Intensive Course on Population Genetics. Ville Mustonen
|
|
- George Turner
- 5 years ago
- Views:
Transcription
1 Intensive Course on Population Genetics Ville Mustonen
2 Population genetics: The study of the distribution of inherited variation among a group of organisms of the same species [Oxford Dictionary of Biology]
3 Cross- and intra-species comparisons at the molecular level m ingroup samples outgroup AACTGTCCACGTTCTTCCGATGCAGCCTGA AACTGTCCACGTTCTTCCGATGCAGCCTGA AACTGTCCACGTTCTTCCGATGCAGCCTGA AACTGTCCACGTTCTTCCGATGCAGCCTGA AACTGTCCACGTTCTTCCGATGCAGCCTGA AACTGTCCAGGTTCTTCCGATGCAGCCTGA AACTGTCCAGGTTCTTCCGATGCAGCCTGA AACTGTCCAGGTTCTTCCGATGCAGCCTGA AACTGTCCAGGTTCTTCCGACGCAGCCTGA frequency counts polymorphic locus substitution event
4 Let s study fundamental evolutionary forces: 1. genetic drift (noise in reproduction) 2. selection (differential reproductive success of individuals) 3. mutation (process providing variation) 4....
5 Genetic drift: noise in reproduction time in generations individuals
6
7 Wright - Fisher process p b = N b /N = x p a = N a /N =1 x P (m, N, t + 1) = ( ) N x m m t (1 x t ) N m m = Nx t m 2 m 2 = Nx t (1 x t ) x t+1 = x t x 2 t+1 x t+1 2 = x t(1 x t ) N
8 Wright - Fisher process x t τ d N N= N=100 t 0.8 x t t
9 Selection: differential reproductive success of individuals N a = F a N a N b = F b N b t ẋ = d dt N b (t) N a (t)+n b (t) N b N b = N a + N b N a + N b = (F b F a )x(1 x) N b + N a N a + N b
10 Selection ẋ = F ba x(1 x) x(t) = x 0 exp(f ba t) 1+x 0 (exp(f ba t) 1) x t τ s 1/F ba t
11 Mutation: source of variation time in generations individuals
12 Mutation: source of variation N a = µn b µn a N b = µn a µn b µ µ ẋ = d dt N b (t) N a (t)+n b (t) N b = N a + N b = µ(1 2x) N b N a + N b N b + N a N a + N b
13 Mutation ẋ = µ(1 2x) x(t) = 1 2 (1 + exp( 2µt)(2x 0 1)) 1.0 τ 0.8 m 1/µ x 0.6 t t
14 Drift, Selection and Mutation 1.0 τ d N N= x t t
15 Drift, Selection and Mutation x t τs 1/Fba t
16 Drift, Selection and Mutation x t 0.6 τ m 1/µ t
17 Drift, Selection and Mutation Langevin equation: ẋ(t) =F ba x(t)[1 x(t)] + µ[1 2x(t)] + χ x (t) χ x (t) =0 χ x (t)χ x (t ) =(x(1 x)/n ) δ(t t )
18 One locus two alleles model Wright-Fisher process with mutation and selection Ratio of time scales: N 1/µ = µn 1 lighter shading indicates the fitter state population fraction of allele b µt
19 Diffusion equation p(x, t) probability density of populations g(x, ɛ, dt) probability of change x x + ɛ, dt p(x, t + dt) = p(x ɛ, t)g(x ɛ, ɛ, dt)dɛ = = p(x, t) p(x, t)g(x, ɛ, dt) ɛ x pg + ɛ2 2 g(x, ɛ, dt)dɛ x p 2 pg +... dɛ x2 ɛgdɛ x 2 p ɛ 2 gdɛ [SH Rice, Evolutionary Theory (2004)]
20 = p(x, t) g(x, ɛ, dt)dɛ x p ɛgdɛ x 2 p ɛ 2 gdɛ = p(x, t) p(x, t)m(x) x dt p(x, t)v (x) x 2 dt g(x, ɛ, dt)dɛ = 1 ɛg(x, ɛ, dt)dɛ = ɛ rate of directional change of allele frequency at point x = M(x)dt ɛ 2 g(x, ɛ, dt)dɛ = ɛ 2 + var(ɛ) = V (x)dt variance of allele frequency change due to nondirectional effects
21 p(x, t + dt) p(x, t) dt = p(x, t)m(x) x p(x, t)v (x) x 2 p(x, t) t = p(x, t)m(x) x p(x, t)v (x) x 2 Now we just need to plug in our earlier results to get Kimura s diffusion equation for one locus two alleles case: p(x, t) t = x(1 x) x 2 p(x, t) N x [F bax(1 x)+µ(1 2x)]p(x, t)
22 One locus two alleles model: looking at the averages 1 Equilibrium distributions G t (x x0) x
23 One locus two alleles model: looking at the averages 1 after infinite time 0.1 Q(x) x
24 Substitution rate from Kimura s diffusion equation u/µ 4 u(2nf ba )= µ2nf ba 1 exp( 2NF ba ) NF ba
25 Substitution dynamics N 1/µ = µn 1 p a = u ba p b u ab p a p b = u ab p a u ba p b
26 Substitution dynamics p a = p b = u ba u ba + u ab u ab u ba + u ab p a = p b exp( 2NF ba ) N deleterious = N beneficial exp(2nf ba )
27 Conclusions Fundamental evolutionary forces: 1. genetic drift, diffusive force (!), effect strongest in small populations, changes allele frequencies at time-scale 2N 2. selection, directed force, increases the fitter phenotypes, timescale 1/F 3. mutation, directed force, restarts the process from monomorphic states, time-scale 1/µ More complex scenarios, recombination, linkage, diploid genomes, demographics, frequency/time-dependent selection... Further reading, Gillespie: Population Genetics, Hartl and Clark: Principles of Population Genetics
Fitness landscapes and seascapes
Fitness landscapes and seascapes Michael Lässig Institute for Theoretical Physics University of Cologne Thanks Ville Mustonen: Cross-species analysis of bacterial promoters, Nonequilibrium evolution of
More informationGene Genealogies Coalescence Theory. Annabelle Haudry Glasgow, July 2009
Gene Genealogies Coalescence Theory Annabelle Haudry Glasgow, July 2009 What could tell a gene genealogy? How much diversity in the population? Has the demographic size of the population changed? How?
More informationPopulation Genetics and Evolution III
Population Genetics and Evolution III The Mechanisms of Evolution: Drift São Paulo / January 2019 SMRI (Italy) luca@peliti.org 1 Drift 2 The Population Genetics Triad Sewall Wright Ronald A. Fisher Motoo
More informationThe Evolution of Gene Dominance through the. Baldwin Effect
The Evolution of Gene Dominance through the Baldwin Effect Larry Bull Computer Science Research Centre Department of Computer Science & Creative Technologies University of the West of England, Bristol
More informationPopulation Genetics: a tutorial
: a tutorial Institute for Science and Technology Austria ThRaSh 2014 provides the basic mathematical foundation of evolutionary theory allows a better understanding of experiments allows the development
More informationLinking levels of selection with genetic modifiers
Linking levels of selection with genetic modifiers Sally Otto Department of Zoology & Biodiversity Research Centre University of British Columbia @sarperotto @sse_evolution @sse.evolution Sally Otto Department
More informationFrom Biophysics to Evolutionary Genetics: Statistical Aspects of Gene Regulation
To appear in BMC Bioinformatics (2007) From Biophysics to Evolutionary Genetics: Statistical Aspects of Gene Regulation Michael Lässig Institut für Theoretische Physik, Universität zu Köln, Zülpicher Str.
More informationGene regulation: From biophysics to evolutionary genetics
Gene regulation: From biophysics to evolutionary genetics Michael Lässig Institute for Theoretical Physics University of Cologne Thanks Ville Mustonen Johannes Berg Stana Willmann Curt Callan (Princeton)
More informationAn Application of Perturbation Methods in Evolutionary Ecology
Dynamics at the Horsetooth Volume 2A, 2010. Focused Issue: Asymptotics and Perturbations An Application of Perturbation Methods in Evolutionary Ecology Department of Mathematics Colorado State University
More informationNeutral Theory of Molecular Evolution
Neutral Theory of Molecular Evolution Kimura Nature (968) 7:64-66 King and Jukes Science (969) 64:788-798 (Non-Darwinian Evolution) Neutral Theory of Molecular Evolution Describes the source of variation
More informationDarwinian Selection. Chapter 6 Natural Selection Basics 3/25/13. v evolution vs. natural selection? v evolution. v natural selection
Chapter 6 Natural Selection Basics Natural Selection Haploid Diploid, Sexual Results for a Diallelic Locus Fisher s Fundamental Theorem Darwinian Selection v evolution vs. natural selection? v evolution
More informationClassical Selection, Balancing Selection, and Neutral Mutations
Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected
More informationRecovery of a recessive allele in a Mendelian diploid model
Recovery of a recessive allele in a Mendelian diploid model Loren Coquille joint work with A. Bovier and R. Neukirch (University of Bonn) Young Women in Probability and Analysis 2016, Bonn Outline 1 Introduction
More informationThe Wright-Fisher Model and Genetic Drift
The Wright-Fisher Model and Genetic Drift January 22, 2015 1 1 Hardy-Weinberg Equilibrium Our goal is to understand the dynamics of allele and genotype frequencies in an infinite, randomlymating population
More informationIntroduction to Natural Selection. Ryan Hernandez Tim O Connor
Introduction to Natural Selection Ryan Hernandez Tim O Connor 1 Goals Learn about the population genetics of natural selection How to write a simple simulation with natural selection 2 Basic Biology genome
More information6 Introduction to Population Genetics
Grundlagen der Bioinformatik, SoSe 14, D. Huson, May 18, 2014 67 6 Introduction to Population Genetics This chapter is based on: J. Hein, M.H. Schierup and C. Wuif, Gene genealogies, variation and evolution,
More informationDerivation of Itô SDE and Relationship to ODE and CTMC Models
Derivation of Itô SDE and Relationship to ODE and CTMC Models Biomathematics II April 23, 2015 Linda J. S. Allen Texas Tech University TTU 1 Euler-Maruyama Method for Numerical Solution of an Itô SDE dx(t)
More informationEvolution in a spatial continuum
Evolution in a spatial continuum Drift, draft and structure Alison Etheridge University of Oxford Joint work with Nick Barton (Edinburgh) and Tom Kurtz (Wisconsin) New York, Sept. 2007 p.1 Kingman s Coalescent
More informationGenetics and Natural Selection
Genetics and Natural Selection Darwin did not have an understanding of the mechanisms of inheritance and thus did not understand how natural selection would alter the patterns of inheritance in a population.
More informationGenetic Variation in Finite Populations
Genetic Variation in Finite Populations The amount of genetic variation found in a population is influenced by two opposing forces: mutation and genetic drift. 1 Mutation tends to increase variation. 2
More informationPopulation Genetics I. Bio
Population Genetics I. Bio5488-2018 Don Conrad dconrad@genetics.wustl.edu Why study population genetics? Functional Inference Demographic inference: History of mankind is written in our DNA. We can learn
More informationMajor questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.
Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary
More informationHow robust are the predictions of the W-F Model?
How robust are the predictions of the W-F Model? As simplistic as the Wright-Fisher model may be, it accurately describes the behavior of many other models incorporating additional complexity. Many population
More informationComputational Approaches to Statistical Genetics
Computational Approaches to Statistical Genetics GWAS I: Concepts and Probability Theory Christoph Lippert Dr. Oliver Stegle Prof. Dr. Karsten Borgwardt Max-Planck-Institutes Tübingen, Germany Tübingen
More information6 Introduction to Population Genetics
70 Grundlagen der Bioinformatik, SoSe 11, D. Huson, May 19, 2011 6 Introduction to Population Genetics This chapter is based on: J. Hein, M.H. Schierup and C. Wuif, Gene genealogies, variation and evolution,
More informationUNIT 8 BIOLOGY: Meiosis and Heredity Page 148
UNIT 8 BIOLOGY: Meiosis and Heredity Page 148 CP: CHAPTER 6, Sections 1-6; CHAPTER 7, Sections 1-4; HN: CHAPTER 11, Section 1-5 Standard B-4: The student will demonstrate an understanding of the molecular
More informationTutorial on Theoretical Population Genetics
Tutorial on Theoretical Population Genetics Joe Felsenstein Department of Genome Sciences and Department of Biology University of Washington, Seattle Tutorial on Theoretical Population Genetics p.1/40
More informationIntroduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
More informationProblems on Evolutionary dynamics
Problems on Evolutionary dynamics Doctoral Programme in Physics José A. Cuesta Lausanne, June 10 13, 2014 Replication 1. Consider the Galton-Watson process defined by the offspring distribution p 0 =
More informationDiffusion Models in Population Genetics
Diffusion Models in Population Genetics Laura Kubatko kubatko.2@osu.edu MBI Workshop on Spatially-varying stochastic differential equations, with application to the biological sciences July 10, 2015 Laura
More informationQuestion: If mating occurs at random in the population, what will the frequencies of A 1 and A 2 be in the next generation?
October 12, 2009 Bioe 109 Fall 2009 Lecture 8 Microevolution 1 - selection The Hardy-Weinberg-Castle Equilibrium - consider a single locus with two alleles A 1 and A 2. - three genotypes are thus possible:
More informationEVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION
Friday, July 27th, 11:00 EVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION Karan Pattni karanp@liverpool.ac.uk University of Liverpool Joint work with Prof.
More informationGenetical theory of natural selection
Reminders Genetical theory of natural selection Chapter 12 Natural selection evolution Natural selection evolution by natural selection Natural selection can have no effect unless phenotypes differ in
More informationIntroductory seminar on mathematical population genetics
Exercises Sheets Introductory seminar on mathematical population genetics WS 20/202 Kristan Schneider, Ada Akerman Ex Assume a single locus with alleles A and A 2 Denote the frequencies of the three (unordered
More informationSome mathematical models from population genetics
Some mathematical models from population genetics 5: Muller s ratchet and the rate of adaptation Alison Etheridge University of Oxford joint work with Peter Pfaffelhuber (Vienna), Anton Wakolbinger (Frankfurt)
More informationEvolutionary Theory. Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A.
Evolutionary Theory Mathematical and Conceptual Foundations Sean H. Rice Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A. Contents Preface ix Introduction 1 CHAPTER 1 Selection on One
More informationStationary Distribution of the Linkage Disequilibrium Coefficient r 2
Stationary Distribution of the Linkage Disequilibrium Coefficient r 2 Wei Zhang, Jing Liu, Rachel Fewster and Jesse Goodman Department of Statistics, The University of Auckland December 1, 2015 Overview
More informationBackground Selection in Partially Selfing Populations
Background Selection in Partially Selfing Populations Denis Roze To cite this version: Denis Roze. Background Selection in Partially Selfing Populations. Genetics, Genetics Society of America, 2016, 202,
More informationMicroevolution 2 mutation & migration
Microevolution 2 mutation & migration Assumptions of Hardy-Weinberg equilibrium 1. Mating is random 2. Population size is infinite (i.e., no genetic drift) 3. No migration 4. No mutation 5. No selection
More informationQ1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate.
OEB 242 Exam Practice Problems Answer Key Q1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate. First, recall
More informationFormative/Summative Assessments (Tests, Quizzes, reflective writing, Journals, Presentations)
Biology Curriculum Map 2017-18 2 Weeks- Introduction to Biology: Scientific method, lab safety, organizing and analyzing data, and psuedoscience. This unit establishes the fundamental nature of scientific
More information1 Errors in mitosis and meiosis can result in chromosomal abnormalities.
Slide 1 / 21 1 Errors in mitosis and meiosis can result in chromosomal abnormalities. a. Identify and describe a common chromosomal mutation. Slide 2 / 21 Errors in mitosis and meiosis can result in chromosomal
More informationEvolution of molecular phenotypes under stabilizing selection
Evolution of molecular phenotypes under stabilizing selection Armita Nourmohammad 1,2,, Stephan Schiffels 1,3,, Michael Lässig 1 arxiv:1301.3981v1 [q-bio.pe] 17 Jan 2013 1 Institute für Theoretische Physik,
More informationCase-Control Association Testing. Case-Control Association Testing
Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits. Technological advances have made it feasible to perform case-control association studies
More informationSelection and Population Genetics
Selection and Population Genetics Evolution by natural selection can occur when three conditions are satisfied: Variation within populations - individuals have different traits (phenotypes). height and
More informationInbreeding depression due to stabilizing selection on a quantitative character. Emmanuelle Porcher & Russell Lande
Inbreeding depression due to stabilizing selection on a quantitative character Emmanuelle Porcher & Russell Lande Inbreeding depression Reduction in fitness of inbred vs. outbred individuals Outcrossed
More informationURN MODELS: the Ewens Sampling Lemma
Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 3, 2014 1 2 3 4 Mutation Mutation: typical values for parameters Equilibrium Probability of fixation 5 6 Ewens Sampling
More informationQUANTITATIVE MODELS PLAY A CRUCIAL role in evolutionary biology, especially
C H A P T E R 2 8 Models of Evolution QUANTITATIVE MODELS PLAY A CRUCIAL role in evolutionary biology, especially in population genetics. Mathematical analysis has shown how different evolutionary processes
More informationMutation-Selection Systems
Chapter 12 Mutation-Selection Systems The basic mechanisms of population biology are mutation, selection, recombination and genetic drift. In the previous chapter we concentrated on mutation and genetic
More information8. Genetic Diversity
8. Genetic Diversity Many ways to measure the diversity of a population: For any measure of diversity, we expect an estimate to be: when only one kind of object is present; low when >1 kind of objects
More informationRunaway. demogenetic model for sexual selection. Louise Chevalier. Jacques Labonne
Runaway demogenetic model for sexual selection Louise Chevalier Master 2 thesis UPMC, Specialization Oceanography and Marine Environments Jacques Labonne UMR Ecobiop INRA - National Institute for Agronomic
More informationProcesses of Evolution
15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection
More informationMicroevolution Changing Allele Frequencies
Microevolution Changing Allele Frequencies Evolution Evolution is defined as a change in the inherited characteristics of biological populations over successive generations. Microevolution involves the
More informationEndowed with an Extra Sense : Mathematics and Evolution
Endowed with an Extra Sense : Mathematics and Evolution Todd Parsons Laboratoire de Probabilités et Modèles Aléatoires - Université Pierre et Marie Curie Center for Interdisciplinary Research in Biology
More information2. Map genetic distance between markers
Chapter 5. Linkage Analysis Linkage is an important tool for the mapping of genetic loci and a method for mapping disease loci. With the availability of numerous DNA markers throughout the human genome,
More informationBIOL Evolution. Lecture 9
BIOL 432 - Evolution Lecture 9 J Krause et al. Nature 000, 1-4 (2010) doi:10.1038/nature08976 Selection http://www.youtube.com/watch?v=a38k mj0amhc&feature=playlist&p=61e033 F110013706&index=0&playnext=1
More informationDynamics of Coexistence of Asexual and Sexual Reproduction in Adaptive Landscape
Dynamics of Coexistence of Asexual and Sexual Reproduction in Adaptive Landscape Shuyun Jiao,Yanbo Wang, Ping Ao Shanghai Center for Systems Biomedicine, Key Laboratory of Systems Biomedicine of Ministry
More information6 Price equation and Selection in quantitative characters
6 Price equation and Selection in quantitative characters There are several levels of population description. At the most fundamental level, e describe all genotypes represented in the population. With
More informationLecture 14 Chapter 11 Biology 5865 Conservation Biology. Problems of Small Populations Population Viability Analysis
Lecture 14 Chapter 11 Biology 5865 Conservation Biology Problems of Small Populations Population Viability Analysis Minimum Viable Population (MVP) Schaffer (1981) MVP- A minimum viable population for
More informationIntroduction to Wright-Fisher Simulations. Ryan Hernandez
Introduction to Wright-Fisher Simulations Ryan Hernandez 1 Goals Simulate the standard neutral model, demographic effects, and natural selection Start with single sites, and build in multiple sites 2 Hardy-Weinberg
More informationModelling populations under fluctuating selection
Modelling populations under fluctuating selection Alison Etheridge With Aleksander Klimek (Oxford) and Niloy Biswas (Harvard) The simplest imaginable model of inheritance A population of fixed size, N,
More informationSolutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin
Solutions to Even-Numbered Exercises to accompany An Introduction to Population Genetics: Theory and Applications Rasmus Nielsen Montgomery Slatkin CHAPTER 1 1.2 The expected homozygosity, given allele
More informationA. Correct! Genetically a female is XX, and has 22 pairs of autosomes.
MCAT Biology - Problem Drill 08: Meiosis and Genetic Variability Question No. 1 of 10 1. A human female has pairs of autosomes and her sex chromosomes are. Question #01 (A) 22, XX. (B) 23, X. (C) 23, XX.
More informationEffective population size and patterns of molecular evolution and variation
FunDamental concepts in genetics Effective population size and patterns of molecular evolution and variation Brian Charlesworth Abstract The effective size of a population,, determines the rate of change
More informationEXERCISES FOR CHAPTER 3. Exercise 3.2. Why is the random mating theorem so important?
Statistical Genetics Agronomy 65 W. E. Nyquist March 004 EXERCISES FOR CHAPTER 3 Exercise 3.. a. Define random mating. b. Discuss what random mating as defined in (a) above means in a single infinite population
More informationWright-Fisher Models, Approximations, and Minimum Increments of Evolution
Wright-Fisher Models, Approximations, and Minimum Increments of Evolution William H. Press The University of Texas at Austin January 10, 2011 1 Introduction Wright-Fisher models [1] are idealized models
More information4. Populationsgenetik
4. Populationsgenetik Populations are never uniform, but individuals differ genetically and phenotypically. Population genetics is concerned with the study of the genetic composition of populations and
More informationQuantitative trait evolution with mutations of large effect
Quantitative trait evolution with mutations of large effect May 1, 2014 Quantitative traits Traits that vary continuously in populations - Mass - Height - Bristle number (approx) Adaption - Low oxygen
More information1.5.1 ESTIMATION OF HAPLOTYPE FREQUENCIES:
.5. ESTIMATION OF HAPLOTYPE FREQUENCIES: Chapter - 8 For SNPs, alleles A j,b j at locus j there are 4 haplotypes: A A, A B, B A and B B frequencies q,q,q 3,q 4. Assume HWE at haplotype level. Only the
More informationSTABILIZING SELECTION ON HUMAN BIRTH WEIGHT
STABILIZING SELECTION ON HUMAN BIRTH WEIGHT See Box 8.2 Mapping the Fitness Landscape in Z&E FROM: Cavalli-Sforza & Bodmer 1971 STABILIZING SELECTION ON THE GALL FLY, Eurosta solidaginis GALL DIAMETER
More informationLecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012
Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based
More informationNEUTRAL EVOLUTION IN ONE- AND TWO-LOCUS SYSTEMS
æ 2 NEUTRAL EVOLUTION IN ONE- AND TWO-LOCUS SYSTEMS 19 May 2014 Variations neither useful nor injurious would not be affected by natural selection, and would be left either a fluctuating element, as perhaps
More informationThe effect of linkage on establishment and. survival of locally beneficial mutations
Genetics: Early Online, published on March 13, 2014 as 10.1534/genetics.114.163477 The effect of linkage on establishment and survival of locally beneficial mutations Simon Aeschbacher,,1, Reinhard Bürger
More informationFebuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution. Classical vs. balanced views of genome structure
Febuary 1 st, 2010 Bioe 109 Winter 2010 Lecture 11 Molecular evolution Classical vs. balanced views of genome structure - the proposal of the neutral theory by Kimura in 1968 led to the so-called neutralist-selectionist
More informationLecture 24: Multivariate Response: Changes in G. Bruce Walsh lecture notes Synbreed course version 10 July 2013
Lecture 24: Multivariate Response: Changes in G Bruce Walsh lecture notes Synbreed course version 10 July 2013 1 Overview Changes in G from disequilibrium (generalized Bulmer Equation) Fragility of covariances
More informationThis article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research education use, including for instruction at the authors institution
More informationFunctional divergence 1: FFTNS and Shifting balance theory
Functional divergence 1: FFTNS and Shifting balance theory There is no conflict between neutralists and selectionists on the role of natural selection: Natural selection is the only explanation for adaptation
More informationQuantitative-Genetic Models and Changing Environments
Bürger R & Krall C (2004). Quantitative-Genetic Models and Changing Environments. In: Evolutionary Conservation Biology, eds. Ferrière R, Dieckmann U & Couvet D, pp. 171 187. Cambridge University Press.
More information122 9 NEUTRALITY TESTS
122 9 NEUTRALITY TESTS 9 Neutrality Tests Up to now, we calculated different things from various models and compared our findings with data. But to be able to state, with some quantifiable certainty, that
More informationMutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution
Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution 15.2 Intro In biology, evolution refers specifically to changes in the genetic makeup of populations over time.
More informationCritical Mutation Rate Has an Exponential Dependence on Population Size
Critical Mutation Rate Has an Exponential Dependence on Population Size Alastair Channon 1, Elizabeth Aston 1, Charles Day 1, Roman V. Belavkin 2 and Christopher G. Knight 3 1 Research Institute for the
More informationTheoretical Population Biology
Theoretical Population Biology 87 (013) 6 74 Contents lists available at SciVerse ScienceDirect Theoretical Population Biology journal homepage: www.elsevier.com/locate/tpb Genotype imputation in a coalescent
More informationAre there species smaller than 1mm?
Are there species smaller than 1mm? Alan McKane Theoretical Physics Division, University of Manchester Warwick, September 9, 2013 Alan McKane (Manchester) Are there species smaller than 1mm? Warwick, September
More informationp(d g A,g B )p(g B ), g B
Supplementary Note Marginal effects for two-locus models Here we derive the marginal effect size of the three models given in Figure 1 of the main text. For each model we assume the two loci (A and B)
More informationA Simple Haploid-Diploid Evolutionary Algorithm
A Simple Haploid-Diploid Evolutionary Algorithm Larry Bull Computer Science Research Centre University of the West of England, Bristol, UK larry.bull@uwe.ac.uk Abstract It has recently been suggested that
More informationStochastic Demography, Coalescents, and Effective Population Size
Demography Stochastic Demography, Coalescents, and Effective Population Size Steve Krone University of Idaho Department of Mathematics & IBEST Demographic effects bottlenecks, expansion, fluctuating population
More informationDarwinian Selection. Chapter 7 Selection I 12/5/14. v evolution vs. natural selection? v evolution. v natural selection
Chapter 7 Selection I Selection in Haploids Selection in Diploids Mutation-Selection Balance Darwinian Selection v evolution vs. natural selection? v evolution ² descent with modification ² change in allele
More informationLecture 18 : Ewens sampling formula
Lecture 8 : Ewens sampling formula MATH85K - Spring 00 Lecturer: Sebastien Roch References: [Dur08, Chapter.3]. Previous class In the previous lecture, we introduced Kingman s coalescent as a limit of
More informationCompeting selective sweeps
Competing selective sweeps Sebastian Bossert Dissertation zur Erlangung des Doktorgrades der Fakultät für Mathematik und Physik der Albert-Ludwigs-Universität Freiburg im Breisgau Pr r t r rö r r t Pr
More information1.3 Forward Kolmogorov equation
1.3 Forward Kolmogorov equation Let us again start with the Master equation, for a system where the states can be ordered along a line, such as the previous examples with population size n = 0, 1, 2,.
More informationThe inevitability of unconditionally deleterious substitutions during adaptation arxiv: v2 [q-bio.pe] 17 Nov 2013
The inevitability of unconditionally deleterious substitutions during adaptation arxiv:1309.1152v2 [q-bio.pe] 17 Nov 2013 David M. McCandlish 1, Charles L. Epstein 2, and Joshua B. Plotkin 1 1 Department
More informationSoft selective sweeps in complex demographic scenarios
Genetics: Early Online, published on July 24, 2014 as 10.1534/genetics.114.165571 Soft selective sweeps in complex demographic scenarios Benjamin A. Wilson, Dmitri A. Petrov, Philipp W. Messer Department
More informationarxiv: v1 [q-bio.pe] 20 Sep 2018
SAIONARY FREQUENCIES AND MIXING IMES FOR NEURAL DRIF PROCESSES WIH SPAIAL SRUCURE ALEX MCAVOY 1, BEN ADLAM 1,2, BENJAMIN ALLEN 1,3, MARIN A. NOWAK 1,4,5 arxiv:1809.07788v1 q-bio.pe 20 Sep 2018 1 Program
More informationThe Genetics of Natural Selection
The Genetics of Natural Selection Introduction So far in this course, we ve focused on describing the pattern of variation within and among populations. We ve talked about inbreeding, which causes genotype
More informationUnderstanding relationship between homologous sequences
Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 007 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results
More informationMichael Whitlock. #?:Joh. ~esearch Interests. Page 1 of; ubc. ca
v1ichael Whitlock Michael Whitlock Page 1 of; #?:Joh thitlock@zoology. ubc. ca \.ssociate Professor )ep-~lrtment of Zoology Jniversity of British Columbia 3.S., Baylor; Ph.D., Vanderbilt ~uce Scholar,
More informationMathematical modelling of Population Genetics: Daniel Bichener
Mathematical modelling of Population Genetics: Daniel Bichener Contents 1 Introduction 3 2 Haploid Genetics 4 2.1 Allele Frequencies......................... 4 2.2 Natural Selection in Discrete Time...............
More informationLecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency
Lecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency Bruce Walsh lecture notes Introduction to Quantitative Genetics SISG, Seattle 16 18 July 2018 1 Outline Genetics of complex
More informationThe mathematical challenge. Evolution in a spatial continuum. The mathematical challenge. Other recruits... The mathematical challenge
The mathematical challenge What is the relative importance of mutation, selection, random drift and population subdivision for standing genetic variation? Evolution in a spatial continuum Al lison Etheridge
More information