opulation genetics undamentals for SNP datasets
|
|
- Alvin Bell
- 5 years ago
- Views:
Transcription
1 opulation genetics undamentals for SNP datasets with crocodiles) Sam Banks Charles Darwin University
2 I ve got a SNP genotype dataset, now what? Do my data meet the requirements of the analyses I want to do? Identifying babies and bathwater Effects of biological processes and data quality on population genetic patterns Alleles and genotypes Hardy-Weinberg Linkage disequilibrium Do I really have to think about population genetics fundamentals if I have fancier analyses to do?
3
4 Legend Source: Esri, DigitalGlobe, GeoEye, Earthstar Geographics, CNES/Airbus DS, USDA, USGS, AeroGRID, IGN, and the GIS User Community
5 DArTSeq genotypes * * * * * * * DCroc DCroc DCroc16-253DCroc DCroc DCroc16-253DCroc DCroc * * * * * * * 9.09E E E E E E E E+11 * * * * * * * * * * * * * * A F G B H A H B * * * * * * * * * * * * * * none [Originanone [Originanone [Originanone [Originanone [Originanone [Originanone [Originanone [Origina eid AlleleSequenChrom_CrocoChromPos_CrAlnCnt_CrocoAlnEvalue_CrSNP SnpPosition CP0001 CP0005 CP0006 CP0007 CP0009 CP0010 CP0019 CP FTGCAGACCTA :T>C FTGCAGCTCCCKN _ ld E-28 51:G>A F 0-21:T>A-21:T>A TGCAGCTCCTGGGTCTGGTTATGAGTGTGGGTTGTGGGGCACCATGGAAGGATGTGAGGCAGGCCAGGA KN _scaffold E-28 21:T>A F 0-65:G>A-65:G>A TGCAGGCGCGGCGTATCGTGGGATGGAGTGAGGCACCGCAGCGCGGGGCATGAGCGGTTCAGCAGGAAT :G>A F 0-11:G>A-11:G>A TGCAGAGGAGCGAGGGAGTGGCTTGGGCCGTGTGTTGGAGAATGAGATGCATGAGCGGTTCAGCAGGAA :G>A F 0-20:C>G-20:C>G TGCAGCAATGGTGATTCTGGCCAGCAGCCACAGTGTGGCTCTGGGCAGCCTGGCTGTGCTTTTGAGTGG JRXG _scaffold-6215_ E-28 20:C>G F 0-66:T>C-66:T>C TGCAGCAGCCCTAGGAATTAACTCCAGATCCCCAAATCCCTTTCCAGGACCTTAAATCACACGCCTTGC KN _scaffold E-27 66:T>C F 0-46:T>C-46:T>C TGCAGCATACAGCCATGGCACAGGGTGTGTCCCCCTGCCCGCCTCCTATGTGGCGCTCTGTGGCTGCAT :T>C F 0-51:C>T-51:C>T TGCAGGGAGAGGAGCGAGGCTGTCCTCGCCCCGGGGAGATGCGCGCCTTGCCCCCCCTTGCCCCGTCAC KN _scaffold E-28 51:C>T F 0-11:G>C-11:G>C TGCAGAAAAAAGGACCTGGGGGTTACAGTAGACAATAAGCTGAATTTAAGCTAACAGCATGAGCGGTTC KN _scaffold E-24 11:G>C F 0-12:C>T-12:C>T TGCAGAAAAAGACCAGTGGGTCACAGTGGGCAATAAGCTGGATATGAGTCAACAGTGCGCCATTGTTGT KN _scaffold E-28 12:C>T F 0-54:C>A-54:C>A TGCAGAAAAATCTACCCAGTGTTCAGATCTTCTTCCTCAACCATTTTTTCTGGGCCAGAGATTCATTTC KN _scaffold E-27 54:C>A F 0-14:G>A-14:G>A TGCAGAAAAGGACCGGGGGGGGTTACAGTGAACAATAAGCAGCATGAGCGGTTCAGCAGGAATGCCGAG :G>A F 0-41:A>T-41:A>T TGCAGAAAAGGACCTGGGAGTTACCGTGGAGAATAAGCTGGATATGAGTCAGCAGCATGAGCGGTTCAG KN _scaffold E-23 41:A>T F 0-52:C>A-52:C>A TGCAGAAAAGGAGCTGGGGGTTACAGTGGACAATAACCTGAATATGAGCCAGCAGTGTACCCTTTTTGC KN _scaffold E-28 52:C>A F 0-9:T>C-9:T>C TGCAGAAAATTACTACCTTGTATATATAGAAGAACTCTTGCTGTGAAAGTGGACAGAAGATAGAACCAT KN _scaffold E-28 9:T>C F 0-51:G>A-51:G>A TGCAGAAACAAGGAGATATTTTTTTCTTCTTTTTGCCTTTCAAGCAAGGTAGATACCTTATTCTGGGGC KN _scaffold E-28 51:G>A F 0-34:G>C-34:G>C TGCAGAAACAGGCGGCAGATGCTGGGTTTCCATAGAGCTCTAAAGGAATCAGCATAAAAAGAGAAAATA KN _scaffold E-28 34:G>C F 0-63:G>T-63:G>T TGCAGAAACCAGTTGGGGTGGAAGGGAAGGCGCAGTACCCTTTAGCATTGCTTGGGTCAGCTTGTGTGA KN _scaffold E-28 63:G>T F 0-31:A>G-31:A>G TGCAGAAACTCTCACATTAACTTGTGCACCAAGCAGAAAAGCATGAGCGGTTCAGCAGGAATGCCGAGA :A>G F 0-58:T>C-58:T>C TGCAGAAACTCTTATGAAGAAAACTAGCTGATTTTTGCCCATCAAGAATGACTGGGGGTGGGGACAGTG KN _scaffold E-27 58:T>C F 0-44:G>A-44:G>A TGCAGAAAGACAGACATTGCCAGGGTGAAATGCAGCACTCCCGCGGCAGCATGAGCGGTTCAGCAGGAA :G>A F 0-25:C>T-25:C>T TGCAGAAAGCCAGATGACTTTGCCACGGGGTCACTGCCTCCTCTGTAACCCTCCCTGCCCCTGGTGCAC KN _scaffold E-28 25:C>T F 0-18:G>T-18:G>T TGCAGAAAGGGCAAACATGGAGCTTGTGGTGTGGCTGAAAGGAAGTAAAGAGGTGATCACTCTGGGGGT KN _scaffold E-28 18:G>T F 0-24:C>T-24:C>T TGCAGAAATTCACAGGGAGCAAAACGCTAAAAACAGACTTGGCTCCTTTGCTACTTATTCTCAGTTACT KN _scaffold E-28 24:C>T x 700 samples x SNPs
6 Are our data fit for purpose? What do we want from our dataset? (Population genetics bias) Homologous, informative loci Accurate genotypes Independent loci for pop genetics studies
7 How do we find out if that s what we ve got in our dataset?
8 Some population genetics fundamentals We re usually starting with a with a bunch of called genotypes AA, AB, BB 0,1,2 We can measure genetic diversity at the level of alleles: Freq of allele A (p) Freq of allele B (q) Typically measured from observed genotypes
9 Hardy-Weinberg expected genotype proportions can be useful for data exploration Hardy-Weinberg expected genotype proportions F(AA) = p 2 F(AB) = 2pq F(BB) = q 2
10 Deviations from H-W genotype proportions can indicate: Genotyping errors You re not actually looking at homologous, Mendelian etc loci As well as a bunch of interesting biological processes: Random mating Infinite population (no sampling error) No migration No mutation No selection Plus some others like non-overlapping generations
11 Deviations from H-W genotype proportions can indicate: Boring stuff for filtering Genotyping errors You re not actually looking at homologous, Mendelian etc loci As well as a bunch of interesting biological processes: Random mating Infinite population (no sampling error) No migration No mutation No selection Plus some others like non-overlapping generations Cool stuff you want to study
12 Deviations from H-W genotype proportions can indicate: Genotyping errors You re not actually looking at homologous, Mendelian etc loci As well as a bunch of interesting biological processes: Random mating Infinite population (no sampling error) No migration No mutation No selection Plus some others like non-overlapping generations
13 What would HWE look like in crocs? Define sub-population units that might approximate random mating assumption
14 Simulated croc genotypes (under HWE assumptions and observed allele freqs WITHIN sub-populations) Ho f(a) Ho He Hs FIS F IS = (H S H O )/H S
15 HO Real data f(a) HO Mean HS Mean HS FIS
16 Getting your expectations correct wrt population structure Given mean Ho = Sub-populations Mean H S (loci and sub-populations) = Total population Mean H T = F ST = (H T mean H S ) / H T = 0.08 (represents structure among sub-pops) Mean F IS = Mean F IT = 0.178
17 What if I filtered on HWE on the wrong scale? (Incorrect expectations) F ST = 0.08 F ST = 0.03
18 Sometimes you have no idea of expected population genetic patterns Given mean Ho = 0.157
19 So, where to start with filtering? I think HWE criteria are lousy filtering metrics unless you don t want to discover anything unexpected in your data But you can use H-W metrics to explore data quality effects on biological signals And you can explore your data in other ways
20 Reference genomes provide some useful context
21 Frequency Frequency Croc genome assembly is pretty basic But still enables filtering on e-value and alignment count criteria SNPs mapped to crocodile genome. BUT Mapped to 6610 separate scaffolds Alignment Count Alignment Count E value E value
22 Ho Reference genomes are handy for filtering Filtering to mapped reads plus e-value and alignment count criteria Allele frequency Ho vs He Ho He mean FISHs
23 Frequency Frequency Mean HO Density Mean FIS What about basic SNP quality metrics? Call Rate Basic SNP info and pop gen stats post filter ing on mapping criteria RepAvg Depth Mean FIS vs Mean HS Depth (density plot) Ref/SNP depth ratio Depth MAF Ratio of seq depth of alleles Mean HO Mean vs HS Mean HS Mean HS Mean MAFHO Mean FIS
24 Metrics associated with under-calling heterozygotes? FIS FIS by Sequence Depth Depth FIS Call Rate
25 Frequency Frequency Mean HO Density Mean FIS Allelic dropout due to cut site polymorphism? Call Rate Basic SNP info and pop gen stats post filter ing on mapping criteria RepAvg Depth Mean FIS vs Mean HS Depth (density plot) Ref/SNP depth ratio Depth MAF Ratio of seq depth of alleles Mean HO Mean vs HS Mean HS Mean HS Mean MAFHO Mean FIS
26 Filtering on basic quality metrics Depth (incl. ratio among alleles), Call Rate, repeatability, MAF) Down to ~3,000 SNPs Ho Allele frequency Ho vs He Ho mean Hs He FIS
27 (I left out anything about linkage filtering )
28 F Some biological patterns in the pop gen metrics too F M Body Length (m) Big crocodiles tend to be more inbred. Legacy of past hunting impacts?
29 r Strong spatial structure, but over a large scale 0.14 Spatial autocorrelation of multilocus genotypes r U L Interval (Km)
30 Admixture analysis (LEA)
31 Take home messages Don t skip the undergrad-level stuff Graphical visualisations are REALLY useful Explore associations between data quality indices and pop gen metrics Try to avoid forcing your data to look nice
Population Genetics I. Bio
Population Genetics I. Bio5488-2018 Don Conrad dconrad@genetics.wustl.edu Why study population genetics? Functional Inference Demographic inference: History of mankind is written in our DNA. We can learn
More information8. Genetic Diversity
8. Genetic Diversity Many ways to measure the diversity of a population: For any measure of diversity, we expect an estimate to be: when only one kind of object is present; low when >1 kind of objects
More informationQuestion: If mating occurs at random in the population, what will the frequencies of A 1 and A 2 be in the next generation?
October 12, 2009 Bioe 109 Fall 2009 Lecture 8 Microevolution 1 - selection The Hardy-Weinberg-Castle Equilibrium - consider a single locus with two alleles A 1 and A 2. - three genotypes are thus possible:
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 009 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results
More information1.5.1 ESTIMATION OF HAPLOTYPE FREQUENCIES:
.5. ESTIMATION OF HAPLOTYPE FREQUENCIES: Chapter - 8 For SNPs, alleles A j,b j at locus j there are 4 haplotypes: A A, A B, B A and B B frequencies q,q,q 3,q 4. Assume HWE at haplotype level. Only the
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 007 Population genetics Outline of lectures 3-6 1. We want to know what theory says about the reproduction of genotypes in a population. This results
More informationChapter 6 Linkage Disequilibrium & Gene Mapping (Recombination)
12/5/14 Chapter 6 Linkage Disequilibrium & Gene Mapping (Recombination) Linkage Disequilibrium Genealogical Interpretation of LD Association Mapping 1 Linkage and Recombination v linkage equilibrium ²
More informationTsunami Simulations after the Mw7.5 78km N of Palu, Indonesia September 28, 2018
Tsunami Simulations after the Mw7.5 78km N of Palu, Indonesia September 28, 2018 Luisa Urra, Erick Mas, Luis Moya, Shunichi Koshimura LABORATORY OF REMOTE SENSING AND GEOINFORMATICS FOR DISASTER MANAGEMENT
More informationLecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency
Lecture 1 Hardy-Weinberg equilibrium and key forces affecting gene frequency Bruce Walsh lecture notes Introduction to Quantitative Genetics SISG, Seattle 16 18 July 2018 1 Outline Genetics of complex
More informationIntroduction to Linkage Disequilibrium
Introduction to September 10, 2014 Suppose we have two genes on a single chromosome gene A and gene B such that each gene has only two alleles Aalleles : A 1 and A 2 Balleles : B 1 and B 2 Suppose we have
More informationEXERCISES FOR CHAPTER 3. Exercise 3.2. Why is the random mating theorem so important?
Statistical Genetics Agronomy 65 W. E. Nyquist March 004 EXERCISES FOR CHAPTER 3 Exercise 3.. a. Define random mating. b. Discuss what random mating as defined in (a) above means in a single infinite population
More informationOutline of lectures 3-6
GENOME 453 J. Felsenstein Evolutionary Genetics Autumn, 013 Population genetics Outline of lectures 3-6 1. We ant to kno hat theory says about the reproduction of genotypes in a population. This results
More informationPopulation Genetics. with implications for Linkage Disequilibrium. Chiara Sabatti, Human Genetics 6357a Gonda
1 Population Genetics with implications for Linkage Disequilibrium Chiara Sabatti, Human Genetics 6357a Gonda csabatti@mednet.ucla.edu 2 Hardy-Weinberg Hypotheses: infinite populations; no inbreeding;
More information1 Springer. Nan M. Laird Christoph Lange. The Fundamentals of Modern Statistical Genetics
1 Springer Nan M. Laird Christoph Lange The Fundamentals of Modern Statistical Genetics 1 Introduction to Statistical Genetics and Background in Molecular Genetics 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
More informationAEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity,
AEC 550 Conservation Genetics Lecture #2 Probability, Random mating, HW Expectations, & Genetic Diversity, Today: Review Probability in Populatin Genetics Review basic statistics Population Definition
More informationProblems for 3505 (2011)
Problems for 505 (2011) 1. In the simplex of genotype distributions x + y + z = 1, for two alleles, the Hardy- Weinberg distributions x = p 2, y = 2pq, z = q 2 (p + q = 1) are characterized by y 2 = 4xz.
More informationEvolutionary Genetics Midterm 2008
Student # Signature The Rules: (1) Before you start, make sure you ve got all six pages of the exam, and write your name legibly on each page. P1: /10 P2: /10 P3: /12 P4: /18 P5: /23 P6: /12 TOT: /85 (2)
More informationBTRY 7210: Topics in Quantitative Genomics and Genetics
BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu February 12, 2015 Lecture 3:
More informationGenetics and Natural Selection
Genetics and Natural Selection Darwin did not have an understanding of the mechanisms of inheritance and thus did not understand how natural selection would alter the patterns of inheritance in a population.
More informationIntroduction to Natural Selection. Ryan Hernandez Tim O Connor
Introduction to Natural Selection Ryan Hernandez Tim O Connor 1 Goals Learn about the population genetics of natural selection How to write a simple simulation with natural selection 2 Basic Biology genome
More informationNOTES CH 17 Evolution of. Populations
NOTES CH 17 Evolution of Vocabulary Fitness Genetic Drift Punctuated Equilibrium Gene flow Adaptive radiation Divergent evolution Convergent evolution Gradualism Populations 17.1 Genes & Variation Darwin
More informationProcesses of Evolution
15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection
More informationDepartment of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China;
Title: Evaluation of genetic susceptibility of common variants in CACNA1D with schizophrenia in Han Chinese Author names and affiliations: Fanglin Guan a,e, Lu Li b, Chuchu Qiao b, Gang Chen b, Tinglin
More information(Genome-wide) association analysis
(Genome-wide) association analysis 1 Key concepts Mapping QTL by association relies on linkage disequilibrium in the population; LD can be caused by close linkage between a QTL and marker (= good) or by
More informationMechanisms of Evolution
Mechanisms of Evolution 36-149 The Tree of Life Christopher R. Genovese Department of Statistics 132H Baker Hall x8-7836 http://www.stat.cmu.edu/ ~ genovese/. Plan 1. Two More Generations 2. The Hardy-Weinberg
More informationMicrosatellite data analysis. Tomáš Fér & Filip Kolář
Microsatellite data analysis Tomáš Fér & Filip Kolář Multilocus data dominant heterozygotes and homozygotes cannot be distinguished binary biallelic data (fragments) presence (dominant allele/heterozygote)
More informationPopulation genetics snippets for genepop
Population genetics snippets for genepop Peter Beerli August 0, 205 Contents 0.Basics 0.2Exact test 2 0.Fixation indices 4 0.4Isolation by Distance 5 0.5Further Reading 8 0.6References 8 0.7Disclaimer
More informationFei Lu. Post doctoral Associate Cornell University
Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.
More informationNotes on Population Genetics
Notes on Population Genetics Graham Coop 1 1 Department of Evolution and Ecology & Center for Population Biology, University of California, Davis. To whom correspondence should be addressed: gmcoop@ucdavis.edu
More informationFriday Harbor From Genetics to GWAS (Genome-wide Association Study) Sept David Fardo
Friday Harbor 2017 From Genetics to GWAS (Genome-wide Association Study) Sept 7 2017 David Fardo Purpose: prepare for tomorrow s tutorial Genetic Variants Quality Control Imputation Association Visualization
More informationThe Genetics of Natural Selection
The Genetics of Natural Selection Introduction So far in this course, we ve focused on describing the pattern of variation within and among populations. We ve talked about inbreeding, which causes genotype
More informationEvolution and the Genetics of Structured populations. Charles Goodnight Department of Biology University of Vermont
Evolution and the Genetics of Structured populations Charles Goodnight Department of Biology University of Vermont Outline What is Evolution Evolution and the Reductionist Approach Fisher/Wright Controversy
More informationEvolution (Chapters 15 & 16)
Evolution (Chapters 15 & 16) Before You Read... Use the What I Know column to list the things you know about evolution. Then list the questions you have about evolution in the What I Want to Find Out column.
More informationIntroduction to Wright-Fisher Simulations. Ryan Hernandez
Introduction to Wright-Fisher Simulations Ryan Hernandez 1 Goals Simulate the standard neutral model, demographic effects, and natural selection Start with single sites, and build in multiple sites 2 Hardy-Weinberg
More informationCase-Control Association Testing. Case-Control Association Testing
Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits. Technological advances have made it feasible to perform case-control association studies
More informationSTAT 536: Migration. Karin S. Dorman. October 3, Department of Statistics Iowa State University
STAT 536: Migration Karin S. Dorman Department of Statistics Iowa State University October 3, 2006 Migration Introduction Migration is the movement of individuals between populations. Until now we have
More informationLECTURE # How does one test whether a population is in the HW equilibrium? (i) try the following example: Genotype Observed AA 50 Aa 0 aa 50
LECTURE #10 A. The Hardy-Weinberg Equilibrium 1. From the definitions of p and q, and of p 2, 2pq, and q 2, an equilibrium is indicated (p + q) 2 = p 2 + 2pq + q 2 : if p and q remain constant, and if
More informationHomework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics:
Homework Assignment, Evolutionary Systems Biology, Spring 2009. Homework Part I: Phylogenetics: Introduction. The objective of this assignment is to understand the basics of phylogenetic relationships
More informationInbreeding depression due to stabilizing selection on a quantitative character. Emmanuelle Porcher & Russell Lande
Inbreeding depression due to stabilizing selection on a quantitative character Emmanuelle Porcher & Russell Lande Inbreeding depression Reduction in fitness of inbred vs. outbred individuals Outcrossed
More informationLidar-derived Hydrography as a Source for the National Hydrography Dataset
Lidar-derived Hydrography as a Source for the National Hydrography Dataset Lidar-Derived Hydrography, Bathymetry, and Topobathymetry in the National Hydrography Dataset and 3-Dimensional Elevation Program
More information19. When allele frequencies change as a result of the migration of a small subgroup of a population
CP Biology: Evolution Name: Per: Directions: Use your textbook to help you answer the practice questions for each chapter. It is important that you READ the chapter sections and not just search for the
More informationCase Studies in Ecology and Evolution
3 Non-random mating, Inbreeding and Population Structure. Jewelweed, Impatiens capensis, is a common woodland flower in the Eastern US. You may have seen the swollen seed pods that explosively pop when
More informationD. Incorrect! That is what a phylogenetic tree intends to depict.
Genetics - Problem Drill 24: Evolutionary Genetics No. 1 of 10 1. A phylogenetic tree gives all of the following information except for. (A) DNA sequence homology among species. (B) Protein sequence similarity
More information1.A- Natural Selection
1.A- Natural Selection Big Idea 1: The process of evolution drives the diversity and unity of life. EU 1.A- Evolution is change in the genetic makeup of a population over time. EU 1.B- Organisms are linked
More informationLecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012
Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based
More informationLife Cycles, Meiosis and Genetic Variability24/02/2015 2:26 PM
Life Cycles, Meiosis and Genetic Variability iclicker: 1. A chromosome just before mitosis contains two double stranded DNA molecules. 2. This replicated chromosome contains DNA from only one of your parents
More informationThe Wright Fisher Controversy. Charles Goodnight Department of Biology University of Vermont
The Wright Fisher Controversy Charles Goodnight Department of Biology University of Vermont Outline Evolution and the Reductionist Approach Adding complexity to Evolution Implications Williams Principle
More informationThe Wright-Fisher Model and Genetic Drift
The Wright-Fisher Model and Genetic Drift January 22, 2015 1 1 Hardy-Weinberg Equilibrium Our goal is to understand the dynamics of allele and genotype frequencies in an infinite, randomlymating population
More informationStatistical Genetics I: STAT/BIOST 550 Spring Quarter, 2014
Overview - 1 Statistical Genetics I: STAT/BIOST 550 Spring Quarter, 2014 Elizabeth Thompson University of Washington Seattle, WA, USA MWF 8:30-9:20; THO 211 Web page: www.stat.washington.edu/ thompson/stat550/
More information19. Genetic Drift. The biological context. There are four basic consequences of genetic drift:
9. Genetic Drift Genetic drift is the alteration of gene frequencies due to sampling variation from one generation to the next. It operates to some degree in all finite populations, but can be significant
More informationProportional Variance Explained by QLT and Statistical Power. Proportional Variance Explained by QTL and Statistical Power
Proportional Variance Explained by QTL and Statistical Power Partitioning the Genetic Variance We previously focused on obtaining variance components of a quantitative trait to determine the proportion
More informationEVOLUTION UNIT. 3. Unlike his predecessors, Darwin proposed a mechanism by which evolution could occur called.
EVOLUTION UNIT Name Read Chapters 1.3, 20, 21, 22, 24.1 and 35.9 and complete the following. Chapter 1.3 Review from The Science of Biology 1. Discuss the influences, experiences and observations that
More informationMark H. Horwitz Ping Wang PhD Coastal Research Laboratory, School of Geosciences University of South Florida
Mark H. Horwitz Ping Wang PhD Coastal Research Laboratory, School of Geosciences University of South Florida American Shore & Beach Preservation Association 2015 National Coastal Conference, New Orleans,
More informationGene Pool The combined genetic material for all the members of a population. (all the genes in a population)
POPULATION GENETICS NOTES Gene Pool The combined genetic material for all the members of a population. (all the genes in a population) Allele Frequency The number of times a specific allele occurs in a
More informationLecture 13: Population Structure. October 8, 2012
Lecture 13: Population Structure October 8, 2012 Last Time Effective population size calculations Historical importance of drift: shifting balance or noise? Population structure Today Course feedback The
More informationAccounting for read depth in the analysis of genotyping-by-sequencing data
Accounting for read depth in the analysis of genotyping-by-sequencing data Ken Dodds, John McEwan, Timothy Bilton, Rudi Brauning, Rayna Anderson, Tracey Van Stijn, Theodor Kristjánsson, Shannon Clarke
More informationEvolution AP Biology
Darwin s Theory of Evolution How do biologists use evolutionary theory to develop better flu vaccines? Theory: Evolutionary Theory: Why do we need to understand the Theory of Evolution? Charles Darwin:
More informationMicroevolution (Ch 16) Test Bank
Microevolution (Ch 16) Test Bank Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Which of the following statements describes what all members
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#5:(Mar-21-2010) Genome Wide Association Studies 1 Experiments on Garden Peas Statistical Significance 2 The law of causality...
More informationChapter 17: Population Genetics and Speciation
Chapter 17: Population Genetics and Speciation Section 1: Genetic Variation Population Genetics: Normal Distribution: a line graph showing the general trends in a set of data of which most values are near
More informationModule Contact: Dr Doug Yu, BIO Copyright of the University of East Anglia Version 1
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2014-2015 EVOLUTIONARY BIOLOGY & CONSERVATION GENETICS BIO-3C24 Time allowed: 3 hours Answer ALL questions in Section
More informationLecture 1: Case-Control Association Testing. Summer Institute in Statistical Genetics 2015
Timothy Thornton and Michael Wu Summer Institute in Statistical Genetics 2015 1 / 1 Introduction Association mapping is now routinely being used to identify loci that are involved with complex traits.
More informationChapter 22: Descent with Modification: A Darwinian View of Life
Chapter 22: Descent with Modification Name Period Chapter 22: Descent with Modification: A Darwinian View of Life As you study this chapter, read several paragraphs at a time to catch the flow of ideas
More informationChapter 16. Table of Contents. Section 1 Genetic Equilibrium. Section 2 Disruption of Genetic Equilibrium. Section 3 Formation of Species
Population Genetics and Speciation Table of Contents Section 1 Genetic Equilibrium Section 2 Disruption of Genetic Equilibrium Section 3 Formation of Species Section 1 Genetic Equilibrium Objectives Identify
More informationLinear Regression (1/1/17)
STA613/CBB540: Statistical methods in computational biology Linear Regression (1/1/17) Lecturer: Barbara Engelhardt Scribe: Ethan Hada 1. Linear regression 1.1. Linear regression basics. Linear regression
More informationThe determinants of transport modal choice in Bodensee-Alpenrhein region
The determinants of transport modal choice in Bodensee-Alpenrhein region Seyedeh Ashrafi University of Vienna Energie Innovation, February 2018 Modal choice is a decision process to choose between different
More informationLab 12. Linkage Disequilibrium. November 28, 2012
Lab 12. Linkage Disequilibrium November 28, 2012 Goals 1. Es
More informationQ1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate.
OEB 242 Exam Practice Problems Answer Key Q1) Explain how background selection and genetic hitchhiking could explain the positive correlation between genetic diversity and recombination rate. First, recall
More informationSince we re not going to have review this week either
Since we re not going to have review this week either I am posting these slides to help with reviewing the material that we didn t cover during discussion sessions these past two weeks. Of course, take
More informationSURVEY OF SUBMERGED NOXIOUS WEED SPECIES IN LAKE CHELAN WASHINGTON
SURVEY OF SUBMERGED NOXOUS WEED SPECES N LAKE CHELAN WASHNGTON 1/26/215 Produced by AquaTechnex Lake Chelan was surveyed by air and by boat in the fall of 214 to locate noxious weeds and assess their overall
More informationBTRY 4830/6830: Quantitative Genomics and Genetics Fall 2014
BTRY 4830/6830: Quantitative Genomics and Genetics Fall 2014 Homework 4 (version 3) - posted October 3 Assigned October 2; Due 11:59PM October 9 Problem 1 (Easy) a. For the genetic regression model: Y
More informationStatistical Methods and Software for Forensic Genetics. Lecture I.1: Basics
Statistical Methods and Software for Forensic Genetics. Lecture I.1: Basics Thore Egeland (1),(2) (1) Norwegian University of Life Sciences, (2) Oslo University Hospital Workshop. Monterrey, Mexico, Nov
More informationEnduring Understanding: Change in the genetic makeup of a population over time is evolution Pearson Education, Inc.
Enduring Understanding: Change in the genetic makeup of a population over time is evolution. Objective: You will be able to identify the key concepts of evolution theory Do Now: Read the enduring understanding
More informationStudy of similarities and differences in body plans of major groups Puzzling patterns:
Processes of Evolution Evolutionary Theories Widely used to interpret the past and present, and even to predict the future Reveal connections between the geological record, fossil record, and organismal
More informationIntroduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
More informationSelection Page 1 sur 11. Atlas of Genetics and Cytogenetics in Oncology and Haematology SELECTION
Selection Page 1 sur 11 Atlas of Genetics and Cytogenetics in Oncology and Haematology SELECTION * I- Introduction II- Modeling and selective values III- Basic model IV- Equation of the recurrence of allele
More informationBinomial Mixture Model-based Association Tests under Genetic Heterogeneity
Binomial Mixture Model-based Association Tests under Genetic Heterogeneity Hui Zhou, Wei Pan Division of Biostatistics, School of Public Health, University of Minnesota, Minneapolis, MN 55455 April 30,
More informationThe genomes of recombinant inbred lines
The genomes of recombinant inbred lines Karl W Broman Department of Biostatistics Johns Hopkins University http://www.biostat.jhsph.edu/~kbroman C57BL/6 2 1 Recombinant inbred lines (by sibling mating)
More informationDNA polymorphisms such as SNP and familial effects (additive genetic, common environment) to
1 1 1 1 1 1 1 1 0 SUPPLEMENTARY MATERIALS, B. BIVARIATE PEDIGREE-BASED ASSOCIATION ANALYSIS Introduction We propose here a statistical method of bivariate genetic analysis, designed to evaluate contribution
More informationVocab. ! Evolution - change in a kind of organism over time; process by which modern organisms have descended from ancient organisms
Vocab! Evolution - change in a kind of organism over time; process by which modern organisms have descended from ancient organisms! Theory - well-tested explanation that unifies a broad range of observations
More informationPopulation Genetics II (Selection + Haplotype analyses)
26 th Oct 2015 Poulation Genetics II (Selection + Halotye analyses) Gurinder Singh Mickey twal Center for Quantitative iology Natural Selection Model (Molecular Evolution) llele frequency Embryos Selection
More informationEvolution of Populations
Evolution of Populations Gene Pools 1. All of the genes in a population - Contains 2 or more alleles (forms of a gene) for each trait 2. Relative frequencies - # of times an allele occurs in a gene pool
More informationNotes for MCTP Week 2, 2014
Notes for MCTP Week 2, 2014 Lecture 1: Biological background Evolutionary biology and population genetics are highly interdisciplinary areas of research, with many contributions being made from mathematics,
More informationThe neutral theory of molecular evolution
The neutral theory of molecular evolution Introduction I didn t make a big deal of it in what we just went over, but in deriving the Jukes-Cantor equation I used the phrase substitution rate instead of
More informationBeaming in your answers
Bio 112 Handout for Themes 2 This handout contains: Today s iclicker Questions Handouts for today s lecture Information for Exam I iclicker Question #8A - before lecture In the classic 1954 science fiction
More informationLecture 2. Basic Population and Quantitative Genetics
Lecture Basic Population and Quantitative Genetics Bruce Walsh. Aug 003. Nordic Summer Course Allele and Genotype Frequencies The frequency p i for allele A i is just the frequency of A i A i homozygotes
More informationBig Idea #1: The process of evolution drives the diversity and unity of life
BIG IDEA! Big Idea #1: The process of evolution drives the diversity and unity of life Key Terms for this section: emigration phenotype adaptation evolution phylogenetic tree adaptive radiation fertility
More informationSegregation versus mitotic recombination APPENDIX
APPENDIX Waiting time until the first successful mutation The first time lag, T 1, is the waiting time until the first successful mutant appears, creating an Aa individual within a population composed
More informationLecture 28: BLUP and Genomic Selection. Bruce Walsh lecture notes Synbreed course version 11 July 2013
Lecture 28: BLUP and Genomic Selection Bruce Walsh lecture notes Synbreed course version 11 July 2013 1 BLUP Selection The idea behind BLUP selection is very straightforward: An appropriate mixed-model
More informationTeachers Guide. Overview
Teachers Guide Overview BioLogica is multilevel courseware for genetics. All the levels are linked so that changes in one level are reflected in all the other levels. The BioLogica activities guide learners
More informationPopulation Genetics & Evolution
The Theory of Evolution Mechanisms of Evolution Notes Pt. 4 Population Genetics & Evolution IMPORTANT TO REMEMBER: Populations, not individuals, evolve. Population = a group of individuals of the same
More informationEvolution of phenotypic traits
Quantitative genetics Evolution of phenotypic traits Very few phenotypic traits are controlled by one locus, as in our previous discussion of genetics and evolution Quantitative genetics considers characters
More informationQuantitative Genomics and Genetics BTRY 4830/6830; PBSB
Quantitative Genomics and Genetics BTRY 4830/6830; PBSB.5201.01 Lecture 20: Epistasis and Alternative Tests in GWAS Jason Mezey jgm45@cornell.edu April 16, 2016 (Th) 8:40-9:55 None Announcements Summary
More informationDetecting selection from differentiation between populations: the FLK and hapflk approach.
Detecting selection from differentiation between populations: the FLK and hapflk approach. Bertrand Servin bservin@toulouse.inra.fr Maria-Ines Fariello, Simon Boitard, Claude Chevalet, Magali SanCristobal,
More informationSTAT 536: Genetic Statistics
STAT 536: Genetic Statistics Frequency Estimation Karin S. Dorman Department of Statistics Iowa State University August 28, 2006 Fundamental rules of genetics Law of Segregation a diploid parent is equally
More informationAP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny
AP Biology Review Packet 5- Natural Selection and Evolution & Speciation and Phylogeny 1A1- Natural selection is a major mechanism of evolution. 1A2: Natural selection acts on phenotypic variations in
More informationPOPULATIONS. p t+1 = p t (1-u) + q t (v) p t+1 = p t (1-u) + (1-p t ) (v) Phenotypic Evolution: Process HOW DOES MUTATION CHANGE ALLELE FREQUENCIES?
Phenotypic Evolution: Process MUTATION SELECTION + POPULATIONS +/ MIGRATION DRIFT HOW DOES MUTATION CHANGE ALLELE FREQUENCIES? Assume: a single autosomal locus with 2 alleles. Frequency (A) = p Frequency
More information1. Understand the methods for analyzing population structure in genomes
MSCBIO 2070/02-710: Computational Genomics, Spring 2016 HW3: Population Genetics Due: 24:00 EST, April 4, 2016 by autolab Your goals in this assignment are to 1. Understand the methods for analyzing population
More informationA novel fuzzy set based multifactor dimensionality reduction method for detecting gene-gene interaction
A novel fuzzy set based multifactor dimensionality reduction method for detecting gene-gene interaction Sangseob Leem, Hye-Young Jung, Sungyoung Lee and Taesung Park Bioinformatics and Biostatistics lab
More informationBiology 20 Evolution
Biology 20 Evolution Evolution: Modern synthesis: Individuals: Lamarck: Use and disuse: Inheritance of Acquired Traits: Darwin: Travelled: Galapagos Islands: What was the name of Darwin s book, which he
More information