Supporting Information

Size: px
Start display at page:

Download "Supporting Information"

Transcription

1 Supporting Information Ultrasensitive Label-Free Resonance Rayleigh Scattering Aptasensor for Hg 2+ Using Hg 2+ -Triggered Exonuclease III-Assisted Target Recycling and Growth of G-Wires for Signal Amplification Wang Ren, a, b Ying Zhang, a, b Hong Guo Chen, a Zhong Feng Gao, a Nian Bing Li a, * and Hong Qun Luo a, * a Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing , People s Republic of China b College of Chemistry and Pharmaceutical Engineering, Sichuan Provincial Academician (Expert) Workstation, Key Laboratory of Green Catalysis of Higher Education Institutes of Sichuan, Sichuan University of Science and Engineering, Zigong , People s Republic of China * Corresponding Author, luohq@swu.edu.cn (H. Luo), linb@swu.edu.cn (N. Li) S-1

2 Supporting Tables: Tables S1 to S2 Supporting Figures: Figures S1 to S6 Supporting Information (SI) Contents Table S1 Sequence of Oligomers Table S2 Comparison of the Proposed Approach with Other Reported Methods for the Detection of Hg Figure S1 Atomic Force Microscopy... 5 Figure S2 Optimum Concentrations of Exo-Ш Catalysis 6 Figure S3 Optimum Temperature for the Exo-Ш Catalysis...7 Figure S4 Optimum Time of Exo-Ш Catalysis.8 Figure S5 Optimum Concentration of Mg 2+ for the G-Wire Formation... 9 Figure S6 Optimum Incubation Time of Mg References S-2

3 1. Table S1 Table S1 Sequence of Oligomers Oligomer Sequence (from 5 to 3 ) H 1 (c-myc) H 2 (c-myc) H 3 (c-myc) H 4 (c-myc) H 5 (c-myc) H 6 (PS2.M) H 6 (i-motif) H 7 (normally) TTTTAGGGTGGGGAGGGTGGGGCCCCACCCTTTTT CTTTAGGGTGGGGAGGGTGGGGCCCCACCCTTTAG CTTTAGGGTGGGGAGGGTGGGGCCCCACCCTTAAG TTTAGGGTGGGGAGGGTGGGGCCCCACCCTTTT CTTTAGGGTGGGGAGGGTGGGGCCCCACCCTTTTG CTTTGTGGGTAGGGCGGGTTGGCCTACCCACTTTG CTTTCCCTAACCCTAACCCTAACCCGGGTTAGGGTTTG CTTTCGAACAGC AA GCAGACTG TTGCTGTTCGTTTG c-myc: parallel-stranded G-quadruplex topology; PS2.M: antiparallel-stranded G-quadruplex topology; i-motif: i-motif topology. S-3

4 2. Table S2 Comparison of the Proposed Approach with Other Reported Methods for the Detection of Hg 2+ SERS: Surface-enhanced Raman scattering; PDDA: Poly (diallyldi-methylammonium chloride); AuNPs: gold nanoparticles; ABTS 2- : 2,2 -azino-bis(3-ethylbenzothiazo-line-6-sulfonate) disodium salt. Method Label or signal reagent Linear range (nm) LOD (pm) Ref. Electrochemistry AuNPs and methyl blue S1 Electrochemistry Ru(NH 3 ) 6 Cl S2 Electrochemistry Ferrocene S3 Electrochemistry Methylene blue S4 Electrochemistry Methylene blue S5 Luminescence Iridium(III) complex S6 Fluorescence Phosphorothioate RNA S7 SERS Cyanine S8 Fluorescence Mn:CdS/ZnS and AuNPs S9 Fluorescence Polymer Carbon Nanoribbons S10 Fluorescence Ag nanoclusters S11 Fluorescence Thioflavin T S12 Fluorescence Ag nanoclusters S13 Colorimetry PDDA S14 Colorimetry AuNPs S15 Colorimetry Ag nanowire S16 Colorimetry AuNPs S17 Colorimetry AuNPs S18 Colorimetry ABTS S19 RRS Free This work S-4

5 3. Atomic Force Microscopy Figure S1. AFM images of the resultant products in buffer solution containing (A) 10.0 µm H U Exo-Ш; (B) 10.0 µm H U Exo-Ш µm Hg 2+. S-5

6 4. Optimum Concentrations of Exo-Ш Catalysis 2500 I RRS C Exo-III / U Figure S2 Effect of different concentrations of Exo-III on the RRS intensity responding to the Exo-Ш catalysis process. (The concentration of DNA and Mg 2+ were 0.2 µm and 0.15 M, respectively. Reaction temperature and time were 30 C and 30 min, respectively; Incubation time: 2 h). The error bars represent the standard deviation of three parallel measurements (the same below). S-6

7 5. Optimum Temperature for the Exo-Ш Catalysis I RRS Without Hg nm Hg T / o C Figure S3 Effect of different reaction temperatures on the RRS intensity responding to the Exo Ш catalysis process. (The concentration of DNA and Mg 2+ were 0.2 µm, 0.15 M, respectively. Reaction time was 30 min; Incubation time: 2 h; Exo-III: 25 U) S-7

8 6. Optimum Time of Exo-Ш Catalysis I RRS t / min Figure S4 Effect of different reaction time on the RRS intensity responding to the Exo-Ш catalysis process. (The concentration of DNA and Mg 2+ were 0.2 µm, 0.15 M, respectively. Reaction temperature was 35 C; Incubation time: 2 h; Exo-III: 25 U) S-8

9 7. Optimum Concentration of Mg 2+ for the G-wire Formation 4000 I RRS Without Hg nm Hg C Mg 2+ / M Figure S5 Effect of different concentrations of Mg 2+ on the RRS intensity responding to G-wire formation process in the presence of Hg 2+ (upper line) and in the absence of Hg 2+ (under line) under the optimal conditions. (The concentration of DNA was 0.2 µm. Reaction temperature and time were 35 C and 50 min, respectively; Incubation time: 2 h; Exo-III: 25 U) S-9

10 8. Optimum Incubation Time of Mg I RRS t / min Figure S6 Effect of incubation time on the RRS intensity responding to 10.0 nm Hg 2+ in the presence of 0.2 M Mg 2+. (The concentration of DNA was 0.2 µm. Reaction temperature and time were 35 C and 50 min, respectively; Exo-III: 25 U) S-10

11 References S1) Zhang, Y.; Zeng, G. M.; Tang, L.; Chen, J.; Zhu, Y.; He, X. X.; He, Y. Anal. Chem. 2015, 87, S2) Bao, T.; Wen, W.; Zhang, X.; Xia, Q.; Wang, S. Biosens. Bioelectron. 2015, 70, S3) Zhuang, J.; Fu, L.; Tang D.; Xu, M.; Chen, G.; Yang, H. Biosens. Bioelectron. 2013, 39, S4) Xuan, F.; Luo, X.; Hsing, I. M. Anal. Chem. 2013, 85, S5) Tortolini, C.; Bollella, P.; Antonelli, M. L.; Antiochia, R.; Mazzei, F.; Favero, G. Biosens. Bioelectron. 2015, 67, S6) Ru, J.; Chen, X.; Guan, L.; Tang, X.; Wang, C.; Meng, Y.; Zhang, G.; Liu, W. Anal. Chem. 2015, 87, S7) Huang, P. J.; Wang, F.; Liu, J. Anal. Chem. 2015, 87, S8) Sun, B.; Jiang, X.; Wang, H.; Song, B.; Zhu, Y.; Wang, H.; Su, Y.; He, Y. Anal. Chem. 2015, 87, S9) Huang, D.; Niu, C.; Wang, X.; Lv, X.; Zeng, G.. Anal. Chem. 2013, 85, S10) Wang, Z.; Ding, S. Anal. Chem. 2014, 86, S11) Deng, L.; Zhou, Z.; Li, J.; Li, T.; Dong, S. Chem. Commun. 2011, 47, S12) Ge, J.; Li, X.; Jiang, J.; Yu, R. Talanta 2014, 122, S13) Wang, G.; Xu, G.; Zhu, Y.; Zhang, X. Chem. Commun. 2014, 50, S14) Zhu, Y.; Cai, Y.; Zhu, Y.; Zheng, L.; Ding, J.; Quan, Y.; Wang, L.; Qi, B. Biosens. Bioelectron.2015, 69, S15) Gao, Y.; Li,X.; Li,Y.; Li, T.; Zhao,Y.; Wu, A. Chem. Commun. 2014, 50, S16) Tang, S.; Tong, P.; Wang, M.; Chen, J.; Li, G.; Zhang, L. Chem. Commun., 2015, 51, S17) Sener, G.; Uzun, L.; Denizli, A. Anal. Chem. 2014, 86, S18) Chen, J.; Zhou, S.; Wen, J. Anal. Chem. 2014, 86, S19) Ren, W.; Zhang, Y.; Huang, W. T.; Li, N. B.; Luo, H. Q. Biosens. Bioelectron. 2015, 68, S-11

Supporting Information

Supporting Information Supporting Information Electrochemiluminescent Pb 2+ -Driven Circular Etching Sensor Coupled to a DNA Micronet-Carrier Wen-Bin Liang,, Ying Zhuo, Ying-Ning Zheng, Cheng-Yi Xiong, Ya-Qin Chai, *, and Ruo

More information

Supporting Information. Ultrasensitive and facile detection of microrna via portable. pressure meter

Supporting Information. Ultrasensitive and facile detection of microrna via portable. pressure meter Supporting Information Ultrasensitive and facile detection of microrna via portable pressure meter Lu Shi a, Jing Lei a, Bei Zhang a, Baoxin Li a, Chaoyong James Yang b and Yan Jin a, * a Key Laboratory

More information

Supporting Information. Fluorescence Regulation of Copper Nanoclusters via DNA Template. Manipulation toward Design of a High Signal-to-Noise Ratio

Supporting Information. Fluorescence Regulation of Copper Nanoclusters via DNA Template. Manipulation toward Design of a High Signal-to-Noise Ratio Supporting Information Fluorescence Regulation of Copper Nanoclusters via DNA Template Manipulation toward Design of a High Signal-to-Noise Ratio Biosensor Junyao Li, Wenxin Fu, Jianchun Bao, Zhaoyin Wang*,

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Supporting Information Highly Photoluminescent Carbon Dots Derived from

More information

Large-Area and Uniform Surface-Enhanced Raman. Saturation

Large-Area and Uniform Surface-Enhanced Raman. Saturation Supporting Information Large-Area and Uniform Surface-Enhanced Raman Spectroscopy Substrate Optimized by Enhancement Saturation Daejong Yang 1, Hyunjun Cho 2, Sukmo Koo 1, Sagar R. Vaidyanathan 2, Kelly

More information

Supporting information

Supporting information Supporting information Platinum nanoparticle encapsulated metal organic frameworks for colorimetric measurement and facile removal of mercury (II) Huaping Li a, Huifang Liu a, Jidong Zhang b, Yuxiao Cheng

More information

A label-free colorimetric strategy for facile and low-cost sensing of

A label-free colorimetric strategy for facile and low-cost sensing of Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2019 Supporting Information A label-free colorimetric strategy for facile and low-cost sensing

More information

Supporting Information. Facile design of phase separation for microfluidic. droplet-based liquid phase microextraction as a front end to

Supporting Information. Facile design of phase separation for microfluidic. droplet-based liquid phase microextraction as a front end to Supporting Information Facile design of phase separation for microfluidic droplet-based liquid phase microextraction as a front end to electrothermal vaporization-icpms for the analysis of trace metals

More information

One-pot synthesis of bi-metallic PdRu tripods as an efficient catalyst for. electrocatalytic nitrogen reduction to ammonia

One-pot synthesis of bi-metallic PdRu tripods as an efficient catalyst for. electrocatalytic nitrogen reduction to ammonia Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Supporting Information for One-pot synthesis of bi-metallic PdRu tripods

More information

Facile Preparation of High-Quantum-Yield Gold Nanoclusters: Application to Probing Mercuric Ions and Biothiols

Facile Preparation of High-Quantum-Yield Gold Nanoclusters: Application to Probing Mercuric Ions and Biothiols Facile Preparation of High-Quantum-Yield Gold Nanoclusters: Application to Probing Mercuric Ions and Biothiols Heng-Chia Chang 1, Ying-Feng Chang 2, Nien-Chu Fan 2 and Ja-an Annie Ho 1,2 * 1 Department

More information

Supporting Information. for

Supporting Information. for Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Supporting Information for Electrochemically induced Fenton reaction of few-layer MoS 2 nanosheets:

More information

Supporting Information

Supporting Information Supporting Information Label-Free Photoelectrochemical Off-On Platform Coupled with G-wire-Enhanced Strategy for Highly Sensitive MicroRNA Sensing in Cancer Cells Cui Ye, Min Qiang Wang, Hong Qun Luo *,

More information

Supporting Information

Supporting Information Supporting Information Nest-like NiCoP for Highly Efficient Overall Water Splitting Cheng Du, a Lan Yang, a Fulin Yang, a Gongzhen Cheng a and Wei Luo a,b* a College of Chemistry and Molecular Sciences,

More information

Nanochannel-Confined Graphene Quantum Dots. for Ultrasensitive Electrochemical Analysis of

Nanochannel-Confined Graphene Quantum Dots. for Ultrasensitive Electrochemical Analysis of Supporting Information Nanochannel-Confined Graphene Quantum Dots for Ultrasensitive Electrochemical Analysis of Complex Samples Lili Lu, 1 Lin Zhou, 1 Jie Chen, 2 Fei Yan, 1 Jiyang Liu,*,1 Xiaoping Dong,

More information

A label-free DNA reduced graphene oxide-based fluorescent. sensor for highly sensitive and selective detection of hemin

A label-free DNA reduced graphene oxide-based fluorescent. sensor for highly sensitive and selective detection of hemin A label-free DNA reduced graphene oxide-based fluorescent sensor for highly sensitive and selective detection of hemin Yan Shi, Wei Tao Huang, Hong Qun Luo and Nian Bing Li* Key Laboratory on Luminescence

More information

Pt-like Hydrogen Evolution Electrocatalysis on PANI/CoP Hybrid Nanowires. by Weakening the Shackles of Hydrogen Ions on the Surfaces of Catalysts

Pt-like Hydrogen Evolution Electrocatalysis on PANI/CoP Hybrid Nanowires. by Weakening the Shackles of Hydrogen Ions on the Surfaces of Catalysts Pt-like Hydrogen Evolution Electrocatalysis on PANI/CoP Hybrid Nanowires by Weakening the Shackles of Hydrogen Ions on the Surfaces of Catalysts Jin-Xian Feng, Si-Yao Tong, Ye-Xiang Tong, and Gao-Ren Li

More information

Supporting information

Supporting information Supporting information In Situ Hydrothermal Grown of TiO 2 @C Core-Shell Nanowire Coating for High Sensitive Solid Phase Microextraction of Polycyclic Aromatic Hydrocarbons Fuxin Wang, Juan Zheng, Junlang

More information

Chemical Research in Chinese Universities

Chemical Research in Chinese Universities Chemical Research in Chinese Universities Vol.24 No.5 September 2008 CONTENTS Articles Comparison of the Sol-gel Method with the Coprecipitation Technique for Preparation of Hexagonal Barium Ferrite WANG

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supporting Information Stacking Up Layers of Polyaniline/Carbon Nanotube

More information

Electronic Supporting Information. for

Electronic Supporting Information. for Electronic Supplementary Material (ESI) for ChemComm. Supplementary material for Chemical Communications Electronic Supporting Information for Self-exothermic reaction prompted synthesis of single-layered

More information

Supporting Information for

Supporting Information for Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2019 Supporting Information for Enhanced cycling stability of boron-doped lithium-rich

More information

Supplementary Information

Supplementary Information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2017 Supplementary Information Supramolecular interactions via hydrogen bonding contributing to

More information

Oxidase-like Mimic of 3 PO 4 Microcubes as A Smart Probe for Ultrasensitive and Selective Hg 2+ Detection

Oxidase-like Mimic of 3 PO 4 Microcubes as A Smart Probe for Ultrasensitive and Selective Hg 2+ Detection Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2016 Supporting Information Oxidase-like Mimic of Ag@Ag 3 PO 4 Microcubes as A Smart Probe

More information

Shell-isolated nanoparticle-enhanced Raman spectroscopy

Shell-isolated nanoparticle-enhanced Raman spectroscopy Shell-isolated nanoparticle-enhanced Raman spectroscopy Jian Feng Li, Yi Fan Huang, Yong Ding, Zhi Lin Yang, Song Bo Li, Xiao Shun Zhou, Feng Ru Fan, Wei Zhang, Zhi You Zhou, De Yin Wu, Bin Ren, Zhong

More information

Supporting Information. Real-Time Dark-Field Scattering Microscopic Monitoring of. the in situ Growth of Single Nanoalloys

Supporting Information. Real-Time Dark-Field Scattering Microscopic Monitoring of. the in situ Growth of Single Nanoalloys Supporting Information for Real-Time Dark-Field Scattering Microscopic Monitoring of the in situ Growth of Single Ag@Hg Nanoalloys Yue Liu,, and Cheng Zhi Huang,,* Education Ministry Key Laboratory on

More information

Supporting information

Supporting information a Supporting information Core-Shell Nanocomposites Based on Gold Nanoparticle@Zinc-Iron- Embedded Porous Carbons Derived from Metal Organic Frameworks as Efficient Dual Catalysts for Oxygen Reduction and

More information

Self-floating nanostructural Ni-NiO x /Ni foam for solar thermal water evaporation

Self-floating nanostructural Ni-NiO x /Ni foam for solar thermal water evaporation Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2019 The supporting information for Self-floating nanostructural Ni-NiO x /Ni

More information

Case Doc 1059 Filed 11/26/18 Entered 11/26/18 11:05:25 Desc Main Document Page 1 of 9

Case Doc 1059 Filed 11/26/18 Entered 11/26/18 11:05:25 Desc Main Document Page 1 of 9 Document Page 1 of 9 UNITED STATES BANKRUPTCY COURT DISTRICT OF MASSACHUSETTS ) In Re: ) ) Chapter 11 ) TELEXFREE, LLC, ) Case No. 14-40987-MSH TELEXFREE, INC., ) Case No. 14-40988-MSH TELEXFREE FINANCIAL,

More information

Hydrothermally Activated Graphene Fiber Fabrics for Textile. Electrodes of Supercapacitors

Hydrothermally Activated Graphene Fiber Fabrics for Textile. Electrodes of Supercapacitors Supporting Information for Hydrothermally Activated Graphene Fiber Fabrics for Textile Electrodes of Supercapacitors Zheng Li, Tieqi Huang, Weiwei Gao*, Zhen Xu, Dan Chang, Chunxiao Zhang, and Chao Gao*

More information

General Synthesis of Graphene-Supported. Bicomponent Metal Monoxides as Alternative High- Performance Li-Ion Anodes to Binary Spinel Oxides

General Synthesis of Graphene-Supported. Bicomponent Metal Monoxides as Alternative High- Performance Li-Ion Anodes to Binary Spinel Oxides Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) General Synthesis of Graphene-Supported

More information

Study on form distribution of soil iron in western Jilin and its correlation with soil properties

Study on form distribution of soil iron in western Jilin and its correlation with soil properties 35 2 2016 6 GLOBAL GEOLOGY Vol. 35 No. 2 Jun. 2016 1004 5589 2016 02 0593 08 1 1 2 1 1 1. 130061 2. 130012 50 A > B > C > D > E > F > G A A CEC B ph C E A C D G B C D P595 S151. 9 A doi 10. 3969 /j. issn.

More information

Metal-Organic Framework Derived Iron Sulfide-Carbon Core-Shell Nanorods as a Conversion-Type Battery Material

Metal-Organic Framework Derived Iron Sulfide-Carbon Core-Shell Nanorods as a Conversion-Type Battery Material Supporting Information Metal-Organic Framework Derived Iron Sulfide-Carbon Core-Shell Nanorods as a Conversion-Type Battery Material Wei Huang,, Shuo Li, Xianyi Cao, Chengyi Hou, Zhen Zhang, Jinkui Feng,

More information

Co-vacancy-rich Co 1 x S nanosheets anchored on rgo for high-efficiency oxygen evolution

Co-vacancy-rich Co 1 x S nanosheets anchored on rgo for high-efficiency oxygen evolution Electronic Supplementary Material Co-vacancy-rich Co 1 x S nanosheets anchored on rgo for high-efficiency oxygen evolution Jiaqing Zhu 1, Zhiyu Ren 1 ( ), Shichao Du 1, Ying Xie 1, Jun Wu 1,2, Huiyuan

More information

Supporting Information

Supporting Information Supporting Information Transparent and Self-supporting Graphene Films with Wrinkled- Graphene-Wall-assembled Opening Polyhedron Building Blocks for High Performance Flexible/Transparent Supercapacitors

More information

Supporting Information. Cobalt Molybdenum Oxide Derived High-Performance Electrocatalyst

Supporting Information. Cobalt Molybdenum Oxide Derived High-Performance Electrocatalyst Supporting Information Cobalt Molybdenum Oxide Derived High-Performance Electrocatalyst for the Hydrogen Evolution Reaction Mingjie Zang, [a] Ning Xu, [a] Guoxuan Cao, [a] Zhengjun Chen, [a] Jie Cui, [b]

More information

Chemical Research in Chinese Universities

Chemical Research in Chinese Universities Chemical Research in Chinese Universities Vol.26 No.3 May 2010 CONTENTS Articles Synthesis and Structure Description of a New Tetradecaborate [H 3 N(CH 2 ) 2 NH 3 ] 2 [B 14 O 20 (OH) 6 ] YANG Miao, ZHANG

More information

Quantitative Surface-Enhanced Raman Spectroscopy through the Interface-Assisted Self-Assembly of Three- Dimensional Silver Nanorod Substrates

Quantitative Surface-Enhanced Raman Spectroscopy through the Interface-Assisted Self-Assembly of Three- Dimensional Silver Nanorod Substrates SUPPORTING INFORMATION Quantitative Surface-Enhanced Raman Spectroscopy through the Interface-Assisted Self-Assembly of Three- Dimensional Silver Nanorod Substrates Si-Ying Liu,, Xiang-Dong Tian, *,, Yun

More information

Supporting material. Figures

Supporting material. Figures Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Supporting material Figures

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Experimental section Materials: Tannic acid (TA), silver nitrate

More information

Supporting Information for

Supporting Information for Supporting Information for Multilayer CuO@NiO Hollow Spheres: Microwave-Assisted Metal-Organic-Framework Derivation and Highly Reversible Structure-Matched Stepwise Lithium Storage Wenxiang Guo, Weiwei

More information

Science and Technology, Dalian University of Technology, Dalian , P. R. China b

Science and Technology, Dalian University of Technology, Dalian , P. R. China b Electronic Supplementary Information for Fabrication of Superior-Performance SnO 2 @C Composites for Lithium-Ion Anodes Using Tubular Mesoporous Carbons with Thin Carbon Wall and High Pore Volume Fei Han,

More information

Effective Adsorption of Pd(II), Pt(IV) and Au(III) by Zr- Cluster-Based Metal-Organic Frameworks from Strongly Acidic Solution

Effective Adsorption of Pd(II), Pt(IV) and Au(III) by Zr- Cluster-Based Metal-Organic Frameworks from Strongly Acidic Solution Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supporting Information Effective Adsorption of Pd(II), Pt(IV) and Au(III)

More information

Supporting Infromation

Supporting Infromation Supporting Infromation Transparent and Flexible Self-Charging Power Film and Its Application in Sliding-Unlock System in Touchpad Technology Jianjun Luo 1,#, Wei Tang 1,#, Feng Ru Fan 1, Chaofeng Liu 1,

More information

A Two-Dimensional Biodegradable Niobium Carbide (MXene) for Photothermal Tumor Eradication in NIR-I and NIR-II Biowindows

A Two-Dimensional Biodegradable Niobium Carbide (MXene) for Photothermal Tumor Eradication in NIR-I and NIR-II Biowindows Supporting information for JACS A Two-Dimensional Biodegradable Niobium Carbide (MXene) for Photothermal Tumor Eradication in NIR-I and NIR-II Biowindows Han Lin, 1,2 Shanshan Gao, 1,2 Chen Dai, 1 Yu Chen,

More information

An Advanced Anode Material for Sodium Ion. Batteries

An Advanced Anode Material for Sodium Ion. Batteries Layered-Structure SbPO 4 /Reduced Graphene Oxide: An Advanced Anode Material for Sodium Ion Batteries Jun Pan, Shulin Chen, # Qiang Fu, Yuanwei Sun, # Yuchen Zhang, Na Lin, Peng Gao,* # Jian Yang,* and

More information

Case Doc 1060 Filed 11/26/18 Entered 11/26/18 11:06:29 Desc Main Document Page 1 of 9

Case Doc 1060 Filed 11/26/18 Entered 11/26/18 11:06:29 Desc Main Document Page 1 of 9 Document Page 1 of 9 UNITED STATES BANKRUPTCY COURT DISTRICT OF MASSACHUSETTS ) In Re: ) ) Chapter 11 ) TELEXFREE, LLC, ) Case No. 14-40987-MSH TELEXFREE, INC., ) Case No. 14-40988-MSH TELEXFREE FINANCIAL,

More information

Efficient removal of typical dye and Cr(VI) reduction using N-doped

Efficient removal of typical dye and Cr(VI) reduction using N-doped Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Efficient removal of typical dye and Cr(VI) reduction using N-doped magnetic porous carbon

More information

Supporting Information for:

Supporting Information for: Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supporting Information for: A Highly Efficient Electrocatalyst Based on

More information

Main controlling factors of hydrocarbon accumulation in Sujiatun oilfield of Lishu rift and its regularity in enrichment

Main controlling factors of hydrocarbon accumulation in Sujiatun oilfield of Lishu rift and its regularity in enrichment 35 3 2016 9 GLOBAL GEOLOGY Vol. 35 No. 3 Sept. 2016 1004 5589 2016 03 0785 05 130062 P618. 130. 2 A doi 10. 3969 /j. issn. 1004-5589. 2016. 03. 019 Main controlling factors of hydrocarbon accumulation

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Mesoporous C-coated SnO x nanosheets

More information

Case Doc 1061 Filed 11/26/18 Entered 11/26/18 11:07:32 Desc Main Document Page 1 of 8

Case Doc 1061 Filed 11/26/18 Entered 11/26/18 11:07:32 Desc Main Document Page 1 of 8 Document Page 1 of 8 UNITED STATES BANKRUPTCY COURT DISTRICT OF MASSACHUSETTS ) In Re: ) ) Chapter 11 ) TELEXFREE, LLC, ) Case No. 14-40987-MSH TELEXFREE, INC., ) Case No. 14-40988-MSH TELEXFREE FINANCIAL,

More information

Engineering NiS/Ni 2 P Heterostructures for Efficient Electrocatalytic Water Splitting

Engineering NiS/Ni 2 P Heterostructures for Efficient Electrocatalytic Water Splitting Supporting Information Engineering NiS/Ni 2 P Heterostructures for Efficient Electrocatalytic Water Splitting Xin Xiao, Dekang Huang, Yongqing Fu, Ming Wen, Xingxing Jiang, Xiaowei Lv, Man Li, Lin Gao,

More information

Supplementary Information for

Supplementary Information for Supplementary Information for One-Nanometer-Thick PtNiRh Trimetallic Nanowires with Enhanced Oxygen Reduction Electrocatalysis in Acid Media: Integrating Multiple Advantages into One Catalyst Kan Li,,

More information

Tuning the Shell Number of Multi-Shelled Metal Oxide. Hollow Fibers for Optimized Lithium Ion Storage

Tuning the Shell Number of Multi-Shelled Metal Oxide. Hollow Fibers for Optimized Lithium Ion Storage Supporting Information Tuning the Shell Number of Multi-Shelled Metal Oxide Hollow Fibers for Optimized Lithium Ion Storage Jin Sun, Chunxiao Lv, Fan Lv, ǁ Shuai Chen, Daohao Li, Ziqi Guo, Wei Han, Dongjiang

More information

Case Doc 1055 Filed 11/26/18 Entered 11/26/18 10:59:37 Desc Main Document Page 1 of 8

Case Doc 1055 Filed 11/26/18 Entered 11/26/18 10:59:37 Desc Main Document Page 1 of 8 Document Page 1 of 8 UNITED STATES BANKRUPTCY COURT DISTRICT OF MASSACHUSETTS ) In Re: ) ) Chapter 11 ) TELEXFREE, LLC, ) Case No. 14-40987-MSH TELEXFREE, INC., ) Case No. 14-40988-MSH TELEXFREE FINANCIAL,

More information

Degradation of Bisphenol A by Peroxymonosulfate Catalytically Activated with. Gui-Xiang Huang, Chu-Ya Wang, Chuan-Wang Yang, Pu-Can Guo, Han-Qing Yu*

Degradation of Bisphenol A by Peroxymonosulfate Catalytically Activated with. Gui-Xiang Huang, Chu-Ya Wang, Chuan-Wang Yang, Pu-Can Guo, Han-Qing Yu* Supporting Information for Degradation of Bisphenol A by Peroxymonosulfate Catalytically Activated with Mn 1.8 Fe 1.2 O 4 Nanospheres: Synergism between Mn and Fe Gui-Xiang Huang, Chu-Ya Wang, Chuan-Wang

More information

Supporting Information. General Strategy to Fabricate Electrochemiluminescence. Sandwich-Type Nanoimmunosensors Using Quantum

Supporting Information. General Strategy to Fabricate Electrochemiluminescence. Sandwich-Type Nanoimmunosensors Using Quantum Supporting Information General Strategy to Fabricate Electrochemiluminescence Sandwich-Type Nanoimmunosensors Using CdTe@ZnS Quantum Dots as Luminescent Labels and Fe 3 O 4 @SiO 2 Nanoparticles as Magnetic

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Supporting Information Si/SiO x Hollow Nanospheres/Nitrogen-Doped Carbon

More information

Mercury(II) detection by SERS based on a single gold microshell

Mercury(II) detection by SERS based on a single gold microshell Mercury(II) detection by SERS based on a single gold microshell D. Han, S. Y. Lim, B. J. Kim, L. Piao and T. D. Chung* Department of Chemistry, Seoul National University, Seoul, Korea. 2010, 46, 5587-558

More information

Supporting Information

Supporting Information Supporting Information Fe 3 O 4 @Carbon Nanosheets for All-Solid-State Supercapacitor Electrodes Huailin Fan, Ruiting Niu, & Jiaqi Duan, Wei Liu and Wenzhong Shen * State Key Laboratory of Coal Conversion,

More information

Journal of Materials Chemistry A ELECTRONIC SUPPLEMENTARY INFORMATION (ESI )

Journal of Materials Chemistry A ELECTRONIC SUPPLEMENTARY INFORMATION (ESI ) Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 218 Journal of Materials Chemistry A ELECTRONIC SUPPLEMENTARY INFORMATION (ESI

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2019 Supporting Information Atomically dispersed Ni as the active site towards selective hydrogenation

More information

Highly Stretchable and Transparent Thermistor Based on Self-Healing Double. Network Hydrogel

Highly Stretchable and Transparent Thermistor Based on Self-Healing Double. Network Hydrogel Supporting Information Highly Stretchable and Transparent Thermistor Based on Self-Healing Double Network Hydrogel Jin Wu a, Songjia Han a, Tengzhou Yang a, Zhong Li c, Zixuan Wu a, Xuchun Gui a, Kai Tao

More information

Full-Color Light-Emitting Carbon Dots with a Surface-State

Full-Color Light-Emitting Carbon Dots with a Surface-State Supporting information Full-Color Light-Emitting Carbon Dots with a Surface-State -Controlled Luminescence Mechanism Hui Ding, Shang-Bo Yu, Ji-Shi Wei and Huan-Ming Xiong* Department of Chemistry, Fudan

More information

for highly efficient and stable corrosive-water evaporation

for highly efficient and stable corrosive-water evaporation Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Synthesis of mesoporous Fe 3 Si aerogel

More information

Bimetallic Thin Film NiCo-NiCoO as Superior Bifunctional Electro- catalyst for Overall Water Splitting in Alkaline Media

Bimetallic Thin Film NiCo-NiCoO as Superior Bifunctional Electro- catalyst for Overall Water Splitting in Alkaline Media Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supportting Information for Bimetallic Thin Film NiCo-NiCoO 2 @NC as Superior

More information

Large-Scale Multifunctional Electrochromic-Energy Storage Device Based on Tungsten Trioxide Monohydrate Nanosheets and Prussian White

Large-Scale Multifunctional Electrochromic-Energy Storage Device Based on Tungsten Trioxide Monohydrate Nanosheets and Prussian White Supporting Information Large-Scale Multifunctional Electrochromic-Energy Storage Device Based on Tungsten Trioxide Monohydrate Nanosheets and Prussian White Zhijie Bi, a,b Xiaomin Li,* a Yongbo Chen, a,b

More information

Supporting information. One-step facile synthesis of novel β-amino alcohol functionalized

Supporting information. One-step facile synthesis of novel β-amino alcohol functionalized Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Supporting information One-step facile synthesis of novel β-amino alcohol functionalized carbon

More information

Carbon dot-based fluorescence turn-on sensor for hydrogen. peroxide with a photo-induced electron transfer mechanism

Carbon dot-based fluorescence turn-on sensor for hydrogen. peroxide with a photo-induced electron transfer mechanism Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Carbon dot-based fluorescence turn-on sensor for hydrogen peroxide with a photo-induced electron

More information

A Hydrophilic/Hydrophobic Janus Inverse-Opal

A Hydrophilic/Hydrophobic Janus Inverse-Opal Supporting information A Hydrophilic/Hydrophobic Janus Inverse-Opal Actuator via Gradient Infiltration Dajie Zhang #, Jie Liu //#, Bo Chen *, Yong Zhao, Jingxia Wang * //, Tomiki Ikeda, Lei Jiang //. CAS

More information

Supporting information for the communication Label-Free Aptasensor. Based on Ultrathin-Linker-Mediated Hot-Spot Assembly to Induce

Supporting information for the communication Label-Free Aptasensor. Based on Ultrathin-Linker-Mediated Hot-Spot Assembly to Induce Supporting information for the communication Label-Free Aptasensor Based on Ultrathin-Linker-Mediated Hot-Spot Assembly to Induce Strong Directional Fluorescence. Shuo-Hui Cao 1, Wei-Peng Cai 1, Qian Liu

More information

The Sensitive and Selective Adsorption of Aromatic. Compounds with Highly Crosslinked Polymer Nanoparticles

The Sensitive and Selective Adsorption of Aromatic. Compounds with Highly Crosslinked Polymer Nanoparticles Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Supplementary Information The Sensitive and Selective Adsorption of Aromatic Compounds with Highly

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information An Ultrasensitive Flow Cytometric Immunoassay Based

More information

Cloth for High-Efficient Electrocatalytic Urea Oxidation

Cloth for High-Efficient Electrocatalytic Urea Oxidation Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Supporting Information In-situ Growth of Single-Layered α-ni(oh) 2 Nanosheets

More information

Please do not adjust margins. Flower stamen-like porous boron carbon nitride nanoscrolls for water cleaning

Please do not adjust margins. Flower stamen-like porous boron carbon nitride nanoscrolls for water cleaning Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry Please do 2017 not adjust margins Electronic Supplementary Information (ESI) Flower stamen-like porous

More information

Phytic Acid-Assisted Formation of Hierarchical Porous CoP/C Nanoboxes for Enhanced Lithium Storage and Hydrogen Generation

Phytic Acid-Assisted Formation of Hierarchical Porous CoP/C Nanoboxes for Enhanced Lithium Storage and Hydrogen Generation Phytic Acid-Assisted Formation of Hierarchical Porous CoP/C Nanoboxes for Enhanced Lithium Storage and Hydrogen Generation Xuxu Wang, ab Zhaolin Na, a Dongming Yin, a Chunli Wang, ab Yaoming Wu, a Gang

More information

Digitized single scattering nanoparticles for probing molecular binding

Digitized single scattering nanoparticles for probing molecular binding Electronic Supplementary Information (ESI) Digitized single scattering nanoparticles for probing molecular binding Yue Liu a, Cheng Zhi Huang a,b* a Education Ministry Key Laboratory on Luminescence and

More information

Relocation of aftershocks of the Wenchuan M S 8.0 earthquake and its implication to seismotectonics

Relocation of aftershocks of the Wenchuan M S 8.0 earthquake and its implication to seismotectonics Earthq Sci (2011)24: 107 113 107 doi:10.1007/s11589-011-0774-6 Relocation of aftershocks of the Wenchuan M S 8.0 earthquake and its implication to seismotectonics Bo Zhao Yutao Shi and Yuan Gao Institute

More information

In-Situ Fabrication of CoS and NiS Nanomaterials Anchored on. Reduced Graphene Oxide for Reversible Lithium Storage

In-Situ Fabrication of CoS and NiS Nanomaterials Anchored on. Reduced Graphene Oxide for Reversible Lithium Storage Supporting Information In-Situ Fabrication of CoS and NiS Nanomaterials Anchored on Reduced Graphene Oxide for Reversible Lithium Storage Yingbin Tan, [a] Ming Liang, [b, c] Peili Lou, [a] Zhonghui Cui,

More information

Chemical Research in Chinese Universities

Chemical Research in Chinese Universities Chemical Research in Chinese Universities Vol.26 No.1 January 2010 CONTENTS Articles Primary Organicamine Templated Indium Iodate (H 2 en)kin(io 3 ) 6 2(H 2 O) with Hydrogen-bonded Helices LIU Guo-zong,

More information

Green Synthesis of Fluorescent Carbon Dots for Selective Detection of Tartrazine in Food Samples

Green Synthesis of Fluorescent Carbon Dots for Selective Detection of Tartrazine in Food Samples 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Supporting Information Green Synthesis of Fluorescent Carbon Dots for Selective Detection of Tartrazine in Food Samples Hua Xu, Xiupei Yang, *, Gu

More information

Supporting Information. Co 4 N Nanosheets Assembled Mesoporous Sphere as a Matrix for Ultrahigh Sulfur Content Lithium Sulfur Batteries

Supporting Information. Co 4 N Nanosheets Assembled Mesoporous Sphere as a Matrix for Ultrahigh Sulfur Content Lithium Sulfur Batteries Supporting Information Co 4 N Nanosheets Assembled Mesoporous Sphere as a Matrix for Ultrahigh Sulfur Content Lithium Sulfur Batteries Ding-Rong Deng, Fei Xue, Yue-Ju Jia, Jian-Chuan Ye, Cheng-Dong Bai,

More information

Supporting Information

Supporting Information Supporting Information Surfactant-Free Assembly of Mesoporous Carbon Hollow Spheres with Large Tunable Pore Sizes Hongwei Zhang, Owen Noonan, Xiaodan Huang, Yannan Yang, Chun Xu, Liang Zhou, and Chengzhong

More information

Supporting Information. Phenolic/resin assisted MOFs derived hierarchical Co/N-doping carbon

Supporting Information. Phenolic/resin assisted MOFs derived hierarchical Co/N-doping carbon Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Material (ESI) for Journal of Materials Chemistry

More information

Hexagonal-Phase Cobalt Monophosphosulfide for. Highly Efficient Overall Water Splitting

Hexagonal-Phase Cobalt Monophosphosulfide for. Highly Efficient Overall Water Splitting Supporting Information for Hexagonal-Phase Cobalt Monophosphosulfide for Highly Efficient Overall Water Splitting Zhengfei Dai,,, Hongbo Geng,,, Jiong Wang, Yubo Luo, Bing Li, ǁ Yun Zong, ǁ Jun Yang, Yuanyuan

More information

Multifunctional bi-continuous composite foams with ultralow percolation thresholds

Multifunctional bi-continuous composite foams with ultralow percolation thresholds Supporting Information for Multifunctional bi-continuous composite foams with ultralow percolation thresholds Jiabin Xi 1,, Yingjun Liu 1,, Ying Wu 1,4, Jiahan Hu 1, Weiwei Gao 1, Erzhen Zhou 1,3, Honghui

More information

Self-assembled pancake-like hexagonal tungsten oxide with ordered mesopores for supercapacitors

Self-assembled pancake-like hexagonal tungsten oxide with ordered mesopores for supercapacitors Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Electronic Supporting Information Self-assembled pancake-like hexagonal

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Supporting Information Synthesis and electrochemical properties of spherical and hollow-structured

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Two-dimensional CoNi nanoparticles@s,n-doped

More information

A long-lived iridium(iii) chemosensor for the real-time

A long-lived iridium(iii) chemosensor for the real-time Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2017 Supporting Information A long-lived iridium(iii) chemosensor for the real-time

More information

Journal of South China University of Technology Natural Science Edition

Journal of South China University of Technology Natural Science Edition 45 8 207 8 Journal of South China University of Technology Natural Science Edition Vol 45 No 8 August 207 000-565X20708-0050-07 2 3002202 54004 PERCLOS U49 doi0 3969 /j issn 000-565X 207 08 008 4-7 0 h

More information

Metal Organic Framework-Derived Metal Oxide Embedded in Nitrogen-Doped Graphene Network for High-Performance Lithium-Ion Batteries

Metal Organic Framework-Derived Metal Oxide Embedded in Nitrogen-Doped Graphene Network for High-Performance Lithium-Ion Batteries Supporting Information for Metal Organic Framework-Derived Metal Oxide Embedded in Nitrogen-Doped Graphene Network for High-Performance Lithium-Ion Batteries Zhu-Yin Sui, Pei-Ying Zhang,, Meng-Ying Xu,

More information

Hierarchical MoO 2 /Mo 2 C/C Hybrid Nanowires for High-Rate and. Long-Life Anodes for Lithium-Ion Batteries. Supporting Information

Hierarchical MoO 2 /Mo 2 C/C Hybrid Nanowires for High-Rate and. Long-Life Anodes for Lithium-Ion Batteries. Supporting Information Supporting Information Hierarchical MoO 2 /Mo 2 C/C Hybrid Nanowires for High-Rate and Long-Life Anodes for Lithium-Ion Batteries Lichun Yang, a Xiang Li, a Yunpeng Ouyang, a Qingsheng Gao, b Liuzhang

More information

Supporting Information

Supporting Information Supporting Information Rapid Recovery Hydrogel Actuator in Air with Bionic Large-ranged Gradient Structure Yun Tan, Di Wang, Huaxiu Xu, Yang Yang, Xiong-Lei Wang, Fei Tian, Pingping Xu, Wenli An, Xu Zhao,

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supporting Information Ultrathin Petal-like NiAl Layered Double oxide/sulfide

More information

Three Dimensional Nano-assemblies of Noble Metal. Nanoparticles-Infinite Coordination Polymers as a Specific

Three Dimensional Nano-assemblies of Noble Metal. Nanoparticles-Infinite Coordination Polymers as a Specific Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Three Dimensional Nano-assemblies of Noble Metal Nanoparticles-Infinite

More information

Supporting Information. Unique Core-Shell Concave Octahedron with Enhanced Methanol Oxidation Activity

Supporting Information. Unique Core-Shell Concave Octahedron with Enhanced Methanol Oxidation Activity Supporting Information Unique Cu@CuPt Core-Shell Concave Octahedron with Enhanced Methanol Oxidation Activity Qi Wang a, Zhiliang Zhao c, Yanlin Jia* b, Mingpu Wang a, Weihong Qi a, Yong Pang a, Jiang

More information

Supporting Information. Engineering Two-Dimensional Mass-Transport Channels

Supporting Information. Engineering Two-Dimensional Mass-Transport Channels Supporting Information Engineering Two-Dimensional Mass-Transport Channels of MoS 2 Nanocatalyst towards Improved Hydrogen Evolution Performance Ge Wang a, Jingying Tao a, Yijie Zhang a, Shengping Wang

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Cation exchange MOF-derived nitrogen-doped

More information

Supporting Information

Supporting Information Supporting Information A Rational Solid-state Synthesis of Supported Au-Ni Bimetallic Nanoparticles with Enhanced Activity for Gas-phase Selective Oxidation of Alcohols Wuzhong Yi, a Wentao Yuan, b Ye

More information