Introduction. Global challenge of energy supply CO 2 output Radioactive waste Inefficient storage in batteries
|
|
- Iris Mitchell
- 5 years ago
- Views:
Transcription
1
2 Introduction Global challenge of energy supply CO 2 output Radioactive waste Inefficient storage in batteries Limited resources Toxic waste Charging time 2
3 Fuel Cells H 2 + Anode Cathode O 2 3
4 Microbial Fuel Cells Substrate Cathode Anode O 2 4
5 Advantages Fuel Cells High efficiency Energy on demand Easy scaling Microbial Fuel Cells Same as fuel cell Variety of possible substrates Renewable resources Waste 5
6 Application Already in use with mixed cultures Escherichia coli vs. Mixed culture - electron transfer + + growth - + predictability + safety - + genetic accessibility - 6
7 Application Already in use with mixed cultures Escherichia coli vs. Mixed culture + electron transfer + + growth - + predictability + safety - + genetic accessibility - 7
8 Project Levels Hardware level Constructing a Microbial Fuel Cell Making MFC technology available to the igem community Establishing standardized measurement parameters Genome level Enabling electron transfer across membrane Enabling electron transport to anode Implementing biosafety system 8
9 Fuel Cell Evolution Requirements Electron transfer Proton transfer Anaerobic 9
10 Fuel Cell Evolution Requirements Electron transfer Proton transfer Anaerobic Nitrogen aeration Easy refill 10
11 Fuel Cell Evolution Requirements Electron transfer Proton transfer Anaerobic Nitrogen aeration Easy refill Available to community Customized for igem team York 11
12 Fuel Cell Evolution Requirements Electron transfer Proton transfer Anaerobic Nitrogen aeration Easy refill Available to community Customized for igem team York Introduced reference electrode 12
13 Fuel Cell Evolution Requirements Electron transfer Proton transfer Anaerobic Nitrogen aeration Easy refill Available to community Easy to build with 3D-printer Cheap 13
14 Genome Level Multiple approaches for each problem Crossing the cell membrane Route to the electrode Porins Cytochromes Nanowires Riboflavin GldA 14
15 Anode Mediators Electron shuttles Requirements Redox properties Soluble Non-toxic Chemical mediators Methylene blue Neutral red e - e - e - e - e - e - e - 15
16 Genetic approach Riboflavin from S. oneidensis Riboflavin Expensive exogenous mediators Heterologous expression of the riboflavin synthesis gene cluster GldA Porins Biosafety Wild type E. coli KRX Riboflavin producing strain, Anderson 0.33 (weak) Riboflavin producing strain, Anderson 0.77 (strong) 16
17 Genetic approach Riboflavin from S. oneidensis Riboflavin Expensive exogenous mediators Heterologous expression of the riboflavin synthesis gene cluster GldA Fluorescence assay Porins Enhanced extracellular riboflavin concentration Biosafety Confirmed with absorbance assay, HPLC and LC/MS measurements 17
18 Genetic approach GldA from E. coli Riboflavin Overexpression of glycerol dehydrogenase (GldA) for increasing NADH production GldA NAD + + H + + 2e - GldA NADH Porins Biosafety 18
19 Genetic approach GldA from E. coli Riboflavin Overexpression of glycerol dehydrogenase (GldA) for increasing NADH production Fluorescence-based NADH assay GldA Porins Biosafety Increased NADH production 19
20 Genetic approach GldA from E. coli Riboflavin Overexpression of glycerol dehydrogenase (GldA) for increasing NADH production Examination of increased electricity generation GldA Porins Biosafety Average electrical power increased by 40 % 20
21 Genetic approach Anode Membrane Riboflavin Membranes natural isolator GldA Optimization of mediator transport Porins Permeabilization e - e - e - e - e - Biosafety 21
22 Genetic approach OprF from P. fluorescens Riboflavin Heterologous expression of the outer membrane porin OprF One of the largest porins on bacterial outer membranes GldA Visualization via Atomic Force Microscopy Porins Biosafety Wild type E. coli KRX OprF producing strain AFM was carried out in cooperation with the Physics Department of Bielefeld University 22
23 Genetic approach OprF from P. fluorescens Riboflavin Membrane permeability assay with 1-N-phenylnaphthylamine uptake assay GldA Porins Biosafety Increased membrane permeability 23
24 Genetic approach OprF from P. fluorescens Riboflavin Electricity generation by OprF expressing strain GldA Porins Biosafety Measurements at 200 Ω resistance with methylene blue added 100 % enhanced maximal voltage 24
25 Genetic approach OprF from P. fluorescens Riboflavin Electricity generation by OprF expressing strain GldA Porins Biosafety Measurements at 200 Ω resistance with methylene blue added 400 % enhanced average electric power 25
26 Genetic approach OprF from P. fluorescens Riboflavin Electricity generation by OprF expressing strain GldA Porins Biosafety Increased membrane permeability Enabling of efficient electricity generation Further optimization possible 26
27 Genetic approach Biosafety Riboflavin GldA Porins Novel Biosafety approach inspired by igem-team Paris Bettencourt 2012 Basis: Biosafety strain D-alanine auxotrophic E. coli (Δalr ΔdadX) Complementation with safety plasmid carrying alr Additional kill switch: toxic gene product RNase Ba (Barnase) Three systems with different regulatory mechanisms AraCtive Biosafety TetOR Alive Lac of Growth 27
28 Genetic approach System AraCtive Riboflavin Rhamnose D-alanine GldA prha arac alr pbad RNase Ba Porins Biosafety 28
29 Genetic approach System AraCtive Riboflavin D-alanine GldA prha arac alr pbad RNase Ba Porins Biosafety Test with GFP instead of Barnase Functionality indirectly proven System works as expected 29
30 Achievements Design, construction and improvement of a MFC Printing a biodegradable DIY-MFC Integration of porins Riboflavin overproduction Overexpression of glycerol dehydrogenase Three advantageous biosafety systems 30
31 Achievements Human Practice Conventions SynBioDay Student Academy Media Experts Dr. Falk Harnisch Dr. Arnold Sauter Aeneas Wanner 31
32 We want to thank Prof. Dr. Jörn Kalinowski Dr. Christian Rückert Nils Lübke Timo Wolf Working groups: - Fermentation Technology - Microbial Genomics and Biotechnology 32
Investigating Ammonia-producing Bacteria for the Establishment of a ph Gradient in Microbial Biofuel Cells. Alex Hodson
Investigating Ammonia-producing Bacteria for the Establishment of a ph Gradient in Microbial Biofuel Cells Alex Hodson Mentor: Dr. R. Shane Gold BIOL 491-494 April 20 2015 Abstract Microbial biofuel cells
More informationSynthesis of Biofuels on Biocathodes
Synthesis of Biofuels on Biocathodes Alfred M. Spormann Departments of Chemical Engineering, and of Civil & Environmental Engineering Stanford University Source: The National Academies http://needtoknow.nas.edu/energy/interactive/energy-system.php
More informationAdditional higher level topics
Option C: Energy 15/25 hours 150 Essential idea: Chemical energy from redox reactions can be used as a portable source of electrical energy. C.6 Electrochemistry, rechargeable batteries and fuel cells
More informationThe Proton Motive Force. Overview. Compartmentalization 11/6/2015. Chapter 21 Stryer Short Course. ATP synthesis Shuttles
The Proton Motive Force Chapter 21 Stryer Short Course Redox reactions Electron transport chain Proton gradient Overview ATP synthesis Shuttles Analogy: How does burning coal put flour in the grocery store?
More informationBio-electrochemistry course
Bio-electrochemistry course LabMET short course on microbial energy management and microbial fuel cells Peter Aelterman and Korneel Rabaey Course overview Bacterial metabolism and the redox potential Basic
More informationTCA Cycle. Voet Biochemistry 3e John Wiley & Sons, Inc.
TCA Cycle Voet Biochemistry 3e Voet Biochemistry 3e The Electron Transport System (ETS) and Oxidative Phosphorylation (OxPhos) We have seen that glycolysis, the linking step, and TCA generate a large number
More informationMicrobial Genetics, Mutation and Repair. 2. State the function of Rec A proteins in homologous genetic recombination.
Answer the following questions 1. Define genetic recombination. Microbial Genetics, Mutation and Repair 2. State the function of Rec A proteins in homologous genetic recombination. 3. List 3 types of bacterial
More informationEnergy Conservation and Transformation
Goals Understand how redox reactions work Perform an electrolysis reaction Make calculations based on data Background For every action, there s an equal and opposite reaction, even at the atomic level.
More informationELECTROCHEMICAL CELLS NAME ROW PD
4-26-12 NAME ROW PD (1) Which statement describes the redox reaction that occurs when an object is electroplated? The diagram below shows the electrolysis of fused KCl. A) It is spontaneous and requires
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
More informationAnalysis of Escherichia coli amino acid transporters
Ph.D thesis Analysis of Escherichia coli amino acid transporters Presented by Attila Szvetnik Supervisor: Dr. Miklós Kálmán Biology Ph.D School University of Szeged Bay Zoltán Foundation for Applied Research
More informationConstruction and Characterization of Microbial Fuel Cells Using a Defined Co-culture of G. sulfurreducens and E. coli
Construction and Characterization of Microbial Fuel Cells Using a Defined Co-culture of G. sulfurreducens and E. coli by Nicholas Bourdakos A thesis submitted in conformity with the requirements for the
More informationTi plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines
Ti plasmid derived plant vector systems: binary and co - integrative vectors transformation process; regeneration of the transformed lines Mitesh Shrestha Constraints of Wild type Ti/Ri-plasmid Very large
More informationCellular Energy: Respiration. Goals: Anaerobic respiration
Cellular Energy: Respiration Anaerobic respiration Goals: Define and describe the 3 sets of chemical reactions that comprise aerobic cellular respiration Describe the types of anaerobic respiration Compare
More informationElectrochemical Cells Homework Unit 11 - Topic 4
Electrochemical Cell Vocabulary Electrochemical Cells Homework Unit 11 - Topic 4 Electrode Anode Voltaic Cell Oxidation Electrolytic Cell Cathode Salt Bridge Reduction Half Reaction Refer to Table J: For
More informationMolecules in Time and Space
Molecules in Time and Space Molecules in Time and Space Bacterial Shape, Division and Phylogeny Edited by Miguel Vicente CSIC National Biotechnology Centre Javier Tamames BioAlma, S.L. Alfonso Valencia
More informationMini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for
Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI
More informationreturn in class, or Rm B
Last lectures: Genetic Switches and Oscillators PS #2 due today bf before 3PM return in class, or Rm. 68 371B Naturally occurring: lambda lysis-lysogeny decision lactose operon in E. coli Engineered: genetic
More informationTransporters and Membrane Motors Nov 15, 2007
BtuB OM vitamin B12 transporter F O F 1 ATP synthase Human multiple drug resistance transporter P-glycoprotein Transporters and Membrane Motors Nov 15, 2007 Transport and membrane motors Concentrations
More informationElectrochemistry. Michael Faraday s law of electromagnetic induction says that whenever a conductor is
Surname 1 Name Course Instructor Date Electrochemistry 1. Faraday s Law Michael Faraday s law of electromagnetic induction says that whenever a conductor is positioned in a changeable magnetic field emf
More informationBatteries (Electrochemical Power Sources)
Batteries (Electrochemical Power Sources) 1. Primary (single-discharge) batteries. => finite quantity of the reactants 2. Secondary or rechargeable batteries => regeneration of the original reactants by
More informationMultistability in the lactose utilization network of Escherichia coli
Multistability in the lactose utilization network of Escherichia coli Lauren Nakonechny, Katherine Smith, Michael Volk, Robert Wallace Mentor: J. Ruby Abrams Agenda Motivation Intro to multistability Purpose
More informationCellular Respiration: Harvesting Chemical Energy. 9.1 Catabolic pathways yield energy by oxidizing organic fuels
Cellular Respiration: Harvesting Chemical Energy 9.1 Catabolic pathways yield energy by oxidizing organic fuels 9.2 Glycolysis harvests chemical energy by oxidizing glucose to pyruvate 9.3 The citric acid
More informationMICROBIOLOGY TEST 1 - SPRING 2007
MICROBIOLOGY TEST 1 - SPRING 2007 Name Part One: Short Answers. Answer 5 of the following 6 questions in the space that has been provided. Each question is worth 15 points. Question 1: Name and briefly
More informationBBS2710 Microbial Physiology. Module 5 - Energy and Metabolism
BBS2710 Microbial Physiology Module 5 - Energy and Metabolism Topics Energy production - an overview Fermentation Aerobic respiration Alternative approaches to respiration Photosynthesis Summary Introduction
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More informationElectrochemical Potential and the Thermodynamic Basis of Solute Transport Mechanisms
Electrochemical Potential and the Thermodynamic Basis of Solute Transport Mechanisms A. Electrochemical Potential The electrochemical potential arising from the distribution of a solute A across a membrane
More informationThis is an author's accepted manuscript of an article published in World Journal of Microbiology and Biotechnology, March 2017, 33:56.
WestminsterResearch http://www.westminster.ac.uk/westminsterresearch The role of riboflavin in decolourisation of Congo red and bioelectricity production using Shewanella oneidensis-mr1 under MFC and non-mfc
More informationProperties of novel anion selective material with DABCO functional groups for alkaline water electrolysis
Properties of novel anion selective material with DABCO functional groups for alkaline water electrolysis Jaromír Hnát, Jan Žitka, Martin Ďurovič, Martin Paidar, Karel Bouzek Department of Inorganic Technology
More informationTechniques in Molecular Genetics Spectroscopy and Enzyme Assays
Techniques in Molecular Genetics Spectroscopy and Enzyme Assays H.E. Schellhorn Spectroscopy Chromophore Molar Extinction Coefficient Absorbance Transmittance Spectroscopy Many biological materials have
More informationreport Membrane Transport of Lactic Acid in the Filamentous Fungus Rhizopus Abstract
826 report Membrane Transport of Lactic Acid in the Filamentous Fungus Rhizopus Christopher D. Skory 1, Ronald E. Hector 1, Steven W. Gorsich 2 and Joseph O. Rich 1 * Abstract The fungus Rhizopus is frequently
More informationCellular Energetics. Photosynthesis, Cellular Respiration and Fermentation
Cellular Energetics Photosynthesis, Cellular Respiration and Fermentation TEKS B.4 Science concepts. The student knows that cells are the basic structures of all living things with specialized parts that
More informationSYLLABUS. Meeting Basic of competence Topic Strategy Reference
SYLLABUS Faculty : Mathematics and science Study Program : Biology education Lecture/Code : Microbiology/BIO 236 Credits : 2 unit of semester credit Semester : 5 Prerequisites lecture : Biochemistry, Cell
More information3. Organic Geochemisty Organic Chemistry is the chemistry... of Carbon -Morrison and Boyd
3. Organic Geochemisty Organic Chemistry is the chemistry... of Carbon -Morrison and Boyd Definitions, Nomenclature Organic Compound Solubility Octanol-Water Partition Coefficient Organic Compound Sorption
More informationTopic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.
Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of
More informationMetabolism. Fermentation vs. Respiration. End products of fermentations are waste products and not fully.
Outline: Metabolism Part I: Fermentations Part II: Respiration Part III: Metabolic Diversity Learning objectives are: Learn about respiratory metabolism, ATP generation by respiration linked (oxidative)
More informationMultistability in the lactose utilization network of E. coli. Lauren Nakonechny, Katherine Smith, Michael Volk, Robert Wallace Mentor: J.
Multistability in the lactose utilization network of E. coli Lauren Nakonechny, Katherine Smith, Michael Volk, Robert Wallace Mentor: J. Ruby Abrams Motivation Understanding biological switches in the
More informationthe noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
More informationCE 421/521 Environmental Biotechnology. The Cell: The common denominator of all living things Chapter 4 in Vaccari et al. Tim Ellis August 24, 2006
CE 421/521 Environmental Biotechnology The Cell: The common denominator of all living things Chapter 4 in Vaccari et al. Tim Ellis August 24, 2006 Introduction Cells were discovered around the same time
More informationClassifying Prokaryotes: Eubacteria Plasma Membrane. Ribosomes. Plasmid (DNA) Capsule. Cytoplasm. Outer Membrane DNA. Flagellum.
Bacteria The yellow band surrounding this hot spring is sulfur, a waste product of extremophilic prokaryotes, probably of the Domain Archaea, Kingdom Archaebacteria. Bacteria are prokaryotic cells (no
More informationElectron Transport Chain (Respiratory Chain) - exercise - Vladimíra Kvasnicová
Electron Transport Chain (Respiratory Chain) - exercise - Vladimíra Kvasnicová Respiratory chain (RCH) a) is found in all cells b) is located in a mitochondrion c) includes enzymes integrated in the inner
More informationInfluence of ph and Carbonate Buffering on the Performance of a Lactate Microbial Fuel Cell
Excerpt from the Proceedings of the COMSOL Conference 2010 Paris Influence of ph and Carbonate Buffering on the Performance of a Lactate Microbial Fuel Cell A. Torrents 1, N. Godino 1, F.J. del Campo 1,
More informationMicrobial Fuel Cell DAMION L. IRVING DECEMBER 21, 2009
Microbial Fuel Cell DAMION L. IRVING DECEMBER 21, 2009 Microbial fuel cell (MFC) MFC s are devices that produce energy from bacteria (and other microbes) metabolism The devices involve an anode and a cathode
More informationName: TF: Section Time: LS1a ICE 5. Practice ICE Version B
Name: TF: Section Time: LS1a ICE 5 Practice ICE Version B 1. (8 points) In addition to ion channels, certain small molecules can modulate membrane potential. a. (4 points) DNP ( 2,4-dinitrophenol ), as
More informationFuel Cells Activation polarization
Fuel Cells The principle of fuel cells Oxygen and hydrogen, when mixed together in the presence of enough activation energy have a natural tendency to react and form water, because the Gibbs free energy
More informationElectrochemistry & Redox. Voltaic Cells. Electrochemical Cells
Electrochemistry & Redox An oxidation-reduction (redox) reaction involves the transfer of electrons from the reducing agent to the oxidising agent. OXIDATION - is the LOSS of electrons REDUCTION - is the
More informationSynthesis of LiFePO 4 Nanostructures for Lithium-Ion Batteries by Electrochemical Deposition
Synthesis of LiFePO 4 Nanostructures for Lithium-Ion Batteries by Electrochemical Deposition Erika Aragon and Alfredo A. Martinez-Morales Southern California Research Initiative for Solar Energy College
More informationA synthetic oscillatory network of transcriptional regulators
A synthetic oscillatory network of transcriptional regulators Michael B. Elowitz & Stanislas Leibler, Nature, 403, 2000 igem Team Heidelberg 2008 Journal Club Andreas Kühne Introduction Networks of interacting
More informationElectrofuels Electrochemistry as a tool for a sustainable biofuel synthesis
Electrofuels Electrochemistry as a tool for a sustainable biofuel synthesis Uwe Schröder, Nachhaltige Chemie und Energieforschung, Institut für ökologische Chemie Uwe Schröder, Institut für Ökologische
More informationBi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
More information12.05 Galvanic Cells. Zn(s) + 2 Ag + (aq) Zn 2+ (aq) + 2 Ag(s) Ni(s) + Pb 2+ (aq) «Ni 2+ (aq) + Pb(s)
12.05 Galvanic Cells 1. In an operating voltaic cell, reduction occurs A) at the anode B) at the cathode C) in the salt bridge D) in the wire 2. Which process occurs in an operating voltaic cell? A) Electrical
More informationBACTERIA AND ARCHAEA 10/15/2012
BACTERIA AND ARCHAEA Chapter 27 KEY CONCEPTS: Structural and functional adaptations contribute to prokaryotic success Rapid reproduction, mutation, and genetic recombination promote genetic diversity in
More informationIntroduction to Industrial Biotechnology
Introduction to Industrial Biotechnology Lecture 2 - Getting things in and out mechanisms of solute transport across membranes and their application to IBBE Learning outcomes Think about the transporter
More informationProkaryotic Gene Expression (Learning Objectives)
Prokaryotic Gene Expression (Learning Objectives) 1. Learn how bacteria respond to changes of metabolites in their environment: short-term and longer-term. 2. Compare and contrast transcriptional control
More informationENGINEERING APPROACHES TO SHEWANELLA TAXIS STUDIES RUI LI
ENGINEERING APPROACHES TO SHEWANELLA TAXIS STUDIES BY RUI LI A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Chemical
More informationMembrane proteins Porins: FadL. Oriol Solà, Dimitri Ivancic, Daniel Folch, Marc Olivella
Membrane proteins Porins: FadL Oriol Solà, Dimitri Ivancic, Daniel Folch, Marc Olivella INDEX 1. INTRODUCTION TO MEMBRANE PROTEINS 2. FADL: OUTER MEMBRANE TRANSPORT PROTEIN 3. MAIN FEATURES OF FADL STRUCTURE
More informationGenetic Material Uptake in E. Coli
Genetic Material Uptake in E. Coli Christine Watkins 31 March 2015 Lab Group Number: 7 Taylor BIOL 1111: General Biology I Lab Spring 2015 Lab Section: 103 Lab Instructor: Alex Aitken Genetic Material
More informationNovel electrode PtCr/PAA (polyamic acid) for efficient ethanol oxidation reaction
Novel electrode PtCr/PAA (polyamic acid) for efficient ethanol oxidation reaction Jing Zhang Supervisor : mowunmi Sadik Material Science and Engineering & Chemistry Department 11/08/2015 utline Introduction
More informationOxidation numbers are charges on each atom. Oxidation-Reduction. Oxidation Numbers. Electrochemical Reactions. Oxidation and Reduction
Oxidation-Reduction Oxidation numbers are charges on each atom. 1 2 Electrochemical Reactions Oxidation Numbers In electrochemical reactions, electrons are transferred from one species to another. In order
More informationMetabolic diversity is based on the Electron donors, acceptors, and carbon sources available - thermodynamics
To date you have covered microbial community sampling using molecular techniques to identify who is present in the environment. You have also looked at various genetic mechanisms to understand how organisms
More informationMOLECULAR MECHANISMS INVOLVED IN METAL BIOACCUMULATION
UNIVERSITY OF BUCHAREST FACULTY OF CHEMISTRY DOCTORAL SCHOOL OF CHEMISTRY MOLECULAR MECHANISMS INVOLVED IN METAL BIOACCUMULATION Ph. D. THESIS ABSTRACT Defendant, Lavinia Liliana Ruţă (Cocîrlă) Academic
More informationMETABOLISM CHAPTER 04 BIO 211: ANATOMY & PHYSIOLOGY I. Dr. Lawrence G. Altman Some illustrations are courtesy of McGraw-Hill.
BIO 211: ANATOMY & PHYSIOLOGY I CHAPTER 04 1 Please wait 20 seconds before starting slide show. Mouse click or Arrow keys to navigate. Hit ESCAPE Key to exit. CELLULAR METABOLISM Dr. Lawrence G. Altman
More informationCELL METABOLISM OVERVIEW Keep the big picture in mind as we discuss the particulars!
BIO 211: ANATOMY & PHYSIOLOGY I CHAPTER 04 CELLULAR METABOLISM 1 Please wait 20 seconds before starting slide show. Mouse click or Arrow keys to navigate. Hit ESCAPE Key to exit. Dr. Lawrence G. Altman
More informationRedox reactions Revision galvanic cells and fuel cells Lesson 7 Revise fuel cells by visiting the link below. www.dynamicscience.com.au/tester/solutions1/chemistry/redox/fuelcl.html 1) A fuel cell uses
More informationSUMMER RESEARCH INTERNSHIP PROGRAM JUNE AND JULY 2014
Natural Science Study Programs (taught in German) Biology (BA) Biochemistry (BA/MA) Chemistry (BA/MA) Chemistry and Management (BA/MA) Chemical Engineering (BA) Physics (BA/MA) Physics and Management (BA/MA)
More informationCell Respiration: Energy for Plant Metabolism
Cell Respiration: Energy for Plant Metabolism Glucose is the originating molecule for respiration Production and consumption of ATP Coupled reactions: Endergonic reactions are coupled to exergonic ones
More informationThe Effect of Inhibitors on the Electron-transport Chain of Bacillus brevis. Evidence for Branching of the NADH Oxidase Respiratory Chain
386 Journal of General Microbiology (1974), 84,386-39 Printed in Great Britain The Effect of Inhibitors on the Electron-transport Chain of Bacillus brevis. Evidence for Branching of the NADH Oxidase Respiratory
More informationTopic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
More informationAP Bio-Ms.Bell Unit#3 Cellular Energies Name
AP Bio-Ms.Bell Unit#3 Cellular Energies Name 1. Base your answer to the following question on the image below. 7. Base your answer to the following question on Which of the following choices correctly
More informationEnergy for Life 12/11/14. Light Absorption in Chloroplasts
Energy for Life Biochemical pathways A series of reactions where the products of one reaction is used in the next reaction Light Absorption in Chloroplasts Chloroplasts Two membranes Grana- layered stacks
More informationD. Combinatorial transcriptional control. Complex eukaryotic promoter
D. Combinatorial transcriptional control Complex bacterial s with multiple inputs: Complex eukaryotic [Davidson et al] 1 Mechanisms of complex transcriptional control? specific, complex protein-protein
More informationLast time: Obtaining information from a cloned gene
Last time: Obtaining information from a cloned gene Objectives: 1. What is the biochemical role of the gene? 2. Where and when is the gene expressed (transcribed)? 3. Where and when is the protein made?
More information2. With the help of diagram explain the Edison s discovery of thermionic emission. Mention the observations and the conclusion.
Work Sheet - 1 1. Explain the following terms i) Bound Electrons ii) Conduction/free electrons iii) Work function iv) Thermionic emission 2. With the help of diagram explain the Edison s discovery of thermionic
More informationVital Statistics Derived from Complete Genome Sequencing (for E. coli MG1655)
We still consider the E. coli genome as a fairly typical bacterial genome, and given the extensive information available about this organism and it's lifestyle, the E. coli genome is a useful point of
More informationNeurons and the membrane potential. N500 John Beggs 23 Aug, 2016
Neurons and the membrane potential N500 John Beggs 23 Aug, 2016 My background, briefly Neurons Structural elements of a typical neuron Figure 1.2 Some nerve cell morphologies found in the human
More informationModeling and Simulation in Medicine and the Life Sciences
Frank C. Hoppensteadt Charles S. Peskin Modeling and Simulation in Medicine and the Life Sciences Second Edition With 93 Illustrations fyj Springer Contents Series Preface Preface vii ix Introduction 1
More informationEv e ry living c e l l needs a source of
12 Photosynthesis and Cellular Respiration Ev e ry living c e l l needs a source of energy. Without energy, metabolism all of the chemical reactions that occur within cells will not occur. In this activity,
More informationOrigami Organelles tm
Mighty Mitochondria Cat no OO-001 Origami Organelles tm 折り紙オルガネラ We d love to hear any feedback, comments or questions you have! Post: Discovering DNA Ltd, PO Box 280 Hertford, SG13 9DG, UK email: info@
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More informationSPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
More informationETC/CHEMIOSIS. By: Leslie, Kelsey, Morgan
ETC/CHEMIOSIS By: Leslie, Kelsey, Morgan WHY THIS IS IMPORTANT House Clip SO3E7 The Son of a Coma Guy- Time: 32:00 Patient was visiting his father who was in a vegetative state for 10 years, and his only
More informationAntibiotic resistance: a real and present danger in our hospitals
Antibiotic resistance: a real and present danger in our hospitals http://www.latimes.com/business/la-fi-hospital-infections-20150218-story.html#page=1 2 The search for new antibacterials HTS based on genetically
More informationMONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4. Functional Anatomy of Prokaryotic and Eukaryotic Cells
MONTGOMERY COUNTY COMMUNITY COLLEGE BIO 140 CHAPTER 4 Functional Anatomy of Prokaryotic and Eukaryotic Cells I. PROKARYOTES A. Structure Of The Cell: Chemical Composition And Function 1. Cell Wall a. composition
More informationCarbon and electron fluxes during the electricity driven 1,3-propanediol biosynthesis. from glycerol
1 2 3 4 Supporting Information Carbon and electron fluxes during the electricity driven 1,3-propanediol biosynthesis from glycerol Mi Zhou,, Jingwen Chen, Stefano Freguia,, Korneel Rabaey #,,, Jürg Keller,
More informationSubsystem: Succinate dehydrogenase
Subsystem: Succinate dehydrogenase Olga Vassieva Fellowship for Interpretation of Genomes The super-macromolecular respiratory complex II (succinate:quinone oxidoreductase) couples the oxidation of succinate
More informationCHAPTER : Prokaryotic Genetics
CHAPTER 13.3 13.5: Prokaryotic Genetics 1. Most bacteria are not pathogenic. Identify several important roles they play in the ecosystem and human culture. 2. How do variations arise in bacteria considering
More informationIntroduction to Microbiology. CLS 212: Medical Microbiology Miss Zeina Alkudmani
Introduction to Microbiology CLS 212: Medical Microbiology Miss Zeina Alkudmani Microbiology Micro- means very small (that needs a microscope to see). Microbiology is the study of very small living organisms.
More informationAN ABSTRACT OF THE THESIS OF
AN ABSTRACT OF THE THESIS OF Robert G. Hall for the degree of Master of Science in Biological and Ecological Engineering presented on August 3, 2011. Title: Metabolic Engineering of Shewanella oneidensis
More informationIntroductory Microbiology Dr. Hala Al Daghistani
Introductory Microbiology Dr. Hala Al Daghistani Why Study Microbes? Microbiology is the branch of biological sciences concerned with the study of the microbes. 1. Microbes and Man in Sickness and Health
More informationFoundational Work in Bioelectrochemical Anaerobic Reactor Design with Electron Mediators
Brigham Young University BYU ScholarsArchive All Theses and Dissertations 2013-03-22 Foundational Work in Bioelectrochemical Anaerobic Reactor Design with Electron Mediators Christopher D. Hoeger Brigham
More informationREGULATION OF GENE EXPRESSION. Bacterial Genetics Lac and Trp Operon
REGULATION OF GENE EXPRESSION Bacterial Genetics Lac and Trp Operon Levels of Metabolic Control The amount of cellular products can be controlled by regulating: Enzyme activity: alters protein function
More informationLife 21 - Aerobic respiration Raven & Johnson Chapter 9 (parts)
1 Life 21 - Aerobic respiration Raven & Johnson Chapter 9 (parts) Objectives 1: Describe the overall action of the Krebs cycle in generating ATP, NADH and FADH 2 from acetyl-coa 2: Understand the generation
More informationState state describe
Warm-Up State the products of the light-dependent reaction of photosynthesis, state which product has chemical energy, and describe how that product is made. KREBS ETC FADH 2 Glucose Pyruvate H 2 O NADH
More informationFind the oxidation numbers of each element in a reaction and see which ones have changed.
Find the oxidation numbers of each element in a reaction and see which ones have changed. Rules for oxidation numbers: An element that is not in a compound has an oxidation number of zero (0) Group 1 Metals
More informationMITOCW watch?v=0xajihttcns
MITOCW watch?v=0xajihttcns The following content is provided under a Creative Commons license. Your support will help MIT OpenCourseWare continue to offer high quality educational resources for free. To
More informationSupporting Information
Supporting Information Sana et al. 10.1073/pnas.1608858113 Fig. S1. Representation of the SPI-6 type VI secretion system. (A) Representation of the SPI-6 genetic locus starting at STM0266 and ending at
More informationConnecticut State Department of Education Science - Core Curriculum Standards High School Grades 9-12
Connecticut State Department of Education Science - Core Curriculum Standards High School Grades 9-12 Essential Questions Scientific Inquiry, Literacy and Numeracy How is scientific knowledge created and
More informationUnit 1: Metabolic Processes
1 Unit 1: Metabolic Processes 1. Describe the structure and function of the macromolecules necessary for the normal metabolic functions of all living things, and the role of enzymes in maintaining normal
More informationBiofilm formation by Shewanella oneidensis MR-1 towards fundamental understanding of anode respiring communities
University of New Mexico UNM Digital Repository Nanoscience and Microsystems ETDs Engineering ETDs 1-31-2013 Biofilm formation by Shewanella oneidensis MR-1 towards fundamental understanding of anode respiring
More informationChapter 6. Summary and Outlook
Chapter 6 100 Summary and Outlook Summary: Pathways for Protein-DNA Charge Transfer 101 The experiments described in the preceding chapters examined the chargetransfer (CT) properties of several site-directed
More information