Supplementary Information for. Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria

Transcription

1 Supplementary Information for Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria Isabella Santi 1 *, Neeraj Dhar 1, Djenet Bousbaine 1, Yuichi Wakamoto, John D. McKinney 1 1 School of Life Sciences, Swiss Federal Institute of Technology in Lausanne (EPFL), 115 Lausanne, Switzerland. Research Center for Complex Systems Biology, University of Tokyo, Komaba, Meguro-ku, Tokyo , Japan. Present address: Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 139 USA. *To whom correspondence should be addressed. isabella.santi@epfl.ch 1

2 a Septum position (µm) c FM- (n = 9) Cell length (µm) Phase Wag31-GFP (n = 37) Cell length (µm) Fluorescence b % of cell length FM- (n = 9) Cell length (µm) Pre-bleach Post-bleach Wag31-GFP (n = 37) Cell length (µm) Postcompartmentalization Precompartmentalization d 7 Compartmentalization + e 1 Compartmentalization + f (3) Time (min) Distal bleaching (%) 5 () Mycobacterial cell division cycle (1) () FI of FM- (AU) FI of FM- (AU) Supplementary Figure S1. Wag31-GFP colocalizes with FM--stained septa. (a,b) Time-lapse microscopy of bacteria expressing Wag31-GFP and stained with the fluorescent membrane dye FM-. Images recorded at 1-min intervals. This experiment was repeated two times with similar results. (a) Position of septal FM- (left panel, n = 9) or septal Wag31-GFP (right panel, n = 37) versus the total cell length. Red line, data fitted to a linear function. Blue line, theoretical fit if septum were placed exactly at the mid-cell position. (b) Position of septal FM- (left panel, n = 9) or septal Wag31-GFP (right panel, n = 37) as a percentage of cell length versus the total cell length. (c-f) Time-lapse microscopy of bacteria expressing cytosolic GFP and stained with the fluorescent membrane dye FM-. Images recorded at 1-min intervals. This experiment was repeated two times with similar results. (c) Representative FLiP (fluorescence loss in photobleaching) experiments showing examples of a mother cell pre-compartmentalization (lower panels) and four sibling

3 cells post-compartmentalization (upper panels). Phase-contrast and fluorescence images recorded before and after photobleaching with a laser pulse. White circles ("Phase" panels) indicate foci of the bleaching laser. "Fluorescence" panels represent the GFP and FM- channels. "Pre-bleach" and "Post-bleach" panels represent the FM- channel. Arrows, polar FM- signals. Arrowheads (upper panels), septal FM- staining. Scale bar, 3 µm. (d) Time-dependent increase in FI FM- (n = 5). Red shading indicates that sibling cells are compartmentalized. (e) Percent decrease in fluorescence intensity in the distal half of the cell versus fluorescence intensity of septal FM- (FI FM- ) in arbitrary units (AU). Black symbols, bleached cells. Red symbols, control cells adjacent to bleached cells. Vertical dotted line, FI FM- corresponding to compartmentalization of sibling cells. Black dotted line, fitting of the data to a sigmoidal dose-response curve (R =.78). (f) Schematic of the mycobacterial cell division cycle. (1) Cytokinesis (cytoplasmic compartmentalization) of sibling cells coincides with localization of Wag31-GFP (green) to the FM--stained septum (red). () Cell separation occurs when sibling cells detach from each other and initiate elongation from the newly formed cell poles. (3) Early stage of septation, indicated by first appearance of FM--stained membrane invaginations near midcell. () Late stage of septation, indicated by extension of FM--stained membrane across the midcell. The interdivision time is defined as the time interval between two consecutive cytokinesis events marked by Wag31-GFP localization to the septum. 3

4 a b c Pole1 Pole Pole elongation (µm) P =.8 (n = 35) 3 1 Pole 1 Pole Polar elongation (µm) P =.1 (n = 5) Old-pole New-Pole Supplementary Figure S. Growth of single cells is bipolar. (a) Schematic of pulse-chase assay used to measure elongation from cell poles. Cells are surface-labeled with amine-reactive dye (dark green) and extension of the unlabeled region (light green) is measured by time-lapse microscopy (red doubleheaded arrows), as described 15. (b,c) Time-lapse microscopy of bacteria expressing Wag31-mCherry (b) or nonfluorescent wild-type bacteria (c). Images recorded at 1-min intervals. (b) Pole elongation of 35 randomly selected single cells during the time interval from the first frame of the movie until the first detectable localization of Wag31-mCherry to the nascent division septum. Because it is not possible to assign ages to the poles they are arbitrarily designated "Pole 1" and "Pole ". Dotted lines connect the symbols representing the two poles of the same cell. Wilcoxon matched-pairs signed rank test, P =.8. (c) Pole elongation of the old pole versus the new pole of 5 randomly selected single cells during the interval between two consecutive cell separation events. Mann-Whitney rank sum test, P =.1.

5 a 15 P <.1 (n = 15) b P =.5 (n = 15) L d (µm) 1 5 Interdivision time (h) c 8 Old-pole New-pole P <.1 (n = 15) d Old-pole New-pole P <.1 (n = 15) (L d -L b ) (µm) L d /L b 3 1 Old-pole New-pole Old-pole New-pole Supplementary Figure S3. Single-cell growth parameters of sibling cell pairs. (a-d) Time-lapse microscopy of bacteria expressing Wag31-GFP. Images recorded at 1-min intervals. Localization of Wag31-GFP fluorescence to the septum coincides with cytokinesis of the mother cell and birth of the daughter cells. Interdivision time is defined as the interval between two consecutive cytokinesis events. Red bars represent mean ± SD. P values, Welch's t-test (n = 15 sibling pairs). (a) Cell length at division (L d ) for old-pole and new-pole sibling cells. P <.1. (b) Interdivision time of old-pole and new-pole sibling cells. P =.5. (c) Cell elongation length between two consecutive cytokinesis events (L d L b ) for old-pole and new-pole sibling cells. P <.1. (d) Ratio of length at birth (L b ) and length at division (L d ) for old-pole and new-pole sibling cells. P <.1. 5

6 a L b (µm) c P <.1 P < Cell pole age (new-old) b Elongation velocity (µm/h) d P <.1 P < Cell pole age (new-old) Elongation rate (/h) 1..5 Interdivision time (h) Cell pole age (new-old) Cell pole age (new-old) Supplementary Figure S. Single-cell growth and division parameters in cells with different pole ages. (a-d) Time-lapse microscopy of bacteria expressing Wag31-GFP. Images recorded at 1-min intervals. Localization of Wag31-GFP fluorescence to the septum coincides with cytokinesis of the mother cell and birth of the daughter cells. Interdivision time is defined as the interval between two consecutive cytokinesis events. Red bars represent mean ± SD. P values, Welch's t-test (n = 11 sibling pairs). Pole ages increase by one at each division starting with pole age for the cell pole generated by the most recent division. (a) Cell length at birth (L b ). P <.1 comparing pole age -1 versus - and - versus -3. (b) Cell elongation velocity (µm/h) averaged over the time interval between two consecutive cytokinesis events (from birth to next division). P <.1 comparing pole age -1 versus -. P <.1 comparing pole age - versus -3. (c) Cell elongation rate (/h) averaged over the time interval between two consecutive cytokinesis events (from birth to next division). (d) Interdivision times.

7 Supplementary Figure S5. Representative pedigree tree illustrating the timing of DNA replication and cytokinesis. Time-lapse microscopy of bacteria expressing mcherry-dnan and Wag31-GFP. Images recorded at 1-min intervals. The pedigree tree represents the behavior of all of the descendants of a common progenitor cell through five generations. Black vertical lines represent the interdivision time defined by two successive cytokinesis events marked by localization of Wag31-GFP to the septum. Red vertical lines indicate the C period defined by appearance and disappearance of diffraction-limited foci of mcherry-dnan. In the majority of cells (indicated by an asterisk), chromosome replication initiates before cytokinesis of the mother cell, i.e., appearance of a diffraction-limited focus of mcherry-dnan precedes localization of Wag31-GFP to the septum. However, this relationship is not absolute and in some cells cytokinesis (marked by localization of Wag31-GFP to the septum) occurs prior to initiation of DNA replication (marked by appearance of a diffraction-limited focus of mcherry-dnan). 7

8 a b c d e Supplementary Figure S. Non-canonical organization of the chromosome replication and cell division cycles. (a-e) Time-lapse microscopy of bacteria expressing mcherry-dnan and Wag31- GFP. Images recorded at 1-min intervals (n = 15 cells). Localization of Wag31- GFP fluorescence to the septum coincides with cytokinesis of the mother cell and birth of the daughter cells. Interdivision time is defined as the interval between two consecutive cytokinesis events. The C period is defined as the interval between appearance and disappearance of mcherry-dnan foci. The B period is defined as the interval between cytokinesis and initiation of the C period; in the majority of cells, this value is negative because initiation of the C period (marked by appearance of mcherry-dnan foci) precedes cytokinesis of the mother cell (marked by localization of Wag31-GFP to the septum). The D period is defined as the interval between completion of the C period (marked by disappearance of mcherry-dnan foci) and cytokinesis (marked by localization of Wag31-GFP to the septum). r values, Pearson's correlation coefficients. 8

9 (a) Single-cell durations of the B period (left panel), C period (middle panel), and D period (right panel). Mean values ± SD and % CV of the measured parameters are summarized in Supplementary Table S1. (b) Single-cell interdivision times (left panel) and elongation rates (right panel). Mean values ± SD and % CV of the measured parameters are summarized in Supplementary Table S1. (c) Single-cell B period durations versus interdivision times (left panel, r =.53) and elongation rates (right panel, r= -.3). (d) Single-cell D period durations versus interdivision times (left panel, r =.59) and elongation rates (right panel, r = -.5). (e) Fractional durations of the B, C, and D periods relative to the total duration of the corresponding cell division cycles in single cells binned according to their interdivision times (bin size, 1 min). Bars represent mean values ± SD. Dotted red lines, data fitted to a linear function. 9

10 Supplementary Table S1. Single-cell growth and division parameters of reporter strains expressing Wag31-GFP (marker of cell division septum) and mcherry-dnan (marker of DNA replisome) fusion proteins. Strain: Wag31-GFP (n = 5) mcherry-dnan Wag31-GFP (n = 15) Parameters Mean ± SD CV (%) Mean ± SD CV (%) L b (µm ± SD). ± ±.7 17 L d (µm ± SD) 7.3 ± ± L d /L b 1.8 ± ±.3 13 Interdivision time (min) 17 ± ± 5 Elongation velocity (µm/h) 1.3 ± ±.3 3 Elongation rate (/h) ND ND.7 ±.1 17 B period (min) ND ND 5 ± * 9 C period (min) ND ND 1 ± 7 19 D period (min) ND ND 5 ± Abbreviations: SD, standard deviation; CV, coefficient of variation; L b, length at birth; L d, length at division; ND, not determined. * Negative value reflects the fact that initiation of chromosome replication precedes cytokinesis in the majority of cells, i.e., initiation of the C period of the daughter cell division cycle occurs during the D period of the mother cell division cycle. Thus, at birth, the daughter cell inherits a chromosome that has already been partially replicated. 1

11 Supplementary Table S. Plasmids and oligonucleotides used in this study. Plasmid Name Description Source pcr.1-topo Ap R, Km R. PCR cloning vector. Invitrogen pjg11 pnd35 pnd39 pis1 pis pis5 pis pis3 pis3 pis33 pis3 pbs3 Km R, Hyg R, sacb. Suicide vector containing aph, hyg, and sacb markers. Km R. pmv31-based vector containing GFP expressed from UV15A promoter. Hyg R. pmv31-based vector containing DsRed expressed from UV15A promoter. Km R. pnd35 containing wag31-gfp expressed from UV15A promoter. Km R. pmv31 containing wag31-gfp expressed from hsp promoter. Km R, Hyg R, sacb. pjg11::mcherry_dnan translational fusion for allelic exchange. Km R. pis containing DsRed expressed from UV15A promoter. Km R. pis3-based vector containing wag31- mcherry expressed from UV15A promoter. Km R. pnd35-based vector containing mcherry expressed from UV15A promoter. Km R. pmv31 containing wag31-mcherry expressed from hsp promoter. Km R. pmv3-based vector containing wag31- mcherry expressed from UV15A promoter. Km R, pfa-gfpkan based vector containing mcherry. James Gomez Neeraj Dhar Neeraj Dhar YRC-UW Oligo Name Sequence 5-3 dnan_upf dnan_upr TTAATTAAGGCGGAGTTCATCAACCGCT GGAATATTCACGTCCTATGCGCCCCTTC 11

12 dnan_dnf dnan_dnr m-ch_dnan_f m-ch_dnan_r GGAATATTGGCTCAGCGACGACGACGGCTGGGCT CCGCTCGAGGCCTCGGCCAGCGTCTTCGC GATATCGTGAGCAAGGGCGAGGAGGA GATATCACCTGAGCCCTTGTACAGCTCGTCCATGC DnaN_seq_UPF GTGAGCTCACCGACCTGTCG Mch_DnF Mch_UPR TGGTGTAGTCCTCGTTGTGGGAGGTGAT ATCACCTCCCACAACGAGGACTACACCA DnaN_seq_DnR AAATCCACCGGGAGGTCTTC Wag31_F CAGTGCCGTCGATCATCTTCG Wag31_R GCCAACAACTTTAGCCACTGCA Abbreviations: Ap, ampicillin; GFP, green fluorescent protein; Hyg, hygromycin; Km, kanamycin; YRC-UW, Yeast Research Center, University of Washington. Restriction enzyme sites are underlined. Translation start and stop sites are in bold type. 1