of the simulation

Analysis of the simulation Analysis of the simulation Marcus Elstner and Tomáš Kubař January 7, 2014 Thermodynamic properties time averages of thermodynamic quantites correspond to ensemble averages (ergodic theorem) some quantities

More information

Molecular Basis of K + Conduction and Selectivity

Molecular Basis of K + Conduction and Selectivity The Structure of the Potassium Channel: Molecular Basis of K + Conduction and Selectivity -Doyle, DA, et al. The structure of the potassium channel: molecular basis of K + conduction and selectivity. Science

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Secondary structure of CAP (in the camp 2 -bound state) 10. α-helices are shown as cylinders and β- strands as arrows. Labeling of secondary structure is indicated. CDB, DBD and the hinge are

More information

Supplementary Information Intrinsic Localized Modes in Proteins

Supplementary Information Intrinsic Localized Modes in Proteins Supplementary Information Intrinsic Localized Modes in Proteins Adrien Nicolaï 1,, Patrice Delarue and Patrick Senet, 1 Department of Physics, Applied Physics and Astronomy, Rensselaer Polytechnic Institute,

More information

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b). Crystal contacts at B-C loop are magnified and stereo view of A-weighted

More information

Computing free energy: Thermodynamic perturbation and beyond

Computing free energy: Thermodynamic perturbation and beyond Computing free energy: Thermodynamic perturbation and beyond Extending the scale Length (m) 1 10 3 Potential Energy Surface: {Ri} 10 6 (3N+1) dimensional 10 9 E Thermodynamics: p, T, V, N continuum ls

More information

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases

Supplementary Information. The protease GtgE from Salmonella exclusively targets. inactive Rab GTPases Supplementary Information The protease GtgE from Salmonella exclusively targets inactive Rab GTPases Table of Contents Supplementary Figures... 2 Supplementary Figure 1... 2 Supplementary Figure 2... 3

More information

Supporting Material for. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor

Supporting Material for. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor Supporting Material for Microscopic origin of gating current fluctuations in a potassium channel voltage sensor J. Alfredo Freites, * Eric V. Schow, * Stephen H. White, and Douglas J. Tobias * * Department

More information

Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine

Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine Supplementary figure 1. Comparison of unbound and as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine GM-CSF (slate) with bound GM-CSF in the GIF:GM-CSF complex (GIF: green,

More information

Protein Folding Prof. Eugene Shakhnovich

Protein Folding Prof. Eugene Shakhnovich Protein Folding Eugene Shakhnovich Department of Chemistry and Chemical Biology Harvard University 1 Proteins are folded on various scales As of now we know hundreds of thousands of sequences (Swissprot)

More information

Molecular Dynamics Investigation of the ω-current in the Kv1.2 Voltage Sensor Domains

Molecular Dynamics Investigation of the ω-current in the Kv1.2 Voltage Sensor Domains Molecular Dynamics Investigation of the ω-current in the Kv1.2 Voltage Sensor Domains Fatemeh Khalili-Araghi, Emad Tajkhorshid, Benoît Roux, and Klaus Schulten Department of Physics, Department of Biochemistry,

More information

CD Basis Set of Spectra that is used is that derived from comparing the spectra of globular proteins whose secondary structures are known from X-ray

CD Basis Set of Spectra that is used is that derived from comparing the spectra of globular proteins whose secondary structures are known from X-ray CD Basis Set of Spectra that is used is that derived from comparing the spectra of globular proteins whose secondary structures are known from X-ray crystallography An example of the use of CD Modeling

More information

Tu 1,*, , Sweden

Tu 1,*, , Sweden Supplementary Material Computational studiess of the binding profile of phosphoinositide PtdIns(,4,5)P with the pleckstrin homology domain d of an oomycetee cellulose synthase Guanglin Kuang 1, Vincent

More information

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5 SUPPLEMENTARY TABLES Suppl. Table 1. Protonation states at ph 7.4 and 4.5. Protonation states of titratable residues in GCase at ph 7.4 and 4.5. Histidine: HID, H at δ-nitrogen; HIE, H at ε-nitrogen; HIP,

More information

Insights into Protein Protein Binding by Binding Free Energy Calculation and Free Energy Decomposition for the Ras Raf and Ras RalGDS Complexes

Insights into Protein Protein Binding by Binding Free Energy Calculation and Free Energy Decomposition for the Ras Raf and Ras RalGDS Complexes doi:10.1016/s0022-2836(03)00610-7 J. Mol. Biol. (2003) 330, 891 913 Insights into Protein Protein Binding by Binding Free Energy Calculation and Free Energy Decomposition for the Ras Raf and Ras RalGDS

More information

Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy),

Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy), Supporting Information 1. Constructing the starting structure Comparing crystal structure of M.HhaI with and without DNA1, 2 (PDBID:1hmy and PDBID:2hmy), we find that: the RMSD of overall structure and

More information

Essential dynamics sampling of proteins. Tuorial 6 Neva Bešker

Essential dynamics sampling of proteins. Tuorial 6 Neva Bešker Essential dynamics sampling of proteins Tuorial 6 Neva Bešker Relevant time scale Why we need enhanced sampling? Interconvertion between basins is infrequent at the roomtemperature: kinetics and thermodynamics

More information

Molecular Dynamics Simulations of the Mammalian Glutamate Transporter EAAT3

Molecular Dynamics Simulations of the Mammalian Glutamate Transporter EAAT3 Molecular Dynamics Simulations of the Mammalian Glutamate Transporter EAAT3 Germano Heinzelmann, Serdar Kuyucak* School of Physics, University of Sydney, NSW, Australia Abstract Excitatory amino acid transporters

More information

Supplementary Information

Supplementary Information Supplementary Information Resveratrol Serves as a Protein-Substrate Interaction Stabilizer in Human SIRT1 Activation Xuben Hou,, David Rooklin, Hao Fang *,,, Yingkai Zhang Department of Medicinal Chemistry

More information

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27 Acta Cryst. (2014). D70, doi:10.1107/s1399004714021695 Supporting information Volume 70 (2014) Supporting information for article: Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase

More information

Comparison between Bacteriorhodopsin and Halorhodopsin. Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of

Comparison between Bacteriorhodopsin and Halorhodopsin. Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of Comparison between Bacteriorhodopsin and Halorhodopsin Halorhodopsin (HR) and Bacteriorhodopsin (BR) belong to a subfamily of heptahelical membrane proteins, the archaeal rhodopsins. They are found in

More information

Chapter 6 Cyclic urea - a new central unit in bent-core compounds

Chapter 6 Cyclic urea - a new central unit in bent-core compounds 82 Chapter 6 Cyclic urea - a new central unit in bent-core compounds A new class of five-ring bent-core molecules with a cyclic urea group as a central unit was synthesized [94]. A significant difference

More information

Presenter: She Zhang

Presenter: She Zhang Presenter: She Zhang Introduction Dr. David Baker Introduction Why design proteins de novo? It is not clear how non-covalent interactions favor one specific native structure over many other non-native

More information

Structure Investigation of Fam20C, a Golgi Casein Kinase

Structure Investigation of Fam20C, a Golgi Casein Kinase Structure Investigation of Fam20C, a Golgi Casein Kinase Sharon Grubner National Taiwan University, Dr. Jung-Hsin Lin University of California San Diego, Dr. Rommie Amaro Abstract This research project

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Active Site Structure and Absorption Spectrum of Channelrhodopsin-2

More information

β1 Structure Prediction and Validation

β1 Structure Prediction and Validation 13 Chapter 2 β1 Structure Prediction and Validation 2.1 Overview Over several years, GPCR prediction methods in the Goddard lab have evolved to keep pace with the changing field of GPCR structure. Despite

More information

Why Proteins Fold. How Proteins Fold? e - ΔG/kT. Protein Folding, Nonbonding Forces, and Free Energy

Why Proteins Fold. How Proteins Fold? e - ΔG/kT. Protein Folding, Nonbonding Forces, and Free Energy Why Proteins Fold Proteins are the action superheroes of the body. As enzymes, they make reactions go a million times faster. As versatile transport vehicles, they carry oxygen and antibodies to fight

More information

L718Q mutant EGFR escapes covalent inhibition by stabilizing. a non-reactive conformation of the lung cancer drug. osimertinib

L718Q mutant EGFR escapes covalent inhibition by stabilizing. a non-reactive conformation of the lung cancer drug. osimertinib Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) for L718Q mutant EGFR escapes covalent inhibition

More information

Insights into the Biotransformation of 2,4,6- Trinitrotoluene by the Old Yellow Enzyme Family of Flavoproteins. A Computational Study

Insights into the Biotransformation of 2,4,6- Trinitrotoluene by the Old Yellow Enzyme Family of Flavoproteins. A Computational Study Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2019 Supporting Information for Insights into the Biotransformation of 2,4,6- Trinitrotoluene

More information

Cooperativity and Specificity of Cys 2 His 2 Zinc Finger Protein-DNA Interactions: A Molecular Dynamics Simulation Study

Cooperativity and Specificity of Cys 2 His 2 Zinc Finger Protein-DNA Interactions: A Molecular Dynamics Simulation Study 7662 J. Phys. Chem. B 2010, 114, 7662 7671 Cooperativity and Specificity of Cys 2 His 2 Zinc Finger Protein-DNA Interactions: A Molecular Dynamics Simulation Study Juyong Lee, Jin-Soo Kim, and Chaok Seok*

More information

Chapter 4. Glutamic Acid in Solution - Correlations

Chapter 4. Glutamic Acid in Solution - Correlations Chapter 4 Glutamic Acid in Solution - Correlations 4. Introduction Glutamic acid crystallises from aqueous solution, therefore the study of these molecules in an aqueous environment is necessary to understand

More information

Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6

Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Supplementary Information for: Lipid Regulated Intramolecular Conformational Dynamics of SNARE-Protein Ykt6 Yawei Dai 1, 2, Markus Seeger 3, Jingwei Weng 4, Song Song 1, 2, Wenning Wang 4, Yan-Wen 1, 2,

More information

Chemical properties that affect binding of enzyme-inhibiting drugs to enzymes

Chemical properties that affect binding of enzyme-inhibiting drugs to enzymes Introduction Chemical properties that affect binding of enzyme-inhibiting drugs to enzymes The production of new drugs requires time for development and testing, and can result in large prohibitive costs

More information

Structural study of fluorescence-quenching tryptophan residues in γ-crystallin. Technical Report, April 2007

Structural study of fluorescence-quenching tryptophan residues in γ-crystallin. Technical Report, April 2007 Structural study of fluorescence-quenching tryptophan residues in γ-crystallin Technical Report, April 2007 Grigore D. Pintilie 1, J. A. King 2 1 Electrical Engineering and Computer Science, Massachusetts

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2016 Supporting Information Lipid molecules can induce an opening of membrane-facing

More information

Dimer Dissociation of a Photoreceptor Protein from QM/MM and MD Simulations

Dimer Dissociation of a Photoreceptor Protein from QM/MM and MD Simulations Dimer Dissociation of a Photoreceptor Protein from QM/MM and MD Simulations IMA University of Minnesota Minneapolis, MN, July 20, 2015 Haisheng Ren Advisor: Prof. Jiali Gao Department of Chemistry, University

More information

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR

Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Theory and Applications of Residual Dipolar Couplings in Biomolecular NMR Residual Dipolar Couplings (RDC s) Relatively new technique ~ 1996 Nico Tjandra, Ad Bax- NIH, Jim Prestegard, UGA Combination of

More information

SGE is excited to launch a new HPLC product line under the ProteCol brand.

SGE is excited to launch a new HPLC product line under the ProteCol brand. The Role of Pore Size in Reversed Phase HPLC SGE is excited to launch a new HPLC product line under the ProteCol brand. Fundamental to the new ProteCol line of columns is the continued focus on inert column

More information

Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate

Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate Electro-Mechanical Conductance Modulation of a Nanopore Using a Removable Gate Shidi Zhao a, Laura Restrepo-Pérez b, Misha Soskine c, Giovanni Maglia c, Chirlmin Joo b, Cees Dekker b and Aleksei Aksimentiev

More information

Tracking Protein Allostery in Evolution

Tracking Protein Allostery in Evolution Tracking Protein Allostery in Evolution Glycogen phosphorylase frees sugars to provide energy GP orthologs diverged 600,000,000 years can respond to transcription controls, metabolite concentrations and

More information

MD Simulation in Pose Refinement and Scoring Using AMBER Workflows

MD Simulation in Pose Refinement and Scoring Using AMBER Workflows MD Simulation in Pose Refinement and Scoring Using AMBER Workflows Yuan Hu (On behalf of Merck D3R Team) D3R Grand Challenge 2 Webinar Department of Chemistry, Modeling & Informatics Merck Research Laboratories,

More information

Current address: Department of Chemistry, Hong Kong Baptist University, Kowloon Tong, Hong Kong,

Current address: Department of Chemistry, Hong Kong Baptist University, Kowloon Tong, Hong Kong, Hydrolysis of Cisplatin - A Metadynamics Study Supporting Information Justin Kai-Chi Lau a and Bernd Ensing* b Department of Chemistry and Applied Bioscience, ETH Zurich, USI Campus, Computational Science,

More information

Molecular mechanism of selective transport across the Nuclear Pore Complex

Molecular mechanism of selective transport across the Nuclear Pore Complex Molecular mechanism of selective transport across the Nuclear Pore Complex David Winogradoff and Aleksei Aksimentiev Physics Department, University of Illinois at Urbana-Champaign May 16, 2017 The Nuclear

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Chemical structure of LPS and LPS biogenesis in Gram-negative bacteria. a. Chemical structure of LPS. LPS molecule consists of Lipid A, core oligosaccharide and O-antigen. The polar

More information

MARTINI simulation details

MARTINI simulation details S1 Appendix MARTINI simulation details MARTINI simulation initialization and equilibration In this section, we describe the initialization of simulations from Main Text section Residue-based coarsegrained

More information

Chemical properties that affect binding of enzyme-inhibiting drugs to enzymes

Chemical properties that affect binding of enzyme-inhibiting drugs to enzymes Chemical properties that affect binding of enzyme-inhibiting drugs to enzymes Introduction The production of new drugs requires time for development and testing, and can result in large prohibitive costs

More information

Solutions to Assignment #4 Getting Started with HyperChem

Solutions to Assignment #4 Getting Started with HyperChem Solutions to Assignment #4 Getting Started with HyperChem 1. This first exercise is meant to familiarize you with the different methods for visualizing molecules available in HyperChem. (a) Create a molecule

More information

Table 1. Kinetic data obtained from SPR analysis of domain 11 mutants interacting with IGF-II. Kinetic parameters K D 1.

Table 1. Kinetic data obtained from SPR analysis of domain 11 mutants interacting with IGF-II. Kinetic parameters K D 1. Kinetics and Thermodynamics of the Insulin-like Growth Factor II (IGF-II) Interaction with IGF-II/Mannose 6-phosphate Receptor and the function of CD and AB Loop Solvent-exposed Residues. Research Team:

More information

Supporting Information

Supporting Information Supporting Information Decoding Allosteric Networks in Biocatalysts: Rational Approach to Therapies and Biotechnologies Johannes T. Cramer 1,2, Jana I. Führing 1, Petra Baruch 2, Christian Brütting 3,

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting

More information

Structural Perspectives on Drug Resistance

Structural Perspectives on Drug Resistance Structural Perspectives on Drug Resistance Irene Weber Departments of Biology and Chemistry Molecular Basis of Disease Program Georgia State University Atlanta, GA, USA What have we learned from 20 years

More information

BCMP 201 Protein biochemistry

BCMP 201 Protein biochemistry BCMP 201 Protein biochemistry BCMP 201 Protein biochemistry with emphasis on the interrelated roles of protein structure, catalytic activity, and macromolecular interactions in biological processes. The

More information

Biotechnology of Proteins. The Source of Stability in Proteins (III) Fall 2015

Biotechnology of Proteins. The Source of Stability in Proteins (III) Fall 2015 Biotechnology of Proteins The Source of Stability in Proteins (III) Fall 2015 Conformational Entropy of Unfolding It is The factor that makes the greatest contribution to stabilization of the unfolded

More information

Focus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics

Focus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics SUPPLEMENTARY INFORMATION Focus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics Massimiliano Donato Verona 1, Vincenzo Verdolino 2,3,*, Ferruccio Palazzesi 2,3, and Roberto

More information

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 21 What makes a good graphene-binding peptide? Adsorption of amino acids and

More information

Interpreting and evaluating biological NMR in the literature. Worksheet 1

Interpreting and evaluating biological NMR in the literature. Worksheet 1 Interpreting and evaluating biological NMR in the literature Worksheet 1 1D NMR spectra Application of RF pulses of specified lengths and frequencies can make certain nuclei detectable We can selectively

More information

SUPPLEMENTARY INFORMATION. doi: /nature07461

SUPPLEMENTARY INFORMATION. doi: /nature07461 Figure S1 Electrophysiology. a ph-activation of. Two-electrode voltage clamp recordings of Xenopus oocytes expressing in comparison to waterinjected oocytes. Currents were recorded at 40 mv. The ph of

More information

Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University

Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Alpha-helical Topology and Tertiary Structure Prediction of Globular Proteins Scott R. McAllister Christodoulos A. Floudas Princeton University Department of Chemical Engineering Program of Applied and

More information

University of Bremen and Jacobs University Bremen, June 15 26, A: Simulation of biological systems and their functionalization

University of Bremen and Jacobs University Bremen, June 15 26, A: Simulation of biological systems and their functionalization Program of the International WE Heraeus Summer School ``Quantum and Classical Simulation of Biological Systems and their Interaction with Technical Materials University of Bremen and Jacobs University

More information

PROTEIN STRUCTURE AMINO ACIDS H R. Zwitterion (dipolar ion) CO 2 H. PEPTIDES Formal reactions showing formation of peptide bond by dehydration:

PROTEIN STRUCTURE AMINO ACIDS H R. Zwitterion (dipolar ion) CO 2 H. PEPTIDES Formal reactions showing formation of peptide bond by dehydration: PTEI STUTUE ydrolysis of proteins with aqueous acid or base yields a mixture of free amino acids. Each type of protein yields a characteristic mixture of the ~ 20 amino acids. AMI AIDS Zwitterion (dipolar

More information

Structural basis for catalytically restrictive dynamics of a high-energy enzyme state

Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Supplementary Material Structural basis for catalytically restrictive dynamics of a high-energy enzyme state Michael Kovermann, Jörgen Ådén, Christin Grundström, A. Elisabeth Sauer-Eriksson, Uwe H. Sauer

More information

Affinity and Specificity of Protein U1A-RNA Complex Formation Based on an Additive Component Free Energy Model

Affinity and Specificity of Protein U1A-RNA Complex Formation Based on an Additive Component Free Energy Model doi:10.1016/j.jmb.2007.06.003 J. Mol. Biol. (2007) 371, 1405 1419 Affinity and Specificity of Protein U1A-RNA Complex Formation Based on an Additive Component Free Energy Model Bethany L. Kormos 1, Yulia

More information

How is molecular dynamics being used in life sciences? Davide Branduardi

How is molecular dynamics being used in life sciences? Davide Branduardi How is molecular dynamics being used in life sciences? Davide Branduardi davide.branduardi@schrodinger.com Exploring molecular processes with MD Drug discovery and design Protein-protein interactions Protein-DNA

More information

DISCRETE TUTORIAL. Agustí Emperador. Institute for Research in Biomedicine, Barcelona APPLICATION OF DISCRETE TO FLEXIBLE PROTEIN-PROTEIN DOCKING:

DISCRETE TUTORIAL. Agustí Emperador. Institute for Research in Biomedicine, Barcelona APPLICATION OF DISCRETE TO FLEXIBLE PROTEIN-PROTEIN DOCKING: DISCRETE TUTORIAL Agustí Emperador Institute for Research in Biomedicine, Barcelona APPLICATION OF DISCRETE TO FLEXIBLE PROTEIN-PROTEIN DOCKING: STRUCTURAL REFINEMENT OF DOCKING CONFORMATIONS Emperador

More information

Hands-on Course in Computational Structural Biology and Molecular Simulation BIOP590C/MCB590C. Course Details

Hands-on Course in Computational Structural Biology and Molecular Simulation BIOP590C/MCB590C. Course Details Hands-on Course in Computational Structural Biology and Molecular Simulation BIOP590C/MCB590C Emad Tajkhorshid Center for Computational Biology and Biophysics Email: emad@life.uiuc.edu or tajkhors@uiuc.edu

More information

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

More information

Timescales of Protein Dynamics

Timescales of Protein Dynamics Timescales of Protein Dynamics From Henzler-Wildman and Kern, Nature 2007 Dynamics from NMR Show spies Amide Nitrogen Spies Report On Conformational Dynamics Amide Hydrogen Transverse Relaxation Ensemble

More information

6 Hydrophobic interactions

6 Hydrophobic interactions The Physics and Chemistry of Water 6 Hydrophobic interactions A non-polar molecule in water disrupts the H- bond structure by forcing some water molecules to give up their hydrogen bonds. As a result,

More information

Lecture 34 Protein Unfolding Thermodynamics

Lecture 34 Protein Unfolding Thermodynamics Physical Principles in Biology Biology 3550 Fall 2018 Lecture 34 Protein Unfolding Thermodynamics Wednesday, 21 November c David P. Goldenberg University of Utah goldenberg@biology.utah.edu Clicker Question

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11524 Supplementary discussion Functional analysis of the sugar porter family (SP) signature motifs. As seen in Fig. 5c, single point mutation of the conserved

More information

Density Functional Theory: from theory to Applications

Density Functional Theory: from theory to Applications Density Functional Theory: from theory to Applications Uni Mainz May 27, 2012 Large barrier-activated processes time-dependent bias potential extended Lagrangian formalism Basic idea: during the MD dynamics

More information

Acta Crystallographica Section D

Acta Crystallographica Section D Supporting information Acta Crystallographica Section D Volume 70 (2014) Supporting information for article: Structural characterization of the virulence factor Nuclease A from Streptococcus agalactiae

More information

Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015,

Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015, Biochemistry,530:,, Introduc5on,to,Structural,Biology, Autumn,Quarter,2015, Course,Informa5on, BIOC%530% GraduateAlevel,discussion,of,the,structure,,func5on,,and,chemistry,of,proteins,and, nucleic,acids,,control,of,enzyma5c,reac5ons.,please,see,the,course,syllabus,and,

More information

Manipulating and Probing Enzymatic Conformational Fluctuations and Enzyme-Substrate Interactions by Single-Molecule FRET- Magnetic Tweezers Microscopy

Manipulating and Probing Enzymatic Conformational Fluctuations and Enzyme-Substrate Interactions by Single-Molecule FRET- Magnetic Tweezers Microscopy Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2014 Supporting Information (SI) Manipulating and Probing Enzymatic Conformational Fluctuations

More information