Technology Platform 2018

Transcription

1 Technology Platform 2018

2 Forward Looking Statements This presentation contains forward-looking statements within the meaning of the "safe harbor" provisions of the Private Securities Litigation Reform Act of 1995, as amended. These forward-looking statements include, but are not limited to, financial guidance for full year 2017 as it relates to revenues, operating expenses, and year end cash balances; the design of clinical trials and expected timing for release of data; the anticipated clinical development milestones and other potential value drivers in the future; the expected benefits of the collaboration with Pfizer, the expanded capability of Sangamo s technologies; the benefits of rebranding and reorganization, the research and development of novel gene-based therapies and the application Sangamo s ZFP technology platform to specific human diseases; corporate partnerships; and the potential of Sangamo s genome editing technology to treat genetic diseases. These statements are based upon our current expectations and speak only as of the date hereof. Our actual results may differ materially and adversely from those expressed in any forward-looking statements as a result of various factors and uncertainties. Factors that could cause actual results to differ include, but are not limited to, the dependence on the success of clinical trials of lead programs, the lengthy and uncertain regulatory approval process, uncertainties related to the timing of initiation and completion of clinical trials, whether clinical trial results will validate and support the safety and efficacy of Sangamo s therapeutics, the ability to establish strategic partnerships and our ability to control expenses and achieve our milestones that generate revenues under our agreements. Further, there can be no assurance that the necessary regulatory approvals will be obtained or that Sangamo and its partners will be able to develop commercially viable gene-based therapeutics. Actual results may differ from those projected in forward-looking statements due to risks and uncertainties that exist in Sangamo s operations and business environments. These risks and uncertainties are described more fully in Sangamo s Annual Reports on Form 10-K and Quarterly Reports on Form 10-Q as filed with the Securities and Exchange Commission. Forward-looking statements contained in this presentation are made as of the date hereof, and Sangamo undertakes no duty to update such information except as required under applicable law. 2

3 We are committed to translating ground-breaking science into genomic therapies that transform patients lives 3

4 Sangamo is investing across four technological platforms for genomic medicines Gene Therapy Genome Editing Cell Therapy Gene Regulation 4

5 Product portfolio diversified across therapeutic area and technology Therapeutic Area Research Preclinical Phase 1/2 Phase 3 Collaborator Inherited Metabolic Diseases MPS I (SB-318) MPS II (SB-913) Fabry Disease (ST-920) Hematology Hemophilia A (SB-525) Hemophilia B (SB-FIX) Beta-thalassemia (ST-400) Sickle Cell Disease (BIVV-003) CNS Diseases Tauopathies ALS/FTLD - C9ORF72 Huntington s Disease Oncology Autologous and Allogeneic CAR/TCR/NKR Immunology Undisclosed Autoimmune Disease Targets Investigator Sponsored Clinical Research HIV (T cell and Stem Cell) Gene Therapy Genome Editing Cell Therapy Gene Regulation 5

6 ZFNs: The platform of choice for therapeutic genome editing T A C C C A A C G C G A A T T A T G A T G G G T T G C G C T T A A T A C ZFN T G C G C T T A A C G C A T G G G T A C G C G A A T T G C G T A C C C A ZFPs Precision Target any desired nucleotide in the genome ZFPs ZFN ZFNs Efficiency Level of modification at the desired target nucleotide Specificity Edit the targeted nucleotide without editing elsewhere in the genome 6

7 Two-finger modules used for design COOH NH 2 Enables more specific binding Allows one-step gene assembly 5 T A C C C A 3 7

8 Modular platform enables rapid assembly two-finger modules: 6 base pair subsites: T A C C C A 3 5 A C G C G A 3 5 A T T G C G 3 six finger ZFP: COOH NH 2 18 base pair target site: 5 T A C C C A A C G C G A A T T G C G 3 8

9 Summary of design components intermodule linkers ZFP-Fok linker module module module 5 3 T A C A T G C C A A C G C G A A T T A T G G C G G C G T G C G C T T A A C G C A T G G G T G G T T G C G C T T A A T A C C G C C G C A C G C G A A T T G C G T A C C C A module module module ZFP-Fok linker intermodule linkers Modules: 1- and 2-finger units that >8000 hexamer / module combinations recognize base sequence Intermodule connect adjacent modules 6 alternatives for skipping 0, 1, or 2 bp linkers: ZFP-Fok linker: links the Fok and ZFP domains 5 alternatives for skipping 5-9 bp 4 alternatives for reversing Fok-ZFP polarity 9

10 Base-skipping linkers yield a further 80-fold increase module module module Standard linkers / no skipping: 1 module configuration A T T A A G C A A C G G T A A A T A G G G G G G G G T G C G A T T A A G A C A T G T G A T A T A A T T C G T T G C C A T T T A T C C C C G G G G A C G C T A A T T C T G T A C A C T A T module module module Linker variants that skip a base: 4 configurations / ZFN = 16 configurations / dimer Baseskipping linkers A T T A A G C A A C G G T A A A T A G G G G G G G G T A A T T C G T T G C C A T T T A T C C C C G G G G A T T A A G C A A C G G T A A A T A G G G G G G G G T A A T T C G T T G C C A T T T A T C C C C G G G G A T T A A G C A A C G G T A A A T A G G G G G G G G T A A T T C G T T G C C A T T T A T C C C C G G G G G T G C G A T T A A G A C A T G T G A T A G A C G C T A A T T C T G T A C A C T A T G T G C G A T T A A G A C A T G T G A T A G A C G C T A A T T C T G T A C A C T A T G T G C G A T T A A G A C A T G T G A T A G A C G C T A A T T C T G T A C A C T A T One skip One skip A T T A A G C A A C G G T A A A T A G G G G G G G G T A A T T C G T T G C C A T T T A T C C C C G G G G G T G C G A T T A A G A C A T G T G A T A G A C G C T A A T T C T G T A C A C T A T Two skips Single + 2 bp skipping: 81 configurations / dimer (not shown) 10

11 Reversing Fok-ZFP Order Increases Design Options 4-fold Standard Fok attachment point Standard ZFN dimer COOH COOH NH 2 T A C CCA A C G C G A A T T A T G A T G GGT T G C G C T T A A T A C T G C G C T T A A C G C A T G GGT A C G C G A A T T G C G T A C CCA Bottom-Top T G C G C T T A A C G C A T G A C G C G A A T T G C G T A C G G T C C A COOH Alternative dimers for same target sequence COOH NH 2 Amino-terminal attachment T A C CCA A C G C G A A T T A T G A T G GGT T G C G C T T A A T A C T G C G C T T A A C G C A T G GGT A C G C G A A T T G C G T A C CCA Top-Top COOH T A C CCA A C G C G A A T T A T G A T G GGT T G C G C T T A A T A C T G C G C T T A A C G C A T G GGT A C G C G A A T T G C G T A C CCA Bottom-Bottom NH 2 T G C G C T T A A C G C A T G G G T COOH NH 2 A C G C G A A T T G C G T A C C C A NH 2 T A C CCA A C G C G A A T T A T G A T G GGT T G C G C T T A A T A C T G C G C T T A A C G C A T G GGT A C G C G A A T T G C G T A C CCA Top-Bottom 11 NH 2

12 Further improvements increase specificity while maintaining high levels of gene modification Removal of conserved, non-specific phosphate contacts from zinc finger proteins increases targeting specificity Modified Fok nuclease-dna contacts significantly reduces off-target cleavage events zinc finger DNA Conserved Arg phosphate contact Elrod-Erickson et al., Structure AAY.pdb 12

13 Phosphate contacts modulate global specificity DNA zinc finger Fok domain Fok domain Conserved Arg phosphate contact Lys phosphate contact 13

14 Recent innovations drive exceptional performance Innovation Result Efficiency Precision Specificity New linkers for configuring DNA-binding modules 300-fold increase in design options for targeting any given sequence Efficiency Precision Specificity New dimer architectures yield higher modification activity Increase DNA editing efficiency to as high as 99.5% Efficiency Precision Specificity Phosphate contact tuning via replacement of key residues Off-target cleavage undetectable (>1000 fold reduction) 14

15 Specificity improved >1000 fold via key substitutions # modified fingers Fok domain substitution % Indels BCL11A Off-target A Off-target C (Arg --> Gln) 6 ug 2 ug 0.5ug 6 ug 2 ug 0.5ug 6 ug 2 ug 0.5ug R416S R33S R416S R33S R416S R33S R416S R33S K142S K525S K142S K525S Parent ZFN Off-target activity reduced > 1000x Notes: Grey font = No evidence of ZFN cleavage Test system: ZFNs targeted to BCL11A erythroid enhancer (Nat Methods 12, 927) CD34 + cells; delivery via RNA transfection (BTX) 15

16 ZFNs offer significantly higher success rate for cleaving close to an arbitrarily chosen base Fraction of bases in globin test region ZFN platform G(N20)GG motif Distance (bp) to nearest cleavage site 16

17 Design density allows Sangamo to select a ZFN optimized for ontarget efficiency and maximal therapeutic effect G A A G a T t A t T T A C G A A G a t A X G a X C C T A T a G T t X T T A C T A G T t a X C T C T G T C T A G t X A A X T T C T A G T t a C T A X T T T G T C T A t G A T T a G T C T A t X T A T A G X T A a T G X G g A A G G G A X A G a T T g G G A g A G G G T A a T G X G X T A A G G G G a T T G X G g A G G G G G C T C G G T A G G G T A a X C A X T T X C A a T G G T A a T A A G G T a T X G A C X C A T A a A T T A a C T X C G G T X A T A a A G G X C A G T T a T C G T G C A A X T X A T X C A T X T G T G C A A a X G T X A X C A X G G T X t T G G C C X A X T G T A A X C t a C T C C A T a T C X C t X T C C A A X a C C T A X C t G C T a T A A C X G C T a X t C C A A C X X C C X T T t A X C A G T X t T C T G A T X A G T t A X G T X X G G g t A A C t G T G g X G t A G T T T t A X G t G T T G C T T T T A T C a C A G G C T X A A G G G T T T G G C C T C T G A T TTGAAGCTAGTCTAGTGCAAGCTAACAGTTGCTTTTATCACAGGCTCCAGGAAGGGTTTGGCCTCTGATTAGGG C T A A C A G X T T G C T T T T A T C A C A G G C X C C A G G 17

18 Structural flexibility provides diverse architectures for targeting any DNA segment ZFN ZFN average (455) Distinct architectures available for design (20 bp window) HiFi Cas HiFi Cas9 average (1.07) Base location in β-globin gene Sickle mutation 18

19 Reactivation of fetal hemoglobin (HbF) to treat beta-thalassemia and sickle cell disease Fetal Hemoglobin (HbF) Adult Hemoglobin (HbA) g β g β γ-globin in HbF raises oxygen affinity, confers anti-sickling effects HbF protects infants from β- thal, SCD manifestations until birth, when γ-globin is downregulated by BCL11A β-globin defects (SCD) and scarcity (β-thal) caused by hundreds of different mutations 19

20 Reactivation of HbF in erythroid lineage achieved by targeted KO in CD34+ stem cells at key nucleotide within BCL11A enhancer Natural genetic variants in BCL11A reactivate HbF, which protects against disease symptoms and increases lifespan in β-thal 1 and SCD patients 2 Erythroid-specific enhancer in BCL11A selectively reactivates HbF in erythroid lineage while preserving normal immune cell functions Precise disruption at key nucleotide maximizes γ-globin expression 3 enhancer sequence BCL11A gene Strategic Advantages for Treating β-thalassemia and SCD Non-viral delivery of ZFN mrna for possibly superior long-term safety Precise disruption of key nucleotide in BCL11A erythroidspecific enhancer, based on naturally protective variations Fetal hemoglobin has natural features (stronger oxygen affinity, anti-sickling properties) found to protect against disease symptoms in patients 1,2 1 Platt et al. Blood (1994) 2 Musallam et al. Blood (2012) 3 Vierstra, J. et al. Nat. Methods (2015) 20

21 % indels Deep understanding of protein DNA interaction allows us to engineer ZFNs with unparalleled specificity High on-target modification (82%) Strategic Advantages Defined engineering refinements to protein structures rapidly generate ZFP constructs with high on-target activity No significant off-target modification seen compared to control Locus rank No detectable off-target activity using state-of-theart, unbiased oligo capture assay and deep sequencing Deep sequencing results for 55 loci identified by state-of-art unbiased oligo capture methods (assay background generally <0.1%) for potential off-target activity. Performed in CD34 hematopoietic stem cells treated with ZFNs at clinical scale. 21

22 Thank you.