DISENTANGLING THE PHENOTYPIC VARIATION AND POLLINATION BIOLOGY OF THE CYCLOCEPHALA SEXPUNCTATA SPECIES COMPLEX (COLEOPTERA: SCARABAEIDAE: DYNASTINAE)

Transcription

1 DISENTANGLING THE PHENOTYPIC VARIATION AND POLLINATION BIOLOGY OF THE CYCLOCEPHALA SEXPUNCTATA SPECIES COMPLEX (COLEOPTERA: SCARABAEIDAE: DYNASTINAE) A Thesis by Matthew Robert Moore Bachelor of Science, University of Nebraska-Lincoln, 2009 Submitted to the Department of Biological Sciences and the faculty of the Graduate School of Wichita State University in partial fulfillment of the requirements for the degree of Master of Science July 2011

2 Copyright 2011 by Matthew Robert Moore All Rights Reserved

3 DISENTANGLING THE PHENOTYPIC VARIATION AND POLLINATION BIOLOGY OF THE CYCLOCEPHALA SEXPUNCTATA SPECIES COMPLEX (COLEOPTERA: SCARABAEIDAE: DYNASTINAE) The following faculty members have examined the final copy of this thesis for form and content, and recommend that it be accepted in partial fulfillment of the requirement for the degree of Master of Science with a major in Biological Sciences. Mary Jameson, Committee Chair Bin Shuai, Committee Member Gregory Houseman, Committee Member Peer Moore-Jansen, Committee Member iii

4 DEDICATION To my parents and my dearest friends iv

5 "The most beautiful thing we can experience is the mysterious. It is the source of all true art and all science. He to whom this emotion is a stranger, who can no longer pause to wonder and stand rapt in awe, is as good as dead: his eyes are closed." Albert Einstein v

6 ACKNOWLEDMENTS I would like to thank my academic advisor, Mary Jameson, whose years of guidance, patience and enthusiasm have so positively influenced my development as a scientist and person. I would like to thank Brett Ratcliffe and Matt Paulsen of the University of Nebraska State Museum for their generous help with this project. Several others deserve credit for helping me along the way: Dr. Maxi Polihronakis, Dr. Bin Shuai and Dr. Karen Brown-Sullivan. Lastly, I am very grateful to the researchers at the Biofinity Project ( for their funding of this work. vi

7 ABSTRACT Researching cryptic biodiversity is an integrative process that uses a total evidence approach to identify population-level evolutionary lineages (species). Cryptic species of aroids have been discovered but the existence of cryptic pollinator species has not been addressed. The highly polymorphic scarab beetle, Cyclocephala sexpunctata, is a hypothesized pollinator of two cryptic aroid species. This research integrates detailed morphological data, spatial and distribution data, mitochondrial CO1 sequence data and host plant associations to test the hypothesis that cryptic species of Cyclocephala are visiting aroid flowers. Nine morphologically similar Cyclocephala species were included to address identification problems among similar species. A new country record was found for C. pan (Honduras). A female paratype specimen of C. letiranti was determined to be a female C. sexpunctata raising the possibility that there are no female type specimens of C. letiranti. Four unique male paramere forms (morphotypes) were found in C. sexpunctata and the allied species C. brevis. These paramere forms were associated with four female morphotypes that have a diagnostic form of the ventral surface of the epipleural pillow. The ventral form of the female epipleural pillow is described here for the first time and is a new character for the genus Cyclocephala. Detailed elevational and distribution data indicate that the morphotypes of C. sexpunctata and C. brevis are rarely collected together at specific localities. A checklist of cyclocephaline floral associations was compiled. Examination of voucher specimens and published floral associations indicate that the morphotypes described here visit different species of flowers within their hypothesized elevational range. Mitochondrial CO1 data demonstrate that C. sexpunctata is polyphyletic but the monophyly of C. brevis could not be addressed. The combination of these datasets indicates that the morphotypes described here are cryptic species though their taxonomy remains unresolved due to large numbers of synonyms. vii

8 TABLE OF CONTENTS Chapter Page 1. INTRODUCTION Introduction Questions and Significance 2 2. BACKGROUND The genus Cyclocephala Variation in Species-level Diagnostic Characters Variation and Diagnosability of C. sexpunctata, C. brevis and Morphologically Allied Species 5 3. MATERIALS AND METHODS Taxa Selection Morphological and Distribution Data Scoring Maculae Phenotypes Molecular Methods DNA Extraction Mitochondrial CO1 Amplification Purification, Sequencing and Contig Assembly Alignment and Parsimony Analysis Checklist of Floral Associations for the Cyclocephalini RESULTS AND DISCUSSION Taxa Selection and Specimen Acquisition Taxa Selection Specimen Acquisition Discussion The Morphology and Distribution of Morphotypes Morphotype Morphotype Morphotype Morphotype Sympatry of the Morphotypes Discussion Maculae Phenotypes Morphotype Morphotype Morphotype Morphotype Discussion Molecular Relationships Discussion Checklist of Floral Associations for the Cyclocephalini Discussion CONCLUSIONS 83 viii

9 TABLE OF CONTENTS (continued) Chapter Page REFERENCES 87 APPENDICES Molecular Voucher Specimen and Sequence Data Mitochondrial CO1 Alignment Checklist of Floral Associations for the Cyclocephalini 121 ix

10 LIST OF TABLES Table Page 1. Taxonomic history of C. sexpunctata Taxonomic history of C. brevis Primers for CO1 amplification CO1 sequences from NCBI Cyclocephala species of the C. sexpunctata species group examined during this study Private and institutional collections providing loaned material Elevational distribution of morphotype Elevational distribution of morphotype Elevational distribution of morphotype Elevational distribution of morphotype Localities of sympatry between morphotypes Cyclocephaline synonyms reported in floral association literature Unresolved cyclocephaline names reported in floral association literature Plant synonyms reported in floral association literature Manuscript names and unresolved plant names reported in floral association literature Generic level summary of cyclocephaline floral associations based on most specific data Host plant data for the C. sexpunctata species complex. 78 x

11 LIST OF FIGURES Figure Page 1. Dorsal maculae of C. sexpunctata Ventral view of female epipleural flange of C. letiranti from Costa Rica, Puntarenas (Monte Verde Forest Reserve) Lateral view of female epipleural flange of C. letiranti from Costa Rica, Puntarenas (Monte Verde Forest Reserve) Dorsal habitus of morphotype 1 female and male Caudal view of parameres of a Morphotype 1 male from El Salvador, Ahuachapán (Parque Nacional El Imposible, Cancha San Benito) Lateral view of parameres of a Morphotype 1 male from El Salvador, Ahuachapán (Parque Nacional El Imposible, Cancha San Benito) Caudal view of parameres of a morphotype 1 male from Mexico, Chiapas (Finca Irlanda) Lateral view of parameres of a morphotype 1 male from Mexico, Chiapas (Finca Irlanda) Ventral view of female epipleural flange of morphotype 1 from Honduras, Yoro (Sinai, 5.3 km NW of Sn. Fco. Campo) Ventral view of female epipleural flange of morphotype 1 from Honduras, Yoro (Pico Pijol National Park) Lateral view of female epipleural flange of morphotype 1 from Honduras, Yoro (Sinai, 5.3 km NW of Sn. Fco. Campo) Ventral form of female epipleural pillow of morphotype 1 from Honduras, Yoro (Sinai, 5.3 km NW of Sn. Fco. Campo) The distribution of morphotype 1 in Mexico, Guatemala, Honduras and El Salvador Dorsal habitus of morphotype 2 female and male Caudal view of parameres of a morphotype 2 male from Costa Rica, Guanacaste (Rio San Lorenzo, R. F. Cord., Tenorio) lateral view of parameres of a morphotype 2 male from Costa Rica, Guanacaste (Rio San Lorenzo, R. F. Cord., Tenorio) Caudal view of parameres of a morphotype 2 male from Costa Rica, Puntarenas (Est. La Casona Res. Biol. Monteverde). 31 xi

12 LIST OF FIGURES (continued) Figure Page 18. Lateral view of parameres of a morphotype 2 male from Costa Rica, Puntarenas (Est. La Casona Res. Biol. Monteverde) Ventral view of female epipleural flange of morphotype 2 from Costa Rica, Puntarenas (Monteverde Forest Reserve) Ventral view of female epipleural flange of morphotype 2 from Panama, Chiriquí (Santa Clara) Lateral view of female epipleural flange of morphotype 2 from Panama, Chiriquí (Finca La Suiza, 5.3 km N. Los Planes) Ventral form of female epipleural pillow of morphotype 2 from Costa Rica, Puntarenas (Monteverde Forest Reserve) The distribution of morphotype 2 in Costa Rica and Panama Dorsal habitus of morphotype 3 female and male Caudal view of parameres of a morphotype 3 male from Ecuador, Pichincha (Maquipucuna For. Res., 50 km NW Quito) Lateral view of parameres of a morphotype 3 male from Ecuador, Pichincha (Maquipucuna For. Res., 50 km NW Quito) Caudal view of parameres of a morphotype 3 male from Nicaragua, Jinotega (Cerro Kilambé, Camp 6-Las Torres) Lateral view of parameres of a morphotype 3 male from Nicaragua, Jinotega (Cerro Kilambé, Camp 6-Las Torres) Ventral view of female epipleural flange morphotype 3 from Costa Rica, Guanacaste (Est. Pitilla, 9 km S Santa Cecilia, P.N. Guanacaste) Ventral view of female epipleural flange of morphotype 3 from Costa Rica, Puntarenas (Est. Sirena, Corcovado N.P.) Lateral view of female epipleural flange of morphotype 3 from Costa Rica, Puntarenas (Est. Sirena, Corcovado N.P.) Ventral form of female epipleural pillow of morphotype 3 from Costa Rica, Puntarenas (San Vito, Las Cruces) Ventral form of female epipleural pillow of morphotype 3 from Costa Rica, Puntarenas (Est. Sirena, Corcovado N.P). 40 xii

13 LIST OF FIGURES (continued) Figure Page 34. Caudal view of parameres of a morphotype 3 male from Venezuela, Aragua (Parque Nacional Henri Pittier) Lateral view of parameres of a morphotype 3 male from Venezuela, Aragua (Parque Nacional Henri Pittier) Ventral view of female epipleural flange of morphotype 3 from Venezuela, Aragua (Parque Nacional Henri Pittier) Ventral form of female epipleural pillow of morphotype 3 from Venezuela, Aragua (Parque Nacional Henri Pittier) The distribution of morphotype 3 in Honduras, Nicaragua and Costa Rica The distribution of morphotype 3 in Colombia, Ecuador, Brazil, Suriname and Venezuela Dorsal habitus of morphotype 4 female and male Caudal view of parameres of a morphotype 4 male from Panama, Former Canal Zone (Madden Forest Preserve) Lateral view of parameres of a morphotype 4 male from Panama, Former Canal Zone (Madden Forest Preserve) Caudal view of parameres of a morphotype 4 male from Costa Rica, Limón (Manzanillo, RNFS Grandoca y Manzanillo) Lateral view of parameres of a morphotype 4 male from Costa Rica, Limón (Manzanillo, RNFS Grandoca y Manzanillo) Ventral view of female epipleural flange of morphotype 4 from Panama, Former Canal Zone (Barro Colorado Island) Ventral view of female epipleural flange of morphotype 4 from Panama, Panama (El llano-carti Rd., km 8) Lateral view of female epipleural flange of morphotype 4 from Panama, Panama (El llano-carti Rd., km 8) Ventral form of female epipleural pillow of morphotype 4 from Panama (Barro Colorado Island). 49 xiii

14 LIST OF FIGURES (continued) Figure Page 49. Ventral form of female epipleural pillow of morphotype 4 from Costa Rica, Puntarenas (Buenos Aires, La Amistad, Sector Altamira) The distribution morphotype 4 in Costa Rica, Panama and Colombia Mating scarab beetles (Cyclocephala colasi) on the sterile male florets of Philodendron solimoesense in French Guiana. Arrow indicates position of male protarsal claw and female epipleuron. From Photo credited to R. Seymour Ventral form of female epipleural pillow of C. brittoni from Panama, Former Canal Zone (Skunk Hollow) Ventral form of female epipleural pillow of C. tutilina from Venezuela, Aragua (Henri Pittier National Park) Maculae phenotypes of morphotype Frequency of dorsal maculae phenotypes in morphotype Maculae phenotypes of morphotype Frequency of dorsal maculae phenotypes in morphotype Maculae phenotypes in morphotype Frequency of dorsal maculae phenotypes in morphotype Maculae phenotypes in morphotype Frequency of dorsal maculae phenotypes in morphotype One of nine equally parsimonious trees generated from CO1 sequence data Strict consensus tree generated from nine equally parsimonious trees. 68 xiv

15 LIST OF ABBREVIATIONS bp C Base pairs Celsius CO1 Mitochondrial Cytochrome Oxidase Subunit 1 EtBr μl μm μm ml mm mm M PCR QV rpm sp. spp. TBE UV V w/v Ethidium Bromide Microliter Micrometer Micromolar Milliliter Millimeter Millimolar Molar Polymerase Chain Reaction Quality value Rotations per minute Species Species (multiple) Tris/Borate/EDTA Ultraviolet Volt Weight/volume xv

16 LIST OF SYMBOLS & and Degree μ Micro % Percent Prime xvi

17 CHAPTER 1 INTRODUCTION 1.1 Introduction Cryptic species are two or more species classified as a single nominal species because they are superficially indistinguishable (Bickford et al. 2006). Researching cryptic biodiversity is an integrative process that uses a total evidence approach to identify population-level evolutionary lineages (species). Diverse data sets combining detailed examination of morphological characters (especially sexual structures), behavioral and ecological observations, distributional data and molecular data have been used to discover cryptic species diversity (Smith et al. 2000; Blair et al. 2005; Marsteller et al. 2009). Discovery of cryptic species elucidates patterns of geographic models of speciation, morphological evolution and ecological specialization in diverse taxonomic groups (Smith et al. 2000; Blair et al. 2005; Marsteller et al. 2009). Investigation and discovery of cryptic species has challenged interpretations of specialization and generalism between various insect and host plant taxa. Fig wasps (Agaonidae) and their fig hosts (Ficus spp.) were believed to constitute one of the tightest known pollination mutualisms, with each fig species being pollinated by one wasp species. Molecular data indicate that this assumption is often incorrect and that there are many lineages (species) of fig wasps that pollinate single fig species (Molbo et al. 2003). Conversely, similar data sets have shown that insect species considered generalists are cryptic complexes of specialists (Blair et al. 2005). Flowers of the basal angiosperm family Araceae are visited by taxonomically diverse assemblages of insects in the Neotropics. Nocturnal scarab beetles of the tribe Cyclocephalini (Scarabaeidae: Dynastinae) are hypothesized pollinators of several Neotropical Araceae genera. Pollination mutualism is particularly well documented between cyclocephalines and the Araceae genera Dieffenbachia Schott, Montrichardia H. Crüger, Philodendron Schott and Xanthosoma Schott (Young 1986; Goldwasser 1987; Gibernau et al. 2000; Gibernau et al. 2003). Cyclocephaline visitors of these 1

18 thermogenic aroid genera are offered an array of rewards including food sources in the form of sterile flowers, mating aggregation sites and elevated body temperatures (Young 1986; Goldwasser 1987; Seymour et al. 2009). Cyclocephalines are generalist floral visitors and the factors determining which beetle species visit which aroid species are poorly understood. Differences in floral scent, the relative timing of thermogenesis and anthesis and canopy stratification of aroid flowers have been hypothesized to determine the spectrum of cyclocephaline visitors (Young 1986; Schatz 1990; Beath 1999; García- Robledo et al. 2005). Geographic variation in cyclocephaline floral visitation has been documented in the genera Dieffenbachia and Xanthosoma (Beath 1999; García-Robledo et al. 2005). The geographic variation of floral visitor communities on Dieffenbachia longispatha Engl. & K. Krause discovered by Beath (1999) at La Selva (Costa Rica) and Barro Colorado Island (Panama) were later expanded by Croat (2004). Croat (2004) confirmed that the geographic differences in the spectrum of floral visitors were due to existence of cryptic Dieffenbachia species with different elevational distributions. 1.2 Questions and Significance The highly polymorphic species Cyclocephala sexpunctata Laporte, 1840 is a visitor of these cryptic Dieffenbachia species (Beath 1999; Croat 2004). Across its distribution C. sexpunctata has been reported from the aroid genera Philodendron and Xanthosoma and the palm genus Socratea H. Karst. A second polymorphic species, Cyclocephala brevis Höhne, 1847, is nearly identical to C. sexpunctata. Cyclocephala sexpunctata and C. brevis are sympatric at some localities but are hypothesized to have different elevational distributions (Ratcliffe 2003). The data of Beath (1999) and Croat (2004) are complicated by the observation that C. sexpunctata does not occur at La Selva or Barro Colorado Island (Ratcliffe 2003). The existence of cryptic Dieffenbachia species raises the possibility that their floral visitors may also be cryptic species though this has not been addressed. This research takes an integrated approach to test the hypothesis that cryptic Cyclocephala Dejean, 1821 species are involved in aroid visitation and potentially their pollination. The suitability of diverse methods to explore the existence of cryptic cyclocephaline scarab species has not been evaluated. 2

19 Evidence for cryptic species will be weighed by integrating detailed morphological study, spatial and distribution data, host plant associations and molecular data to address whether: 1) Monophyletic lineages (species) can be circumscribed based on morphological and phenotypic data. 2) Monophyletic lineages (species) can be circumscribed based on spatial analyses and the distribution of corroborative host plant associations. 3) Monophyletic lineages can be circumscribed using DNA sequence data. 4) The tools identified in 1-3 can be used to diagnose cryptic species of Cyclocephala. The outcomes of this research are significant for many reasons. Female sexual characters in the Cyclocephalini are poorly understood. Close examination of female characters in morphologically similar species will provide a framework for their further study and provide insights into their biological function. There exists almost no DNA sequence data for the Cyclocephalini and data generated here can be used in future analyses. DNA barcode sequences from the Cyclocephalini, particularly in Cyclocephala, offer an opportunity to preliminarily investigate whether this is a useful tool for identifying speciation events in this genus. The spatial factors that determine host plant associations in Cyclocephala species are obscure. Pollination mutualism between species having similar elevational tolerances has not been considered in explaining patterns of floral visitation in cyclocephalines. There are other variable Cyclocephala species that have been reported from flowers and this research will create a foundation for evaluating the biological meaning of variability in male and female sexual characters. 3

20 CHAPTER 2 BACKGROUND 2.1 The Genus Cyclocephala Cyclocephala is a large genus (~335 species) that ranges from southeastern Canada south to Argentina and the West Indies (Ratcliffe 2003; Ratcliffe and Cave 2006). Species diversity within Cyclocephala is concentrated in the Neotropics (Ratcliffe 2003; Ratcliffe and Cave 2006). Adult Cyclocephala are typically nocturnal or crepuscular and the few larvae described feed on grass roots and organic matter in soil (Ratcliffe 2003; Ratcliffe and Cave 2006; Stechauner-Rohringer and Pardo-Locarno 2010). One exception to this is a collection record of larvae and pupae of Cyclocephala dilatata (Prell, 1934) from petiole tissue of a palm in French Guiana (Ponchel 2006). Adults of many Cyclocephala species are known visitors of flowers and inflorescences of several plant families (Morón 1997; Morón et al. 1997; Gottsberger 1988; Ratcliffe 2003; Ratcliffe and Cave 2006). There are currently no phylogenetic hypotheses for species relationships within Cyclocephala and the monophyly of the genus has not been addressed (Ratcliffe 2003). Cyclocephala is currently characterized by a clypeus with sides always converging to a rounded, parabolic, subtruncate or emarginated apex; antennae with 8-10 segments; maxilla with distinct teeth; and sexually dimorphic protarsal claws (males with medial claw enlarged and females with both claws simple) (Ratcliffe 2003; Ratcliffe and Cave 2006). The cyclocephaline genera Ancognatha Erichson, 1847, Aspidolea Bates, 1888 and Mimeoma Casey, 1915 show overlap in some generic-level characters with Cyclocephala thus creating the potential for paraphyly or polyphyly within the genus (Ratcliffe 2003). Without a phylogenetic framework, patterns of character evolution within Cyclocephala are necessarily obscure. Based on monographic treatments including Cyclocephala there appears to be a general model for diagnosing externally similar species (Endrödi 1985; Ratcliffe 2003; Ratcliffe and Cave 2006). Characters such as the shape of the apex of the clypeus, shape and arrangement of dorsal maculae, presence/absence of dorsal patches of setae, presence/absence of a pronotal basal bead and the 4

21 arrangement of teeth on the protibia can be used to phenetically group species. Cyclocephala species have been identified primarily by unique, diagnostic form of the male genitalia and the form of the female epipleuron. Similar male (genitalia) and female (shape and relative position of dilations on elytral epipleuron) species-level diagnostic characters have been described from other cyclocephaline genera, particularly Ancognatha, Arriguttia Martínez, 1960, Aspidolea, Augoderia Burmeister, 1847, Chalepides Casey, 1915, Dyscinetus Harold1869, Mimeoma, Peltonotus Burmeister, 1847 and Surutu Martinez, 1955 (Endrödi 1985; Ratcliffe 2003; Jameson and Wada 2004; Ratcliffe and Cave 2006). 2.2 Variation in Species-level Diagnostic Characters Some Cyclocephala species exhibit intraspecific variation in patterns of dorsal maculae and sexual characters. Dramatic examples of intraspecific variation in maculae patterns can be observed in large samples of many Cyclocephala species (Endrödi 1966). García-Luna et al. (2002) documented variation in dorsal maculae for three species of Cyclocephala: C. complanata Burmeister, 1847, C. mafaffa Burmeister, 1847 and C. sexpunctata. Two of these species, C mafaffa and C. sexpunctata, are known to have variable male genitalia though correlations between dorsal maculae and genital morphs have not been addressed (García-Luna et al. 2002). 2.3 Variation and Diagnosability of C. sexpunctata, C. brevis and Morphologically Allied Species Cyclocephala sexpunctata and C. brevis are two taxa illustrative of the intra-specific variation observed in some Cyclocephala species. Cyclocephala sexpunctata and C. brevis have overlapping distributions occurring from Mexico to Brazil and west into Ecuador (Endrödi 1985; Ratcliffe 2003; Ratcliffe and Cave 2006). Adult emergence is concentrated in the first half of the wet season and adults can be collected in lowland broadleaf rainforests (~sea level) up to montane broadleaf forests (700 m and up) (Ratcliffe 2003; Ratcliffe and Cave 2006). These two morphologically similar species are defined by traits that seemingly vary along altitudinal gradients (Ratcliffe 2003). Cyclocephala brevis is considered a low-land form, characterized by smaller body size, straighter male parameres and relatively less melanic elytra compared to C. sexpunctata (Ratcliffe 2003). Cyclocephala sexpunctata is considered a high altitude form, characterized by larger body size, more bent male parameres and relatively more melanic 5

22 elytra compared to C. brevis (Ratcliffe 2003). C. sexpunctata and C. brevis, as well as C. tutilina Burmeister, 1847 are reliably diagnosable only by the following set of male characters: The parameres of C. sexpunctata and C. tutilina are distinctly bent for their entire length and remain thick to the apex, whereas those of C. brevis are nearly straight in their apical half and with a slender apex. In caudal view, the apices of all three species are subtriangular but are broadly rounded to nearly blunt in C. sexpunctata and C. tutilina and narrowly rounded to almost pointed or narrow and elongated with an elongated, subtriangular apex in C. brevis (Ratcliffe and Cave 2006). In Honduras, Nicaragua and El Salvador C. sexpunctata tends to be of larger size as well as having larger elytral maculae than C. brevis (Ratcliffe and Cave 2006). Diagnostic differences in body and maculae size have been proposed for sympatric populations of C. sexpunctata and C. brevis occurring at Hartmann s Finca in Chiriquí, Panama (Ratcliffe 2003). A particularly interesting pattern in this variation is the presence of additional pronotal maculae in C. sexpunctata (a dark morph) populations occurring from Mexico to Honduras and in Venezuela. This trait is mostly lacking in Costa Rican and Panamanian populations (Ratcliffe 2003; Ratcliffe and Cave 2006). The distribution this dark morph has created taxonomic confusion and has been treated differently by various authors (Tab 1; Tab 2). In his monographic works, Endrӧdi (1966) referred to this dark morph only as an aberration. This particular form was described as a separate species, C. lucida Burmeister, 1847, and C. lucida was later considered to be a synonym of C. sexpunctata (Ratcliffe 2003). Casey (1915) described several species that have subsequently been synonymized with Cyclocephala sexpunctata. Casey s (1915) species concepts were based primarily on differences in dorsal maculae pattern, and he did not discuss male genitalia or female sexual characteristics. 6

23 TABLE 1 TAXONOMIC HISTORY OF C. SEXPUNCTATA Taxonomy (from Ratcliffe 2003 and Krajcik 2005) Cyclocephala sexpunctata Laporte, syn. Cyclocephala pubescens Erichson, syn. Cyclocephala lucida Burmeister, syn. Cyclocephala sexpunctata spermophila Ohaus, syn. Stigmalia triangulifer Casey, syn. Stigmalia discoidalis Casey, syn. Stigmalia costaricana Casey, syn. Stigmalia circulifer Casey, syn. Cyclocephala pubescens nigripes Höhne, 1923 Type Locality (from Krajcik 2005) French Guiana (Cayenne) Peru Mexico Colombia, Ecuador Mexico (Guerrero) Mexico (Jalapa) Chiriquí Mexico (Guerrero) Central America TABLE 2 TAXONOMIC HISTORY OF C. BREVIS Taxonomy (from Ratcliffe 2003 and Krajcik 2005) Cyclocephala brevis Höhne, hom. Cyclocephala pubescens Burmeister, syn. Cyclocephala pubescens brevis Höhne, 1923 Type Locality (from Krajcik 2005) Peru Peru 7

24 CHAPTER 3 MATERIALS AND METHODS 3.1 Taxa Selection No phylogeny is presently available for the genus Cyclocephala and the monophyly of the genus is in question (Ratcliffe 2003; Ratcliffe and Cave 2006). It is therefore only possible to approximate species relationships based on expert opinion and monographic treatments of the genus Cyclocephala. Ideally, the taxa included in this study should be closely allied to C. sexpunctata and C. brevis to root molecular analyses and offer a basis to compare intra- and interspecific morphological variation in these species. Taxa were selected for inclusion in this study based on the following set of characters: clypeus with apex distinctly emarginate, dorsal surface at least partially setose (especially frons, anterior angles of pronotum and elytra); pronotum on base without marginal bead, dorsal color testaceous or reddish-brown, presence of 6-8 elytral maculae; males with protibia tridentate with the basal tooth small and removed from the apical teeth and; the general lance-like form of the male parameres (especially presence of a baso-ventral process or swelling) (Ratcliffe 2003; Ratcliffe and Cave 2006; Brett Ratcliffe, pers. comm., May 2009). Geographic distribution of Cyclocephala species was also considered. Species selected for study have distributions from southern Mexico south to northern South America. 3.2 Morphological and Distribution Data The form of the parameres of the male genitalia in dynastine scarabs is, with few exceptions, diagnostic for species-level identification (Ratcliffe 2003). Every male specimen of C. sexpunctata and C. brevis was dissected and the male genitalia were extracted by the following procedure: 1) the middle and hind legs were pushed away from the sternites of the abdomen using forceps, 2) the membrane at the base of the first abdominal sternite was broken, 3) the abdomen was removed from the specimen 4) the genitalia were removed from the abdomen and placed using water-soluble glue onto archival mounting points, and 5) the abdomen was placed back onto the specimen using water-soluble glue. Males were 8

25 sorted initially into morphotypes by the form of their parameres. Characters used to group male morphotypes included the shape of the apex of the parameres in caudal view (broadly rounded and blunt, broadly rounded and elongate or sub-triangular and pointed), the degree of deflection of the apex of the parameres (straight or deflexed downward) and the degree of the production of the basal tooth. Females were initially associated with males by locality data. The form of the female epipleuron in many cyclocephalines, and especially Cyclocephala, are diagnostic for species-level identification, but characters associated with the epipleuron have not been quantified or investigated (Ratcliffe 2003). For some scarab groups (e.g., Chrysina Kirby, 1827 and Cyclocephala) the epipleural expansion is important for mating. Females initially sorted with male morphotypes were examined in ventral and lateral view for variation in the epipleural flange. A subsample of females was examined for the ventral structure of the epipleural pillow (the ventral form of the expansion). The left elytron was dissected by the following procedure: 1) the specimen was softened by placement in hot, soapy water for several minutes, 2) the left elytron was removed by popping the elytral articulation from the thorax, 3) the elytron was allowed to dry, and 4) was placed using water-soluble glue onto archival mounting points. The phylogenetic species concept of Wheeler and Platnick (2000) was applied herein: A species is the smallest aggregation of (sexual) populations or (asexual) lineages diagnosable by a unique combination of character states. The morphotypes (species lineages) characterized in this work are recognized by combined characters of the shape of the male parameres in lateral view, the shape of the apex of the parameres, degree of production of the baso-ventral tooth, the shape and position of the female epipleural flange and the ventral form of the female epipleural pillow. Body size was measured from the apex of pronotum to the apex of the elytra using calipers (Swiss Precision Instruments, Inc., SPI 2000). Images of specimens and structures were captured using Automontage by Synchroscopy (Synoptics Inc.). Images were edited in Adobe Photoshop CS2 (Adobe Systems Inc.). 9

26 Label data were used to generate detailed distribution maps of morphotypes. It was necessary to reference external sources in cases that labels did not include latitude and longitude data. Referenced publications included gazetteers and other taxonomic papers that reported identical or very similar locality data to that associated with specimens observed in this study (Global Gazetteer Version 2.2; Armbruster et al. 1992; Campbell and Smith 2000; Ratcliffe 2003; Ratcliffe and Cave 2006). Latitude and longitude data were approximated when these data could not be determined from labels or an external reference. These data were approximated using Google Earth by the following procedure: 1) a city or otherwise identifiable location indicated on a label was found on Google Earth, 2) if distance measures were given (e.g., 5 km east of Purulhá) a straight line was drawn from the locality and the end-point data was used for mapping. 134 specimens had latitude, longitude and/or elevational data generated using Google Earth. Latitiude and longitude coordinates were entered into Excel 2007 (Microsoft Inc.) spreadsheets and converted to KML format in Earth Point (Google Inc.) for mapping in Google Earth (Google Inc.). Localities above 1000 m were considered high-elevation and localities below 900 m were considered low- to mid-elevation. 3.3 Scoring Maculae Phenotypes Specimens of C. sexpunctata and C. brevis that had been assigned to morphotypes (based on male and female morphology) were scored for unique maculae patterns. Cyclocephala sexpunctata and C. brevis often have maculae on the pronotum and 4 maculae on the elytra (Fig. 1). Pronotal Macula Basal Medial Macula Basal Lateral Macula Apical Lateral Macula Apical Medial Macula Figure 1. Dorsal maculae of C. sexpunctata. 10

27 Pronotal maculae were scored as either present or absent. Elytral maculae were scored as present, absent or variably continuous. This was accomplished without magnification. Maculae that could not be detected with the naked eye were considered absent. Unique combinations of maculae presence, absence and contiguousness constituted the phenotypes. The relative size of maculae was not considered when scoring phenotypes. Phenotypes were then counted to determine their relative frequency in the sample. 3.4 Molecular Methods DNA Extraction Tissue samples were taken from the coxal cavites of specimens preserved in alcohol and placed in sterile 1.5 ml Eppendorf tubes. Alcohol was allowed to evaporate entirely at room temperature. 10 μl of Proteinase K (Roche Applied Science) and 80 μl of Chelex (5% w/v) (BioRad) solution were added to each tube, briefly vortexed and centrifuged until tissue samples were immersed in the extraction solution. Samples were incubated at 55 C for 1 hour and then at 90 C for 8 minutes. Samples were then vortexed for one minute and centrifuged at 13,200 rpm. 70 μl of the resulting supernatant was transferred to a second sterile tube and stored at -80 C for use as template DNA in later reactions. The procedure was the same for pinned specimens except that DNA was extracted from manually pulverized metatarsi. DNA extractions performed on pinned specimens were precipitated using 3 volumes of 100% ethanol and 1/10 volume of 3 M sodium acetate. This mixture was incubated overnight in a -20 C freezer. Extractions were centrifuged for one hour at 13,200 rpm and the supernatant discarded. The resulting DNA pellet was washed with 70% ethanol, stored at -20 C and centrifuged for one hour at 13,200 rpm and the supernatant discarded. Any remaining ethanol was allowed to dry and the resulting DNA pellet was resuspended with Tris buffer (ph 8) at half the volume of the original extraction CO1 Amplification Mitochondrial Cytochrome Oxidase Subunit 1 was amplified using the primers C1-J-1751 (Ron)/TL2-N-3014 (Pat) and C1-J-2183 (Jerry)/TL2-N-3014 (Pat) (Tab. 3) (Simon et al. 1994). Predicted amplicon length for the primers Ron and Pat was approximately 1200 bp (Simon et al. 1994). Predicted amplicon length for the primers Jerry and Pat was approximately 800 bp (Simon et al. 1994). PCR 11

28 reactions were set up using Ex Taq PCR Kits (Takara). Individual 25 μl PCR reactions using the primers Ron and Pat were composed of 4μl of template DNA, 1.25 units of Ex Taq, 0.5 μm of each primer, 0.2 mm dntps, 1 mm Tris-HCl, 50 mm KCl, 2 mm MgCl 2 and millipore H 2 O used to fill out reaction volume. Individual 25 μl PCR reactions using the primers Jerry and Pat were composed of 4μl of template DNA, 1.25 units of Ex Taq, 0.5 μm of each primer, 0.2 mm dntps, 1 mm Tris-HCl, 50 mm KCl, 1.5 mm MgCl 2 and millipore H 2 O used to fill out reaction volume. The thermal cycle for the primers Ron and Pat was as follows: 1) initial denaturation step of 94 C for 2 minutes, 2) 35 cycles of 94 C for 30 seconds, 55 C for 30 seconds and 72 C for 2 minutes and 3) a final extension of 72 C for 5 minutes (pers. comm. with M. Polihronakis). The thermal cycle for the primers Ron and Pat was as follows: 1) initial denaturation step of 94 C for 2 minutes, 2) 35 cycles of 94 C for 30 seconds, 50 C for 30 seconds and 72 C for 45 seconds and 3) a final extension of 72 C for 2 minutes. TABLE 3 PRIMERS FOR CO1 AMPLIFICATION Primer Sequence C1-J-1751 (Ron) (Forward) 5 GGATCACCTGATATAGCATTYCC 3 C1-J-2183 (Jerry) (Forward) 5 CAACATTTATTTTGATTTTTTGG 3 TL2-N-3014 (Pat) (Reverse) 5 TCCAATGCACTAATCTGCCATATTA PCR Product Purification and Sequencing PCR products were run through 1% agarose TBE gels at 100 V for one hour. Gels were stained by immersion in diluted EtBr for one hour. Stained gels were visualized under UV light and PCR products of the predicted length were extracted from gels. PCR products were purified and prepared for sequencing using a Geneclean Kit (MP Biomedicals) per kit specifications for TBE gels. Purified PCR products were split into two 10 μl aliquots. 2 μl of the appropriate 10 μm primer stock was added to these aliquots for forward and reverse sequencing. Samples were directly sequenced at San Diego State University s CSUPERB Microchemical Core Facility. 12

29 3.4.4 Contig Assembly, Sequence Alignment and Parsimony Analysis Sequence contigs were assembled using the program DNA Baser v Chromatogram files were imported into DNA Baser and assembled into contigs using the assembler engine with 20 base word size, 80 % sample identity and 25 base minimum overlap. Ends were trimmed until there were 75% good bases in an 18 base window (good bases have a QV higher than 25). Out group taxa sequences from the scarab subfamilies Rutelinae and Melolonthinae were downloaded from The National Center for Biotechnology Information (NCBI) ( (Tab. 4). Sequences were aligned in ClustalW (Thompson et al. 1994) using a full sequence alignment with 1000 bootstrap replicates. The ends of the resulting sequence alignment were trimmed to create a rectangular matrix. The resulting matrix was analyzed using parsimony in PAUP (Swofford 1991). The matrix was analyzed using the branch and bound method with 10,000 max trees with upper bound computed via stepwise, multrees and only saving minimal trees. Character support for the strict consensus tree was measured by the full heuristic bootstrap method with 100 replicates starting at random seed TABLE 4 CO1 SEQUENCES FROM NCBI Taxa Phyllophaga hirticula (Knoch) (Scarabaeidae: Melolonthinae) Phyllophaga profunda (Blanchard) (Scarabaeidae: Melolonthinae) Phyllophaga balia (Say) (Scarabaeidae: Melolonthinae) Phyllophaga bipartita (Horn) (Scarabaeidae: Melolonthinae) Phyllopertha horticola (L.) (Scarabaeidae: Rutelinae) Accession GQ GQ GQ GQ DQ Checklist of Floral Associations for the Cyclocephalini Published occurrences of cyclocephaline floral associations are numerous, having been reported in journals, books and monographs since the late 18 th century. The prevalence, geographic scope and biological importance of these records are difficult to gauge because there is no contemporary, concise review of inflorescence associations for the Cyclocephalini. Botanical publications summarizing 13

30 cyclocephaline floral visitation are available though these are somewhat dated and report pollination records limited to specific plant families, geographic areas or vegetation types (Henderson 1986; Gibernau 2003; Gottsberger and Silberbauer-Gottsberger 2006). The fragmentary nature of these types of data and the widespread citation of unpublished observations have hampered the ability to indentify floral association trends within the Cyclocephalini. Compilation and synthesis of a checklist of floral associations for the tribe is needed in order to understand ecological and evolutionary patterns within the group. The compiled checklist was designed with specific intent to: 1) summarize ecological data for the adult beetles of C. sexpunctata and C. brevis for the purposes of this study; 2) identify and correct invalid taxonomy in the surveyed literature and; 3) aid researchers by providing an easily accessible, comprehensive data set on the taxonomic and geographic scope of floral associations for the tribe. All reported cyclocephaline species names were verified by referencing the original species description and monographic treatments of the Dynastinae (Endrödi 1985; Ratcliffe 2003; Ratcliffe and Cave 2006). Synonyms or misspelled cyclocephaline species names were updated to reflect current taxonomy. All reported host plant names were verified using the peer-reviewed botanical taxonomic databases Tropicos ( and The Plant List ( Synonyms or misspelled plant names were updated to reflect current taxonomy. In some cases scientific names could not be verified as valid (e.g., possible manuscript names or conflicting synonyms). These unverified plant names were reported according to the original citation for the floral association and the name noted as unresolved (Tab. 4). Occasionally, host plant species and beetles were not assigned authorship in the reference for an association. This caused problems due to the prevalence of synonyms and homonyms in the plant and insect literature. Ambiguities caused by this practice were rectified to the extent possible and explained in the remarks column. Specimens of Cyclocephala species borrowed for this research allowed for direct and indirect evaluation of species level Cyclocephala identifications reported by several authors. Particularly, this included specimens of C. sexpunctata and C. brevis collected by George Schatz, Helen Young (La Selva Biological Station, Heredia, Costa Rica), Alberto Seres and Nelson Ramirez (Henri Pittier National Park, 14

31 Venezuela) with floral association data that were subsequently published or unpublished. Identifications of these specimens (or specimen vouchers) were critically examined. Exemplar material borrowed from the University of Nebraska State Museum (authoritatively identified by B. C. Ratcliffe) and monographic treatments (Ratcliffe 2003; Ratcliffe and Cave 2006) served as the basis for evaluating species identifications. An operating assumption of this evaluation was that the collectors and authors were consistent with their species level determinations. Identifications deemed incorrect based on current taxonomy were updated and noted accordingly. Concrete and anecdotal evidence of floral associations were equally included in the checklist. The nature of the published association occasionally needed clarification or elaboration (e.g., cyclocephalines reported near flowers but not on them or museum specimens covered in resin and pollen). These clarifications were provided in the remarks column. A relatively large amount of unpublished and inaccessible data exists with regards to cyclocephaline visitation of inflorescences. These inaccessible data sets are important because they report certain associations that are not recorded elsewhere in the literature. These records typically provide ambiguous data for plant species, cyclocephaline species and locality. For example, Schatz (1990; Table 7.3) recorded known and predicted (without distinguishing the two) plant taxa pollinated by dynastines in the Neotropics. Schatz (1990; Table 7.4) recorded cyclocephaline plant visitation at La Selva Biological Station, but a large amount of data could not be extracted because of the non-specific nature of the record (i.e., the data were reported at the tribal-level). Repetitive data from these types of records were omitted from the checklist. Only unique generic or species-level plant associations were reported for the beetle tribe from these data sets. These non-specific records are reported at the end the checklist (App. 3) with the intention that they be reevaluated with stronger data. 15

32 CHAPTER 4 RESULTS AND DISCUSSION 4.1 Taxa Selection and Specimen Acquisition Taxa Selection Nine morphologically similar Cyclocephala species were included in this study (see Taxa Selection, Chapter 2) (Tab. 5). All nine species fit the taxa selection criteria with the following exceptions: 1) Cyclocephala brittoni Endrödi, 1964 has a pronotal basal bead that is variably present or absent, 2) C. krombeini Endrödi, 1979 and C. kuntzeniana Höhne, 1923 have more than six elytral maculae, 3) C. letiranti Young, 1992 males occasionally have the basal tooth of the protibia reduced to a small protuberance and 4) C. zodion Ratcliffe, 1992 male parameres lack a distinct, baso-ventral tooth. These species were studied primarily because they present identification challenges throughout the distributional range C. sexpunctata and C. brevis. Together, these species are referred to as the C. sexpunctata species group. Together, C. sexpunctata and C. brevis (sensu Ratcliffe 2003; Ratcliffe and Cave 2006) are referred to as the C. sexpunctata species complex. TABLE 5 CYCLOCEPHALA SPECIES OF THE C. SEXPUNCTATA SPECIES GROUP EXAMINED DURING THIS STUDY Cyclocephala Species Number of Observed Specimens Cyclocephala brevis Höhne, syn. Cyclocephala pubescens Burmeister, syn. Cyclocephala pubescens brevis Höhne, 1923 Cyclocephala brittoni Endrödi, Cyclocephala krombeini Endrödi, syn. Cyclocephala rorschachoides Ratcliffe, 1992 Cyclocephala kuntzeniana Höhne, Cyclocephala letiranti Young, Cyclocephala pan Ratcliffe,

33 TABLE 5 (continued) Cyclocephala sexpunctata Laporte, syn. Cyclocephala pubescens Erichson, syn. Cyclocephala lucida Burmeister, syn. Stigmalia triangulifer Casey, syn. Stigmalia discoidalis Casey, syn. Stigmalia costaricana Casey, syn. Stigmalia circulifer Casey, syn. Cyclocephala pubescens nigripes Höhne, 1923 Cyclocephala tutilina Burmeister, syn. Cyclocephala venezuelae Arrow, 1911 Cyclocephala zodion Ratcliffe, Specimen Acquisition Study material was primarily obtained through loans from museums and private collections. Specimens from the following institutional and private collections were studied (Tab. 6). This study was based on the examination of 866 specimens of Cyclocephala from Mexico, Guatemala, Honduras, Nicaragua, El Salvador, Costa Rica, Panama, Colombia, Ecuador, Venezuela, Brazil and Suriname. Specimens identified as C. sexpunctata and C. brevis comprised 441 and 279 of these records, respectively (Tab. 5). TABLE 6 PRIVATE AND INSTITUIONAL COLLECTIONS PROVIDING LOANED MATERIAL EAPZ INBI MLJC SEMC UNSM USNM UVGC Escuela Agricola Panamericana, Zamorano, Honduras (Ron Cave) Instituto Nacional de Biodiversidad, Costa Rica, Santo Domingo de Heredia (Angel Solís) Mary Liz Jameson Collection, Wichita, KS Snow Entomological Museum, University of Kansas, Lawrence, KS (Zach Falin) University of Nebraska State Museum, Lincoln, NE (Brett Ratcliffe) U. S. National Museum, Washington, D.C. (Currently housed at the University of Nebraska State Museum for off-site enhancement) Universidad del Valle de Guatemala, Guatemala City, Guatemala (Enio Cano) 17

34 4.1.3 Discussion The majority (approximately 80 %) of specimens that comprised this study were identified to the species level, yet approximately 10 % were incorrectly identified due to misidentification or incorrect association of females with male counterparts. Factors contributing to misidentifications were small sample sizes at certain collecting localities, reliance on dorsal maculae patterning with out dissection of male genitalia, and incorrect association of female specimens with males. I have discovered a new female character (ventral form of the epipleural pillow, see next section) that is useful for species level identification in these species. Cyclocephala pan, which was previously known from Costa Rica, Panama and Guatemala, was found to occur in Honduras (NEW COUNTRY RECORD) (Ratcliffe 1992a; Ratcliffe 2003). This new country record for Honduras comprises 11 C. pan specimens from 4 localities. All eleven specimens are deposited at Escuela Agricola Panamericana, Zamorano, Honduras. HONDURAS. Atlántida. Parq. Nac. Pico Bonito, Cerro Miramar, 550 m. N W Augusto Cave, Cordero & Machado. (4 males, 3 females). HONDURAS. Atlántida. Parq. Nac. Pico Bonito, Rio Zacate, 35 m. N W Enero Cave, Cordero & Torres. (1 female). HONDURAS. Atlántida. 7.7 km S La Ceiba en camino a Yuruca, 60 m. N W Enero Cave, Cordero & Torres. (1 female). HONDURAS. Yoro. Parq. Nac. Pico Bonito, El Portillo, 640 m. N W Septiembre R. Cordero & J. Torres. (2 females). Cyclocephala pan will key out to couplet 29 in Ratcliffe and Cave s (2006) key to the adult male Cyclocephala of Honduras, Nicaragua and El Salvador. At couplet 29 both options lead to males with parameres with a triangular to elongate sub-triangular apices (C. brevis) or blunt sub-triangular apices (C. sexpunctata and C. tutilina in the next couplet). Male C. pan can be indentified at this couplet by having parameres with elongate rectangular apices (caudal view) and parameres distinctly bent in lateral view. Female C. pan will key out to couplet 16 in Ratcliffe and Cave s (2006) key to adult female Cyclocephala of Honduras, Nicaragua and El Salvador. 18

35 Couplet 16 separates species by body size and relative size of elytral maculae. Downstream, the couplets separate C. sexpunctata from C. tutilina and C. brevis from C. batesi Delgado and Castañeda, Cyclocephala pan falls in between the body size range given for couplet 16 and possesses variable elytral maculae. Female C. pan can be distinguished from females of these species by the unique form of the epipleron. Female C. pan have an epipleuron that is dilated between abdominal sternites 1 and 2 into a large flange produced at a right angle at its base from the elytral margin. In ventral view there is a small, distinct notch at the level of abdominal sternite 2. Cyclocephala letiranti was described from 7 specimens collected at Monte Verde Forest Reserve in Costa Rica (Young 1992). At this locality, C. letiranti is considered sympatric with C. sexpunctata (with which it is very similar morphologically) (Young 1992). The allotype female of C. letiranti (deposited at the University of Nebraska State Museum) is actually a female of C. sexpunctata (Ratcliffe 2003). I examined a female paratype specimen of C. letiranti Young (deposited at the Instituto Nacional de Biodiversidad, Costa Rica). Based on the diagnostic form of the female epipleuron, I determined it to be a female C. sexpunctata. This paratype specimen has the following label data: COSTA RICA: Puntarenas. Monte Verde Forest Res. V , 1500 m. B. Ratcliffe & M. Jameson. Based on these two misidentifications it is probable that there are no female type specimens of C. letiranti. Ratcliffe (2003) described the female epipleuron of C. letiranti but did not offer an image of this structure. Below the female epipleuron of C. letiranti is shown for the first time (Fig. 2; Fig. 3). Female C. letirani can be distinguished from female C. sexpunctata by having the epipleuron dilated into a large, broad flange that is widest at the apex of the metacoxa. The epipleural flange of C. sexpunctata is similar in shape but is smaller and is widest between abdominal sternites 1 and 2. 19

36 Figure 2. Ventral view of female epipleural flange of C. letiranti from Costa Rica, Puntarenas (Monte Verde Forest Reserve). Figure 3. Lateral view of female epipleural flange of C. letiranti from Costa Rica, Puntarenas (Monte Verde Forest Reserve). 20

37 4.2 THE MORPHOLOGY AND SPATIAL DISTRIBUTION OF MORPHOTYPES The current species concepts of C. sexpunctata and C. brevis sensu Ratcliffe (2003) and Ratcliffe and Cave 2006 encompass what I consider to be four morphotypes (herein referred to as morphotypes 1-4). Four male paramere morphologies were characterized. One of the paramere morphologies (see discussion of morphotype 1) increases the amount of variation circumscribed by Ratcliffe (2003) and Ratcliffe and Cave s (2006) concept of C. sexpunctata. Four distinct ventral morphologies of the female epipleural pillow were found in association with these male genitalia types. The ventral form of the epipleural pillow presented below has not been described previously and is a new, informative character for the genus Cyclocephala and for the tribe Cyclocephalini. For example, the differences in this structure between taxonomically unproblematic species indicate that this character has systematic significance for the genus Cyclocephala. Cyclocephala tutilina has been collected from flowers of the same Dieffenbachia species as morphotype 3 in Henri Pittier National Park (App. 3) (Seres and Ramirez 1995). The ventral form of the epipleural pillow in C. tutilina differs from morphotype 3 at this locality in that it is straight, long ridge (Fig. 53) rather than having two ridges with the medial ridge strong and straight and the lateral ridge weaker and angled (Fig. 37). This structure in C. brittoni (Fig. 52) is much different from the other pillows I have observed. The ventral form of the epipleural pillow in C. brittoni is distinctly swollen and raised with several small, wavy ridges oriented towards the base of the elytron (Fig. 52). There is certainly more diversity of form in this structure and it should be examined in more species of Cyclocephala and in the other genera of the Cyclocephalini. 21

38 4.2.1 MORPHOTYPE 1 DIAGNOSIS Morphotype 1 is separated from morphotypes 3 and 4 by having the pronotum with punctures sparse on disc and moderately dense on lateral portions. Body size ranging from mm. The most commonly observed maculae phenotype in morphotype 1 is different than the other morphotypes so it has some utility for identification. Examination of the male parameres is the most reliable way to identify males of morphotype 1. The parameres are thick along their length to the apex (Fig. 6; Fig. 8). The apex of the parameres is sub-triangular and blunt (Fig. 5; Fig. 7). The combination of these paramere characters distinguishes morphotype 1 fom morphotype 3 and 4. Parameres of this morphotype most closely resemble those of morphotype 2. The parameres remain straight to the apex in morphotype 1 while they are distinctly deflexed downward at the apex in morphotype 2. Females of morphotype 1 can be distinguished from morphotypes 2 and 3 by having the epipleuron (in ventral view) expanded into a broadly rounded flange at the level of abdominal sternites 1-2 (Fig. 9; Fig. 10). The ventral morphology of the epipleural pillow can be used to separate females of this morphotype from morphotypes 2 and 3. Morphotype 1females have a single ridge or fold, slightly curved for its length and distinctly removed from the elytral margin (Fig. 12). This ridge approaches the elytral margin in morphotype 3 and is straight in morphotype 4. The ventral form of the epipleural pillow is the same in morphotypes 1 and 2. Morphotype 1 females have the elytral flange slightly thickened in lateral view (Fig. 11) while it is distinctly thickened in morphotype 2. 22

39 Figure 4. Dorsal habitus of morphotype 1 female and male. Figure 5. Caudal view Figure 6. Lateral view Figures 5 6. Caudal and lateral views of parameres of a Morphotype 1 male from El Salvador, Ahuachapán (Parque Nacional El Imposible, Cancha San Benito). 23

40 Figure 7. Caudal View Figure 8. Lateral view Figures 7 8. Caudal and lateral views of parameres of a morphotype 1 male from Mexico, Chiapas (Finca Irlanda). Figure 9. Ventral view of female epipleural flange of morphotype 1 from Honduras, Yoro (Sinai, 5.3 km NW of Sn. Fco. Campo). 24

41 Figure 10. Ventral view of female epipleural flange of morphotype 1 from Honduras, Yoro (Pico Pijol National Park). Figure 11. Lateral view of female epipleural flange of morphotype 1 from Honduras, Yoro (Sinai, 5.3 km NW of Sn. Fco. Campo). 25

42 Figure 12. Ventral form of female epipleural pillow of morphotype 1 from Honduras, Yoro (Sinai, 5.3 km NW of Sn. Fco. Campo). DISTRIBUTION Morphotype 1 is distributed from the transverse volcanic belt of middle Mexico in the north to Honduras in the south. It is common in Honduras and Guatemala. A single male specimen was observed from western El Salvador. Morphotype 1 occurs north of the Isthmus of Tehuantepec in the Mexican states of Chiapas, Hidalgo and Veracruz (Fig. 13). Morphotype 1 specimens have been collected at elevations ranging from 100 m to 2831 m. The majority of collection records (71 %) are from highelevation sites above 1000 m (Tab. 7). 26

43 Figure 13. The distribution of morphotype 1 in Mexico, Guatemala, Honduras and El Salvador. TABLE 7 ELEVATIONAL DISTRIBUTION OF MORPHOTYPE 1* Elevation (m) Number of Specimen Records (n = 156) m m m m m m m 18 Above 1800 m 2 * The majority of collection records (71 %) are from high-elevation sites above 1000 m El SALVADOR (1). AHUACHAPÁN (1): Parque Nacional El Imposible, Cancha San Benito (1). GUATEMALA (88). BAJA VERAPAZ (31): Biotipo del Quetzal (3), Purulhá (1), Este de Purulhá (1), Purulhá, Biotopin (2), Purulhá, Finca Saboj (4), Purulhá, 5 km E (4), Purulhá, 6 km E (1), Purulhá, Posada del Quetzal (3), Salama (1), Tres Cruces, Saboj (11), ESCUINTLA (1): Palin, 3 miles East (1); HUEHUETENANGO (9): Barillas, Chiblac (3), Barillas, Malpais (4), Barillas, Nuevo San Mateo (1), Laguna Maxbal (1); IZABAL (22): Cerro San Gil, Camina Las Torres (2), Cerro San Gil, Camina Las 27

44 Torres, mirador (1), Cerro San Gil, Carboneras Biological Station (2), Cerro San Gil, Nacimiento San Gil (1), Cerro San Gil, Samaria (1), Cerro San Gil, Santo Tomas de Castille (1), Morales, Sierra de Caral (1), Pto. Barrias, Las Escobas (2), S.E. Morales, near Negro Norte (9), Sierra de Caral, Finca La Firmeza (2); QUETZALTENANGO (6): Colomba, Costa Cuca, El Choba, Finca La Florida (1), Costa Cuca (1), El Palmar, Finca El Faro (4); QUICHÉ (1): Uspantan, Norte de aldea Laj Chimel, Cuatro Chorros (1): SAN MARCOS (3): La Reforma (1), Norte La Feria, Cloud Forest (2); ZACAPA (15): Above La Union (9), La Union (6). HONDURAS (57). CORTÉS (1): Cusuco National Park, Orion (1); FRANCISCO MORAZÁN (1): El Zamorano (1); OLANCHO (7): La Muralla National Park (5), La Muralla National Park, 14 km North of La Union (2); SANTA BÁRBARA (5): El Volcán, 21 km NW of Trinidad (1), Montana La Cumbre (4); YORO (43): Pico Pijol National Park (5), Pico Pijol National Park, Linda Vista (32), Sinai, 5.3 km NW of Sn. Fco. Campo (7). MEXICO (18). CHIAPAS (4): Cacaohatan, Puente Shujubal, Luz Flous Cafetal (1), Finca Irlanda (1), Pacific Slope, Cordilleras (1), Puente Rio Huixtla, Montepio, Selva Med. Peren. Luz Fluor (1); GUERRERO (1): Mochitlan, Acahuizolta (1); HIDALGO (9): Chapulhuacán (5), 3 mi. N. Chapulhuacán, Hwy. 85 (4); PUEBLA (1): 5.8 mi. NE Teziutlán (1); VERACRUZ (3): Catemaco, Pipipan, Parque de la Flora y Fauna Silvestre Tropical (1), 3 km S Xalapa (2). TEMPORAL DISTRIBUTION (162). January (2), February (1), March (5), April (15), May (42), June (49), July (22), August (10), September (7), October (5), November (3), December (1). This temporal distribution indicates that adult emergence is concentrated at the onset of the rainy season (May-June). 28

45 4.2.2 MORPHOTYPE 2 DIAGNOSIS Morphotype 2 is separated from morphotypes 3 and 4 by having the pronotum with punctures sparse on disc and moderately dense on lateral portions. Body size ranging from mm. Dorsal maculae phenotype in morphotype 2 shows broad overlap with morphotypes 3 and 4 and is not useful for identification. Examination of the male parameres is the most reliable way to identify males of morphotype 2. The parameres are thick along their length to the apex (Fig. 16; Fig. 18). The apex of the parameres is sub-triangular and blunt (Fig. 15; Fig. 17). The combination of these paramere characters distinguishes this morphotype from morphotypes 3 and 4. Parameres of this morphotype most closely resemble those of morphotype 1. The parameres are distinctly deflexed at the apex in morphotype 2 wheras they are straight in morphotype 1. Females of morphotype 2 can be distinguished from morphotypes 3 and 4 by having the epipleuron (in ventral view) expanded into a broadly rounded flange at the level of abdominal sternites 1-2 (Fig. 19; Fig. 20). The ventral morphology of the epipleural pillow can be used to separate females of morphotype 2 from morphotype 3 and 4. Morphotype 2 females have a single ridge or fold, slightly curved for its length and distinctly removed from the elytral margin (Fig. 22). This ridge approaches the elytral margin in morphotype 3 and is straight in morphotype 4. The ventral form of the epipleural pillow is the same in morphotypes 2 and 1. Morphotype 2 females have the elytral flange distinctly thickened in lateral view (Fig. 21) while it is slightly thickened in northern morphs. 29

46 Figure 14. Dorsal habitus of morphotype 2 female and male. Figure 15. Caudal view Figure 16. Lateral view Figures Caudal and lateral views of parameres of a morphotype 2 male from Costa Rica, Guanacaste (Rio San Lorenzo, R. F. Cord., Tenorio). 30

47 Figure 17. Caudal view Figure 18. Lateral view Figures Caudal and lateral views of parameres of a morphotype 2 male from Costa Rica, Puntarenas (Est. La Casona Res. Biol. Monteverde). Figure 19. Ventral view of female epipleural flange of morphotype 2 from Costa Rica, Puntarenas (Monteverde Forest Reserve). 31

48 Figure 20. Ventral view of female epipleural flange of morphotype 2 from Panama, Chiriquí (Santa Clara). Figure 21. Lateral view of female epipleural flange of morphotype 2 from Panama, Chiriquí (Finca La Suiza, 5.3 km N. Los Planes). 32

49 Figure 22. Ventral form of female epipleural pillow of morphotype 2 from Costa Rica, Puntarenas (Monteverde Forest Reserve). DISTRIBUTION Morphotype 2 is narrowly distributed in montane forest of Costa Rica and western Panama (Fig. 23). Morphotype 2 specimens have been collected at elevations ranging from 700 to 2500 m. The majority of collection records (92 %) are from high-elevation sites above 1000 m (Tab. 8). 33

50 Figure 23. The distribution of morphotype 2 in Costa Rica and Panama. TABLE 8 ELEVATIONAL DISTRIBUTION OF MORPHOTYPE 2* Elevation (meters) Number of Specimen Records (n = 270) m m m m m m 4 *The majority of collection records (92 %) are from high-elevation sites above 1000 m COSTA RICA (174). ALAJUELA (9): Bajos del Toro Amarillo (1), San Ramon, Rio S. Lorencito (8); CARTAGO (47): Chirripo Indian Res., 5 mi SE Moravia (4), Embalse el Llano, Rio Macho (1), Quebrada Segunda Ref. Nac. Fauna Silv. Tapanti (17), Ref. Nac. Tapanti (19), Reserva Tapanti, Rio Grande de Orosi (2), SE side Irazu Volcano (4); GUANACASTE (58): Derrumbe, Est. Cacao lado oeste del V. Cacao (3), Derrumbe, Estac. Mengo, W side Volcan Cacao (11), Est. Cacao, SO Vol. Cacao (6), Est. Mengo, SW side Volcan Cacao (4), Est. Pitilla, 9 km S. Sta. Cecilia (2), Rio San Lorenzo, R. F. Cord., Tenorio (22), Rio San Lorenzo, Tierras Morenas (9) Sector Las Pailas, P.N. Guanacaste (1); HEREDIA 34

51 (1): 10 km N Vara Blanca nr. Cascada de la Paz (1); PUNTARENAS (43): Est. Biol. Los Alturas, Coto Brus (3) Est. La Casona Res. Biol. Monteverde (19), Fca. Cafrosa, Est. Las Mellizas, P.N. Amistad (5), Monteverde Forest Reserve (10), Monteverde Forest Reserve, Campbell s Woods (4), R. Coton, 1 km E de Las Alturas, Coto Brus (1), San Vito, Los Alturas (1); SAN JOSÉ (16): Est. Zurqui, P.N. Barillo Carillo, antes del Tunel (2), Parque del Este (13), P.N. Barillo Carillo, Est. Zurqui-Tunel (1). PANAMA (106). BOCAS DEL TORO (2): Continental divide trail, above La Fortuna (2); CHIRIQUÍ (104): Boquete (3), 6 km N Boquete, Cerro Pate (3), Cerro Punta (4), 2.5 km W Cerro Punta (7), 3 km W Cerro Punta (2), Continental divide trail, above Lago Fortuna (1), Finca La Suiza (1), Finca La Suiza, 5.3 km N Los Planes (1), Fortuna (5), Gualaca, IHRE Vivero, 11 km N Los Planes (13), Gualaca, Windy Pass 7 Km N Los Planes (5), La Fortuna, Quebrada AI Trail (1), Palo Alto Valley, 1.5 km E Boquete (4), Renacimiento, Hartmann's Finca (3), Renacimiento, Hartmann's Finca N Sta. Clara (10), Renacimiento, Hartmann's Finca N. Sta. Clara, Ojo de Agua (15), Renacimiento, Santa Clara (24), Reserva Fortuna, continental divide trail (2). TEMPORAL DISTRIBUTION (279). January (5), February (3), March (6), April (17), May (70), June (66), July (47), August (7), September (42), October (4), November (12), December (0). This temporal distribution indicates that adult emergence is concentrated at the onset of the rainy season (May-June) with a smaller second peak at the beginning of fall rains (September). 35

52 4.2.3 MORPHOTYPE 3 DIAGNOSIS Morphotype 3 is separated from morphotypes 1 and 2 by having the pronotum with punctures evenly distributed. Body size ranging from mm. Dorsal maculae phenotype in morphotype 3 displays broad overlap with morphotypes 2 and 4 and is not useful for identification. Examination of the male parameres is the most reliable way to identify males of morphotype 3. The parameres are slender along their length to the apex (Fig. 24; Fig. 26; Fig 35). The apex of the parameres is sub-triangular and elongate (Fig. 25; Fig. 27) to triangular and elongate (Fig. 34). The combination of these paramere characters distinguishes this morphotype from morphotypes 1 and 2. Parameres of this morphotype most closely resemble those of morphotype 4. The parameres of morphotype 3 have the baso-ventral tooth weakly produced at approximately a right angle from its base (Fig. 24; Fig. 26; Fig 35). Morphotype 4 has the baso-ventral tooth strongly produced at approximately a 45 degree angle from its base. Females of morphotype 3 can be distinguished from morphotype 1 and 2 by having the epipleuron (in ventral view) expanded into a rounded flange between abdominal sternites 1-2 (Fig. 29; Fig. 30; Fig 32; Fig 33). This morphotype has the distal edge (relative to base of the elytron) of the epipleural flange weakly to strongly concave where it meets the elytral margin. This distal edge of the eipipleural flange is convex in morphotypes 1 and 2. In lateral view the epipleural flange is thin in morphotypes 3 and 4 and distinctly thickened in morphotype 1 and 2. The internal morphology of the epipleural pillow can be used to separate females of morphotype 3 from the other morphotypes. Morphotype 3 females have a single ridge or fold, slightly curved for its length which approaches the elytral margin at an acute angle (Fig. 29; Fig. 32; Fig. 33). The intensity of this ridge varies but its angle towards the elytral margin is constant (Fig. 29). Morphotypes 1, 2 and 4 do not possess this strongly angled epipleural pillow ridge. A population of morphotype 3 from Venezuela (Aragua) displays an epipleural flange that is more broadly rounded (Fig. 36) and in ventral view resembles the flange of morphotype 1 and 2. Internally, there are two ridges with the medial ridge strong and straight. The lateral ridge is weaker and 36

53 angled (Fig. 37). Females from this locality are associated with males that have the apices of the parameres triangular and elongate (Fig. 34). This population is unique among all examined specimens of the C. sexpunctata species complex in having some individuals with ventral segments completely melanized. The legs, metacoxae, metepimera and metasternum of this population are often solid black (Fig. 36). This population may represent a fifth morphotype, but I have grouped it with morphotype 3 until I can examine more specimens. Figure 24. Dorsal habitus of morphotype 3 female and male. 37

54 Figure 25. Caudal view. Figure 26. Lateral view. Figures Caudal and lateral views of parameres of a morphotype 3 male from Ecuador, Pichincha (Maquipucuna For. Res., 50 km NW Quito). Figure 27. Caudal view Figure 28. Lateral view Figures Caudal and lateral views of parameres of a morphotype 3 male from Nicaragua, Jinotega (Cerro Kilambé, Camp 6-Las Torres). Figure 29. Ventral view of female epipleural flange morphotype 3 from Costa Rica, Guanacaste (Est. Pitilla, 9 km S Santa Cecilia, P.N. Guanacaste). 38

55 Figure 30. Ventral view of female epipleural flange of morphotype 3 from Costa Rica, Puntarenas (Est. Sirena, Corcovado N.P.). Figure 31. Lateral view of female epipleural flange of morphotype 3 from Costa Rica, Puntarenas (Est. Sirena, Corcovado N.P.). 39

56 Figure 32. Figure 33. Figures Ventral form of female epipleural pillows of morphotype 3 from Costa Rica, Puntarenas, San Vito, Las Cruces (left) and Est. Sirena, Corcovado N.P. (right). Figure 34. Caudal view Figure 35. Lateral view Figures Caudal and lateral views of parameres of a morphotype 3 male from Venezuela, Aragua (Parque Nacional Henri Pittier). 40

57 Figure 36. Ventral view of female epipleural flange of morphotype 3 from Venezuela, Aragua (Parque Nacional Henri Pittier). Figure 37. Ventral form of female epipleural pillow of morphotype 3 from Venezuela, Aragua (Parque Nacional Henri Pittier). 41

58 DISTRIBUTION Morphotype 3 is the most broadly distributed morphotype (Fig. 38; Fig. 39) and is distributed from eastern Honduras in the north to northern South America in the south. Morphotype 3 specimens have been collected at elevations ranging from near sea level (0-100 m) to 1800 m. The majority of collection records (80%) are from low to medium elevations (Tab. 9). Figure 38. The distribution of morphotype 3 in Honduras, Nicaragua and Costa Rica. 42

59 Figure 39. The distribution of morphotype 3 in Colombia, Ecuador, Brazil, Suriname and Venezuela. TABLE 9 ELEVATIONAL DISTRIBUTION OF THE MORPHOTYPE 3* Elevation (meters) Number of Specimen Records (n = 184) m m m m m m m m 1 * The majority of collection records (80%) are from low to medium elevations below 900 m BRAZIL (3). AMAZONAS (1): Reserva Campina 5, 60 km N Manaus (1); RONDONIA (2): 62 km S Ariquemes, Faz Rancho Grande (2). COLOMBIA (2): ANTIOGUIA (1): nr. Yarumal (1); VALLE DEL CAUCA (1): Anchicaya Dam, 70 km E Buenaventura (1). COSTA RICA (151). ALAJUELA (19): Est. Eladios, Ref. Peñas Blancas, Res. Biol. Monteverde (10), Est. Laguna Pocosol, Res. Biol. Monteverde (1), Est. San Ramon Oeste (1), Fca. San Gabriel, 2 km SW 43

60 Dos Rios (1), Rio San Lorencito, Res. For. San Ramon, 5 km N Col. Palmarena (1), San Ramon, Rio S. Lorencito (5); GUANACASTE (54): Est. Maritza, lado O Vol. Orosi (1), Est. Pitilla, 9 km S Santa Cecilia, P.N. Guanacaste (48), Rio San Lorenzo, R. F. Cord., Tenorio (3), Rio San Lorenzo, Tierras Morenas (2); HEREDIA (26): Est. El Ceibo, Braulio Carrillo N. P, Heredia (15), Est. Magsaysay, P.N. Braulio Barrillo (4), Finca La Selva, Pto. Viejo, Sarapiquí (1), La Selva Biological Station (6); LIMÓN (13): Cerro Tortuguero (1), Est. Hitoy Cerere, Res. Biol. Hitoy Cerere (10), Res. Biol. Hitoy Cerere, Valle La Estrella (1), 3 km W Limón (1); PUNTARENAS (33): Est. Sirena, Corcovado N.P. (25), Las Cruces Biological Station (1), Rancho Quemado, Península de Osa (2), San Vito, Las Cruces (5); SAN JOSÉ (2): Est. Carrillo, P.N. Baulio Carrillo (2). ECUADOR (3): PICHINCHA (3): Maquipucuna For. Res., 50 km NW Quito (3). HONDURAS (1). OLANCHO (1): Montaña del Malacate (1). NICARAGUA (2): JINOTEGA (1): Cerro Kilambé, Camp 6-Las Torres (1); RAA NORTE (1): Cerro Saslaya, Camp 3 (1). PANAMA. (2). COLÓN (2): Santa Rita Ridge (2). SURINAME. (2). BROKOPONDO (2): Brownsberg Natuurpark, Mazaroni Plateau VENEZUELA (17). ARAGUA (17): Bosques nublados cercanos a la Estacion Biologica de Rancho Grande, Parque Nacional Henri Pittier (2), Parq. Nac. Henri Pittier, Portochuelo Pass (9), Parq. Nac. Henri Pittier, Est. Biol. Rancho Grande (1), 10 km S Rancho Grande (5). TEMPORAL DISTRIBUTION (182). January (24), February (9), March (17), April (12), May (30), June (19), July (20), August (5), September (6), October (12), November (11), December (17). This temporal distribution indicates that adult emergence is staggered throughought the year, but this will vary depending on location. 44

61 4.2.4 MORPHOTYPE 4 DIAGNOSIS Morphotype 4 is separated from morphotypes 1 and 2 by having the pronotum with punctures evenly distributed. Body size ranging from Length mm. Dorsal maculae phenotype in morphotype 3 displays broad overlap with morphotypes 2 and 3 and is not useful for identification. Examination of the male parameres is the most reliable way to identify males of morphotype 4. The parameres are slender along their length to the apex (Fig. 42; Fig. 44). The apex of the parameres is triangular and squat (Fig. 41; Fig. 43). The apex of the parameres distinguishes this morphotype from males of morphotype 1 and 2. Parameres of this morphotype most closely resemble those of morphotype 3. The parameres of morphotype 4 have the baso-ventral tooth strongly produced at approximately a 45 degree angle from its base (Fig. 42; Fig. 44). Morphotype 3 males have the basal tooth weakly produced from the base at a right angle. Morphotype 4 females can be distinguished from morphotypes 1 and 2 by having the epipleuron (in ventral view) expanded into a rounded flange between abdominal sternites 1-2 (Fig. 45; Fig 46). This morphotype has the distal edge (relative to base of the elytron) of the epipleural flange weakly to strongly concave where it meets the elytral margin. This distal edge of the eipipleural flange is convex in morphotypes 1 and 2. In lateral view the epipleural flange is thin in morphotype 4 and thickened in morphotypes 1 and 2 (Fig. 47). The ventral form of the epipleural pillow can be used to separate females of morphotype 4 from morphotypes 1, 2, and 3. Morphotype 4 females have a single ridge or fold, straight for its length which is parallel to the elytral margin (Fig. 48). The intensity of this ridge varies but its angle towards the elytral margin is constant (Fig. 49). 45

62 Figure 40. Dorsal habitus of morphotype 4 female and male. Figure 41. Caudal view Figure 42. Lateral view Figures Caudal and lateral views of parameres of a morphotype 4 male from Panama, Former Canal Zone (Madden Forest Preserve). 46

63 Figure 43. Caudal view. Figure 44. Lateral view. Figures Caudal and lateral views of parameres of a morphotype 4 male from Costa Rica, Limón (Manzanillo, RNFS Grandoca y Manzanillo). Figure 45. Ventral view of female epipleural flange of morphotype 4 from Panama, Former Canal Zone (Barro Colorado Island). 47

64 Figure 46. Ventral view of female epipleural flange of morphotype 4 from Panama, Panama (El llano-carti Rd., km 8). Figure 47. Lateral view of female epipleural flange of morphotype 4 from Panama, Panama (El llano-carti Rd., km 8). 48

65 Figure 48. Figure 49. Figures Ventral form of female epipleural pillow of morphotype 4 from Panama (Barro Colorado Island) (left) and Costa Rica, Puntarenas (Buenos Aires, La Amistad, Sector Altamira) (Right). DISTRIBUTION Morphotype 4 is distributed from Costa Rica south to Colombia (Fig. 50). Morphotype 4 specimens have been collected at elevations ranging from near sea level (0-100 m) to 1450 m. The majority of collection records (83 %) are from low elevation sites (Tab. 10). 49

66 Figure 50. The distribution of morphotype 4 in Costa Rica, Panama and Colombia. TABLE 10 ELEVATIONAL DISTRIBUTION OF MORPHOTYPE 4* Elevation (meters) Number of Specimen Records (n = 116) m m *The majority of collection records (83 %) are from low elevation sites below 900 m COLOMBIA (10). BOYACÁ (1): La Lechera, Rio Opon N. Tunja (1); FORMER SANTANDER STATE (6): Rio Opon, a tributary of Rio Magdalena (6); Rio Suarez (3). COSTA RICA (18). HEREDIA (1): El Plastico, Horquetas de Sarapiqui (1); LIMÓN (6): Manzanillo, RNFS Grandoca y Manzanillo (6); PUNTARENAS (11): Buenos Aires, La Amistad, Sector Altamira (6); Est. Altamira, Buenos Aires (3), San Vito, las Cruces (2). PANAMA (93). BOCAS DEL TORO (4): Miramar (4); CHIRIQUÍ (14): Dist. Renacimiento, Santa Clara (13); COLÓN (20): Btwn. Gatun and Pina (2), Ft. Sherman, Pavon Hill (1), Portobelo (1), Rio Guanche Bridge, 1 km E (5), Santa Rita Ridge (11); DARIEN (3): Cana (2), Cana, ACON Station (1); FORMER CANAL ZONE (14): Barro Colorado Island (3), Madden Forest Preserve (1), Pipeline Road (1), Skunk Hollow, 6 mi. NW Gatun Locks (9); PANAMA (37): Cerro Azul, INRENARE Station (1), Cerro Jefe, 2 km SE (2), El llano- Carti Rd (2), El llano- Carti Rd., km 8 (23), El llano- Carti Rd., km 12 (2), Soberanía National Park (1), Soberanía National Park, Pipeline Rd. 9 km mark (2), Soberanía National Park, Pipeline Rd., 2 km W Gamboa (2), Soberanía National Park Pipeline Rd. km 2.4 (1), Soberanía National Park Pipeline Rd., Rio Limbo (1); VERAGUAS (1): Alto de Piedra above Santa Fe (1). TEMPORAL DISTRIBUTION. (120). January (1), February (1), March (3), April (9), May (49), June (25), July (15), August (3), September (0), October (7), November (7), December (1). This temporal distribution indicates that adult emergence is concentrated at the onset of the rainy season 50

67 4.2.5 SYMPATRY OF THE MORPHOTYPES Sympatry of C. sexpunctata and C. brevis (based on male parameres) at specific collecting localities has been a noted previously (Ratcliffe 2003). The large sample of C. sexpunctata and C. brevis sensu Ratcliffe (2003) in this study allowed for the detection of patterns in sympatry across the distribution of these beetles. Most of the sympatry was attributable to the widespread morphotype 3 (Tab. 11). Morphotype 3 is sympatric with all other morphotypes in at least one locality. No intermediate male paramere morphologies were observed in sympatric populations. The sample size was smaller for female epipleural pillows than male parameres. The stability of the ventral form of the epipleural pillow in sympatric populations has not been thoroughly evaluated. TABLE 11 LOCALITIES OF SYMPATRY BETWEEN MORPHOTYPES Specific Locality Morphotypes Detected Honduras, Olancho: Montaña del Malacate Morphotypes 1 and 3 Costa Rica, Puntarenas: San Vito, Las Cruces Morphotypes 3 and 4 Costa Rica, Alajuela: Monte Verde Area Morphotypes 2 and 3 Costa Rica, Alajuela: San Ramon, Rio S. Lorencito Morphotypes 2 and 3 Costa Rica, Guanacaste: Est. Pitilla Morphotypes 2 and 3 Costa Rica, Guanacaste: Rio San Lorenzo, R. F. Morphotypes 2 and 3 Cord., Tenorio Costa Rica, Guanacaste: Rio San Lorenzo, Tierras Morphotypes 2 and 3 Morenas Panama, Former Canal Zone: Barro Colorado Morphotypes 3 and 4 Island Panama, Colón: Santa Rita Ridge Morphotypes 3 and Discussion Epipleural dialations and flanges are useful for species-level identification in many cyclocephaline genera (Endrödi 1985; Ratcliffe 2003; Ratcliffe and Cave 2006). The role of these structures in adult cyclocephaline biology is poorly understood despite their taxonomic importance. Mating habits have been noted from Cyclocephala although these are not detailed at the level of genitalic, elytral or claw interactions. Images offer clues to the role of sexually dimorphic characters (male protarsal claws and female elytral epipleura) in Cyclocephala. Figure 51 shows a male C. colasi grasping a female 51

68 with his enlarged protarsal claw on the lateral edge of the female elytra in the corresponding position of epipleural dilations (Fig. 51, see arrow). Figure 51. Mating scarab beetles (Cyclocephala colasi) on the sterile male florets of Philodendron solimoesense in French Guiana. Arrow indicates position of male protarsal claw and female epipleuron. (from (photo credited to R. Seymour.) Male protarsal claws probably make contact with the ventral portions of the female elytra when in this copulatory position (Fig. 51). Based on their position, the ventral elytral ridges and folds of the epipleural pillow are most likely the point of contact for male claws. In addition to the diagnostic forms of the epipleural pillow, the pillow also possess a dark red color indicating that the chitin composition of this area is different than the rest of the elytra (e.g., Fig. 37). This may indicate additional sclerotization of the structure, providing an auxiliary lock and key for prezygotic mating isolation. The ventral form of the epipleural pillow may be an artifact of developmental processes that generate epipleural dilations and flanges. Cyclocephala species in the Neotropics have been observed to aggregate and mate inside of the flowers that they visit. Often there is more than one cyclocephaline species present in an inflorescence (Gottsberger 1988). It has been hypothesized that floral scents determine the community cyclocephaline 52

69 visitors (Gottsberger and Amaral 1994; Beath 1999). There are no direct of indirect observations of hybridization of Cyclocephala species that mate in the same flowers at the same time. Interactions between male legs and female elytra could serve as a pre-copulatory isolating mechanism between congenerics mating in close proximity to each other. The pattern of variation in the ventral morphology of the epipleural pillow is different between C. sexpunctata and C. brevis sensu Ratcliffe (2003). This structure is stable in C. sexpunctata (Fig. 12, morphotype 1; Fig. 22, morphotype 2) but varies from nearly absent to straight (Fig. 48; Fig 49, morphotype 4) to distinctly angled (Fig. 32; Fig. 33, morphotype 3) in C. brevis sensu Ratcliffe (2003). females. The current species concept of C. brevis sensu Ratcliffe (2003) now circumscribes variation in male and female characters. It is not clear why only the male parameres would vary in C. sexpunctata sensu Ratcliffe (2003) (morphotypes 1 and 2) while both male and female characters are variable in C. brevis sensu Ratcliffe (morphotypes 3 and 4). It is also the case that males of the C. sexpunctata species complex have nearly identical protarsal claws. Figure 52. Ventral form of female epipleural pillow of C. brittoni from Panama, Former Canal Zone (Skunk Hollow). 53

70 Figure 53. Ventral form of female epipleural pillow of C. tutilina from Venezuela, Aragua (Henri Pittier National Park). 4.3 MACULAE PHENOTYPES A broad spectrum of maculae phenotypes was observed in the C. sexpunctata species complex. Between 12 to 17 maculae phenotypes are characterized for each morphotype. I report the phenotypes in order of their relative frequency (most frequent to least frequent) in the observed specimen sample. Morphotype 1 displays 12 maculae phenotypes (Fig. 54). The most common phenotype (phenotype A; 46 %) displays pronotal maculae and four elytral spots with the apical two maculae contiguous (Fig. 55). Morphotype 2 displays 17 maculae phenotypes (Fig. 56). The most common phenotype (phenotype A; 64 %) displays no pronotal maculae and four distinctly separated elytral maculae (Fig. 57). Morphotype 3 displays 16 maculae phenotypes (Fig. 58). The most common phenotype (phenotype A; 50 %) displays no pronotal maculae and four distinctly separated elytral maculae (Fig. 59). Morphotype 4 displays 16 maculae phenotypes (Fig. 60). The most common phenotype (phenotype A; 54 %) displays no pronotal maculae and four distinctly separated elytral maculae (Fig. 61). 54

71 4.3.1 Morphotype 1 Phenotype A Phenotype B Phenotype C Phenotype D Phenotype E Phenotype F Phenotype H Phenotype I Phenotype J 55

72 Frequency Phenotype K Phenotype L Phenotype M Figure 54. Maculae phenotypes of morphotype A B C D E F G H I J K L M Maculae Phenotype n = 97 Figure 55. Frequency of dorsal maculae phenotypes in morphotype 1. 56

73 4.3.2 Morphotype 2 Phenotype A Phenotype B Phenotype C Phenotype D Phenotype E Phenotype F Phenotype G Phenotype H Phenotype I 57

74 Phenotype J Phenotype K Phenotype N Phenotype O Phenotype P Phenotype Q Phenotype R Phenotype S Figure 56. Maculae phenotypes of morphotype 2. 58

75 Frequency n = A B C D E F G H I J K L M N O P Q R S Maculae Phenotypes Figure 57. Frequency of dorsal maculae phenotypes in morphotype 2. 59

76 4.3.3 Morphotype 3 Phenotype A Phenotype B Phenotype C Phenotype D Phenotype E Phenotype F Phenotype G Phenotype H Phenotype I 60

77 Phenotype J Phenotype K Phenotype L Phenotype M Phenotype N Phenotype O Phenotype P Figure 58. Maculae phenotypes of morphotype 3. (arrows indicate obscure maculae) 61

78 Frequency n = A B C D E F G H I J K L M N O P Maculae Phenotypes Figure 59. Frequency of dorsal maculae phenotypes in morphotype 3. 62

79 4.3.4 Morphotype 4 Phenotype A Phenotype B Phenotype C Phenotype D Phenotype E Phenotype F Phenotype G Phenotype H Phenotype I 63

80 Frequency Phenotype J Phenotype K Phenotype L Figure 60. Maculae phenotypes of morphotypes 4. (arrows indicate obscure maculae) n = A B C D E F G H I J K L Maculae Phenotype Figure 61. Frequency of dorsal maculae phenotypes in low-elevation C. brevis morphotypes. 64