Evolutionary Dynamics & its Tendencies. David Krakauer, Santa Fe Institute.

Size: px
Start display at page:

Download "Evolutionary Dynamics & its Tendencies. David Krakauer, Santa Fe Institute."

Transcription

1 Evolutionary Dynamics & its Tendencies David Krakauer, Santa Fe Institute.

2 A Talk in 2 Parts Part 1: What is Evolution, What has it generated & What are its limits? Part II: The Evolutionary dynamics of Minimal Forms - microbes

3 Evolutionary questions? Why is there life-like dynamics on earth? Why are organisms so diverse? Why are organisms so complex? What is the relationship of genetic information to learned information? When does cultural evolution outpace genetic evolution? Is self-awareness inevitable?

4

5 What is Evolutionary Theory? A Physics like theory searching for Laws? A Statistical/Inferential Theory like Bayesian learning or approximate dynamic programming? An algorithmic/computational theory?

6 The Darwinian Polynucleotide Machine 1,3,7,1,6,1,7,1,1,5,5,4,3,15,7,1,10,1,15,8,19,1 0,68,2,6,1,4,5,3,1,6,9,2,4,3,1,2,6,5,2,6,20,1,3, 2,176,2,1,1,2 (in MegaBases)

7

8 Ciccarelli et al. Science, 311,

9 Lynch, PNAS, 104,

10 Evolutionary Theory Population genetics/ neutral theory Quantitative genetics Quasispecies theory Game theory/adaptive dynamics Phylogenetic reconstruction/inference Niche Construction Gene-Culture Coevolution

11 Evolutionary Stoichiometry replication g i r i Energy + Resources 2g i

12 Evolutionary Stoichiometry competition g i + g j c ij g j

13 Evolutionary Stoichiometry mutation g i m ij Radiation g j m ij = µ H(i,j) (1 µ) L H(i,j)

14 Evolutionary Stoichiometry recombination g j + g l b ijl g i b ijl = 1, if i = j = l b ijl = ( ) 1 2 (1 c) + c ( ) H(j,l) 1 if i = j or i = l 2 b ijl = c ( ) H(j,l) 1 if H(i, j) + H(i, l) = H(j, l) 2

15 Replicator Equation g i r i 2g i c ij g i + g j g j n genomes ġ i = g i (r i f) where f = n r i g i and c ij = 1 i

16 Evolutionary Game Theory: Frequency dependent Replicator Equation g i r i (g) 2g i c ij g i + g j g j n genomes ġ i = g i (r i (g) f) where f = n r i (g)g i and c ij = 1 i

17 Evolutionary Game Theory: Frequency dependent Replicator Equation ġ i = g i (r i (g) f) Payoff Matrix P = [p ij ] with linear payoffs: n r i (g) = g j p ij j

18 Evolutionary Game Theory: Frequency dependent Replicator Equation n n n ġ i = g i ( g j p ij g j g k p jk ) j j k

19 Evolutionary Game Theory: Adaptive Dynamics for Continuous Traits dx dt = 1 δf(x 2 µσ2 N(x),x) δx x =x

20 Freq-dep Replicator Equation & Bayesian Inference An Insight by Cosma Shalizi

21 g i (t) t = g i (t 1)(r i (g) f) P (X Y ) = P (X) P (Y X) P (Y ) P (X Y ) = P (X) L X L L = P (Y ) = x ω P (Y X)P (X) P X (t) = P X (t 1) L X L P X (t) = P X (t 1)( L X L 1) = P X (t 1) 1 L(L X L) P X (t) = P X (t 1)(f t f), where f t = L X / L

22 Sequence Space & Limits to Evolution

23 I Z 10 ol o

24 Replicator-Mutator Equation 2 n ġ i = g j r j (g)m ij g i f) j m ij = µ H(i,j) (1 µ) L H(i,j)

25

26

27

28

29

30

31

32 Error Threshold g i µ

33 Fitness Landscape Delta function: µ < s L = 1 L Multiplicative function: µ < s

34 Kimura s Neutrality Inequality Expectation of Mutation Nµ Probability of Fixation 1 N Condition for Neutrality sn < 1

35 Evolutionary Information Storage Information Conserved organismal regularity Environmental regularity s µl N Information Lost s< µl N

36 Evolution, Localization & Information (with a 4 letter alphabet)

37 Information as Selective Uniformity ACGTC...T ATGTG...T ATCTG...A Aligned genomes l H i = j p (i) j log 4p (i) j I i = H max H i Information in Population C = L i H i

38 Information-Selection as a Compression Ratio ACGTC...T ATGTG...T ATCTG...A Aligned genomes l H i = j p (i) j log 4p (i) j C = LH max L i H i = L L i H i

39 sn > µl The Tendency to Population Multiplicity & Individual Minimality

40 The Space God versus the andromeda strain

41

42 KEY virus catalyzed host A catalyzed host B catalyzed

43 N = E v i s i h i Minimality Autonomy v i h v i i s i h i v h = N v h = N v h = 0 v h N

44 w = i E f(g i ) j NE h(g j ) w E = i E f(g i ) v i h i g i

45 v i h i g i g i = h i v i P rob(h i = 1) = q P rob(v i = 1) = p L v = i v i, < L v >= pn w = i N g i (1 + L v ) < w >= (q + p qp)n 1 + pn

46 N=4 N=8 host genome virus genome N=16 N=32

47 Evolution & Minimality Evolutionary theory is concerned largely with the frequency, variety & relationships among chemically improbable sequences Genomes tend to neutralize and/or eliminate redundant sequences - genomes need not encode perfectly predictable resources Replicator/Mutator Dynamics tends to favor small sequences which can be preserved Increasing autonomy (often size) reflects greater inferential uncertainty Neutral theory requires large populations for effective selection of target sequences -- more likely with small sequences Evolution can be thought of as an inferential, model fitting process (Bayesian) and selection as a mechanism for injecting information into sequences Genetic dissipation in coevolutionary contexts requires a consideration of rates of gene inactivation in all interacting agents Genome growth beyond competitive persistence is driven by, e.g. robustness & control

48 Whence Complexity?

Complex Systems Theory and Evolution

Complex Systems Theory and Evolution Complex Systems Theory and Evolution Melanie Mitchell and Mark Newman Santa Fe Institute, 1399 Hyde Park Road, Santa Fe, NM 87501 In Encyclopedia of Evolution (M. Pagel, editor), New York: Oxford University

More information

Symbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype

Symbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype Symbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype Kunihiko Kaneko (Univ of Tokyo, Komaba) with Tetsuya Yomo (Osaka Univ.) experiment Akiko

More information

Simple Models of Evolutive Population Dynamics

Simple Models of Evolutive Population Dynamics October 20, 2010 Replicators Living cells (mono and multicellular organisms, sexual and asexual, etc.): DNA, mithocondries, Viruses. Transposable elements, plasmids. Computer viruses. Memes (cultural replicators).

More information

Population Genetics I. Bio

Population Genetics I. Bio Population Genetics I. Bio5488-2018 Don Conrad dconrad@genetics.wustl.edu Why study population genetics? Functional Inference Demographic inference: History of mankind is written in our DNA. We can learn

More information

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species

More information

Evolutionary Genetics: Part 0.2 Introduction to Population genetics

Evolutionary Genetics: Part 0.2 Introduction to Population genetics Evolutionary Genetics: Part 0.2 Introduction to Population genetics S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Population genetics Evolution = changes

More information

Natural Computation. Transforming Tools of NBIC: Complex Adaptive Systems. James P. Crutchfield Santa Fe Institute

Natural Computation. Transforming Tools of NBIC: Complex Adaptive Systems. James P. Crutchfield  Santa Fe Institute Natural Computation Transforming Tools of NBIC: Complex Adaptive Systems James P. Crutchfield www.santafe.edu/~chaos Santa Fe Institute Nanotechnology, Biotechnology, Information Technology, and Cognitive

More information

Haploid & diploid recombination and their evolutionary impact

Haploid & diploid recombination and their evolutionary impact Haploid & diploid recombination and their evolutionary impact W. Garrett Mitchener College of Charleston Mathematics Department MitchenerG@cofc.edu http://mitchenerg.people.cofc.edu Introduction The basis

More information

Error thresholds on realistic fitness landscapes

Error thresholds on realistic fitness landscapes Error thresholds on realistic fitness landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Evolutionary Dynamics:

More information

Lecture Notes: BIOL2007 Molecular Evolution

Lecture Notes: BIOL2007 Molecular Evolution Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits

More information

Population Genetics: a tutorial

Population Genetics: a tutorial : a tutorial Institute for Science and Technology Austria ThRaSh 2014 provides the basic mathematical foundation of evolutionary theory allows a better understanding of experiments allows the development

More information

NEUROEVOLUTION. Contents. Evolutionary Computation. Neuroevolution. Types of neuro-evolution algorithms

NEUROEVOLUTION. Contents. Evolutionary Computation. Neuroevolution. Types of neuro-evolution algorithms Contents Evolutionary Computation overview NEUROEVOLUTION Presenter: Vlad Chiriacescu Neuroevolution overview Issues in standard Evolutionary Computation NEAT method Complexification in competitive coevolution

More information

Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us

Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu Microbiota and man: the story about us Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities

More information

Neutral Theory of Molecular Evolution

Neutral Theory of Molecular Evolution Neutral Theory of Molecular Evolution Kimura Nature (968) 7:64-66 King and Jukes Science (969) 64:788-798 (Non-Darwinian Evolution) Neutral Theory of Molecular Evolution Describes the source of variation

More information

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection

CHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination

More information

Evolution of Genotype-Phenotype mapping in a von Neumann Self-reproduction within the Platform of Tierra

Evolution of Genotype-Phenotype mapping in a von Neumann Self-reproduction within the Platform of Tierra Evolution of Genotype-Phenotype mapping in a von Neumann Self-reproduction within the Platform of Tierra Declan Baugh and Barry Mc Mullin The Rince Institute, Dublin City University, Ireland declan.baugh2@mail.dcu.ie,

More information

Rise and Fall of Mutator Bacteria

Rise and Fall of Mutator Bacteria Rise and Fall of Mutator Bacteria The Evolution of Mutation Rates in Bacteria Yoav Ram Hadany Evolutionary Theory Lab 29 May 2011 Bacteria Bacteria are unicellular, haploid and asexual Reproduce by binary

More information

Evolution & Learning in Games

Evolution & Learning in Games 1 / 28 Evolution & Learning in Games Econ 243B Jean-Paul Carvalho Lecture 5. Revision Protocols and Evolutionary Dynamics 2 / 28 Population Games played by Boundedly Rational Agents We have introduced

More information

The theory of evolution continues to be refined as scientists learn new information.

The theory of evolution continues to be refined as scientists learn new information. Section 3: The theory of evolution continues to be refined as scientists learn new information. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the conditions of the

More information

Complexity in social dynamics : from the. micro to the macro. Lecture 4. Franco Bagnoli. Lecture 4. Namur 7-18/4/2008

Complexity in social dynamics : from the. micro to the macro. Lecture 4. Franco Bagnoli. Lecture 4. Namur 7-18/4/2008 Complexity in Namur 7-18/4/2008 Outline 1 Evolutionary models. 2 Fitness landscapes. 3 Game theory. 4 Iterated games. Prisoner dilemma. 5 Finite populations. Evolutionary dynamics The word evolution is

More information

Chapter 8: Introduction to Evolutionary Computation

Chapter 8: Introduction to Evolutionary Computation Computational Intelligence: Second Edition Contents Some Theories about Evolution Evolution is an optimization process: the aim is to improve the ability of an organism to survive in dynamically changing

More information

An Introduction to Evolutionary Game Theory: Lecture 2

An Introduction to Evolutionary Game Theory: Lecture 2 An Introduction to Evolutionary Game Theory: Lecture 2 Mauro Mobilia Lectures delivered at the Graduate School on Nonlinear and Stochastic Systems in Biology held in the Department of Applied Mathematics,

More information

Mutual Information & Genotype-Phenotype Association. Norman MacDonald January 31, 2011 CSCI 4181/6802

Mutual Information & Genotype-Phenotype Association. Norman MacDonald January 31, 2011 CSCI 4181/6802 Mutual Information & Genotype-Phenotype Association Norman MacDonald January 31, 2011 CSCI 4181/6802 2 Overview What is information (specifically Shannon Information)? What are information entropy and

More information

Evolution and Epigenetics. Seminar: Social, Cognitive and Affective Neuroscience Speaker: Wolf-R. Brockhaus

Evolution and Epigenetics. Seminar: Social, Cognitive and Affective Neuroscience Speaker: Wolf-R. Brockhaus Evolution and Epigenetics Seminar: Social, Cognitive and Affective Neuroscience Speaker: Wolf-R. Brockhaus 1. History of evolutionary theory The history of evolutionary theory ~ 1800: Lamarck 1859: Darwin's

More information

Mechanisms of molecular cooperation

Mechanisms of molecular cooperation Mechanisms of molecular cooperation Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Homo Sociobiologicus Evolution of human

More information

Fitness landscapes and seascapes

Fitness landscapes and seascapes Fitness landscapes and seascapes Michael Lässig Institute for Theoretical Physics University of Cologne Thanks Ville Mustonen: Cross-species analysis of bacterial promoters, Nonequilibrium evolution of

More information

arxiv:physics/ v1 [physics.bio-ph] 19 Apr 2000

arxiv:physics/ v1 [physics.bio-ph] 19 Apr 2000 Optimal Mutation Rates in Dynamic Environments Martin Nilsson Santa Fe Institute, 1399 Hyde Park Road, Santa Fe, New Mexico 87501 USA Institute of Theoretical Physics, Chalmers University of Technology

More information

Chapter 15: Darwin and Evolution

Chapter 15: Darwin and Evolution Chapter 15: Darwin and Evolution AP Curriculum Alignment Big Idea 1 is about evolution. Charles Darwin is called the father of evolution because his theory of natural selection explains how evolution occurs.

More information

Evolution and Computation. Christos H. Papadimitriou The Simons Institute

Evolution and Computation. Christos H. Papadimitriou The Simons Institute Evolution and Computation Christos H. Papadimitriou The Simons Institute The Algorithm as a Lens It started with Alan Turing, 60 years ago Algorithmic thinking as a novel and productive point of view for

More information

Sex accelerates adaptation

Sex accelerates adaptation Molecular Evolution Sex accelerates adaptation A study confirms the classic theory that sex increases the rate of adaptive evolution by accelerating the speed at which beneficial mutations sweep through

More information

Observation: we continue to observe large amounts of genetic variation in natural populations

Observation: we continue to observe large amounts of genetic variation in natural populations MUTATION AND GENETIC VARIATION Observation: we continue to observe large amounts of genetic variation in natural populations Problem: How does this variation arise and how is it maintained. Here, we look

More information

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012

Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012 Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based

More information

Unifying theories of molecular, community and network evolution 1

Unifying theories of molecular, community and network evolution 1 Carlos J. Melián National Center for Ecological Analysis and Synthesis, University of California, Santa Barbara Microsoft Research Ltd, Cambridge, UK. Unifying theories of molecular, community and network

More information

The Advantage of Using Mathematics in Biology

The Advantage of Using Mathematics in Biology The Advantage of Using Mathematics in Biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Erwin Schrödinger-Institut

More information

Code: ECTS Credits: 6. Degree Type Year Semester

Code: ECTS Credits: 6. Degree Type Year Semester 2017/2018 Evolution Code: 101961 ECTS Credits: 6 Degree Type Year Semester 2500890 Genetics OB 3 2 Contact Name: Francisco José Rodríguez-Trelles Astruga Email: FranciscoJose.RodriguezTrelles@uab.cat Prerequisites

More information

COMP3411: Artificial Intelligence 7a. Evolutionary Computation

COMP3411: Artificial Intelligence 7a. Evolutionary Computation COMP3411 14s1 Evolutionary Computation 1 COMP3411: Artificial Intelligence 7a. Evolutionary Computation Outline Darwinian Evolution Evolutionary Computation paradigms Simulated Hockey Evolutionary Robotics

More information

Evolution of Populations

Evolution of Populations Evolution of Populations Gene Pools 1. All of the genes in a population - Contains 2 or more alleles (forms of a gene) for each trait 2. Relative frequencies - # of times an allele occurs in a gene pool

More information

Introduction to population genetics & evolution

Introduction to population genetics & evolution Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics

More information

Evolutionary Algorithms

Evolutionary Algorithms Evolutionary Algorithms a short introduction Giuseppe Narzisi Courant Institute of Mathematical Sciences New York University 31 January 2008 Outline 1 Evolution 2 Evolutionary Computation 3 Evolutionary

More information

Evolutionary Theory. Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A.

Evolutionary Theory. Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A. Evolutionary Theory Mathematical and Conceptual Foundations Sean H. Rice Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A. Contents Preface ix Introduction 1 CHAPTER 1 Selection on One

More information

UNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology

UNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology UNIT V Chapter 11 Evolution of Populations UNIT 4: EVOLUTION Chapter 11: The Evolution of Populations I. Genetic Variation Within Populations (11.1) A. Genetic variation in a population increases the chance

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

Natural selection, Game Theory and Genetic Diversity

Natural selection, Game Theory and Genetic Diversity Natural selection, Game Theory and Genetic Diversity Georgios Piliouras California Institute of Technology joint work with Ruta Mehta and Ioannis Panageas Georgia Institute of Technology Evolution: A Game

More information

Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007

Understanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007 Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.

More information

Evolutionary Computation. DEIS-Cesena Alma Mater Studiorum Università di Bologna Cesena (Italia)

Evolutionary Computation. DEIS-Cesena Alma Mater Studiorum Università di Bologna Cesena (Italia) Evolutionary Computation DEIS-Cesena Alma Mater Studiorum Università di Bologna Cesena (Italia) andrea.roli@unibo.it Evolutionary Computation Inspiring principle: theory of natural selection Species face

More information

Is the Concept of Error Catastrophy Relevant for Viruses? Peter Schuster

Is the Concept of Error Catastrophy Relevant for Viruses? Peter Schuster Is the Concept of Error Catastrophy Relevant for Viruses? Quasispecies and error thresholds on realistic landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa

More information

7. Tests for selection

7. Tests for selection Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info

More information

Gene regulation: From biophysics to evolutionary genetics

Gene regulation: From biophysics to evolutionary genetics Gene regulation: From biophysics to evolutionary genetics Michael Lässig Institute for Theoretical Physics University of Cologne Thanks Ville Mustonen Johannes Berg Stana Willmann Curt Callan (Princeton)

More information

THE EVOLVING WORLD CHAPTERS 4 & 5. Preethy Subramanian & Adam Booth

THE EVOLVING WORLD CHAPTERS 4 & 5. Preethy Subramanian & Adam Booth THE EVOLVING WORLD CHAPTERS 4 & 5 Preethy Subramanian & Adam Booth Chapter 4 Evolution and Conservation Mindell s Main Idea Our understanding of evolutionary history allows us to better focus our resources

More information

Evolutionary computation

Evolutionary computation Evolutionary computation Andrea Roli andrea.roli@unibo.it DEIS Alma Mater Studiorum Università di Bologna Evolutionary computation p. 1 Evolutionary Computation Evolutionary computation p. 2 Evolutionary

More information

Robust Predictions in Games with Incomplete Information

Robust Predictions in Games with Incomplete Information Robust Predictions in Games with Incomplete Information joint with Stephen Morris (Princeton University) November 2010 Payoff Environment in games with incomplete information, the agents are uncertain

More information

CAUGHT IN THE ACT APSQ 01

CAUGHT IN THE ACT APSQ 01 ANNEXE A.1 CAUGHT IN THE ACT APSQ 01 Document PowerPoint, disponible en téléchargement seulement à l adresse suivante : http://www.apsq.org/sautquantique/tresors.html CAUGHT IN TH E A CT : AG E NTS O F

More information

Genetic Algorithm: introduction

Genetic Algorithm: introduction 1 Genetic Algorithm: introduction 2 The Metaphor EVOLUTION Individual Fitness Environment PROBLEM SOLVING Candidate Solution Quality Problem 3 The Ingredients t reproduction t + 1 selection mutation recombination

More information

Evolution of Populations. Chapter 17

Evolution of Populations. Chapter 17 Evolution of Populations Chapter 17 17.1 Genes and Variation i. Introduction: Remember from previous units. Genes- Units of Heredity Variation- Genetic differences among individuals in a population. New

More information

InDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9

InDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9 Lecture 5 Alignment I. Introduction. For sequence data, the process of generating an alignment establishes positional homologies; that is, alignment provides the identification of homologous phylogenetic

More information

Dynamics of Coexistence of Asexual and Sexual Reproduction in Adaptive Landscape

Dynamics of Coexistence of Asexual and Sexual Reproduction in Adaptive Landscape Dynamics of Coexistence of Asexual and Sexual Reproduction in Adaptive Landscape Shuyun Jiao,Yanbo Wang, Ping Ao Shanghai Center for Systems Biomedicine, Key Laboratory of Systems Biomedicine of Ministry

More information

SWEEPFINDER2: Increased sensitivity, robustness, and flexibility

SWEEPFINDER2: Increased sensitivity, robustness, and flexibility SWEEPFINDER2: Increased sensitivity, robustness, and flexibility Michael DeGiorgio 1,*, Christian D. Huber 2, Melissa J. Hubisz 3, Ines Hellmann 4, and Rasmus Nielsen 5 1 Department of Biology, Pennsylvania

More information

-SQA-SCOTTISH QUALIFICATIONS AUTHORITY. Hanover House 24 Douglas Street GLASGOW G2 7NQ NATIONAL CERTIFICATE MODULE DESCRIPTOR

-SQA-SCOTTISH QUALIFICATIONS AUTHORITY. Hanover House 24 Douglas Street GLASGOW G2 7NQ NATIONAL CERTIFICATE MODULE DESCRIPTOR -SQA-SCOTTISH QUALIFICATIONS AUTHORITY Hanover House 24 Douglas Street GLASGOW G2 7NQ NATIONAL CERTIFICATE MODULE DESCRIPTOR -Module Number- 7312012 -Session-1992-93 -Superclass- RH -Title- EVOLUTION (x

More information

Evolutionary games of condensates in coupled birth-death processes

Evolutionary games of condensates in coupled birth-death processes Evolutionary games of condensates in coupled birth-death processes Simon Kirschler, Asmar Nayis Universität Augsburg 21. March 2016 Simon Kirschler, Asmar Nayis (Universität Augsburg)Evolutionary games

More information

APES C4L2 HOW DOES THE EARTH S LIFE CHANGE OVER TIME? Textbook pages 85 88

APES C4L2 HOW DOES THE EARTH S LIFE CHANGE OVER TIME? Textbook pages 85 88 APES C4L2 HOW DOES THE EARTH S LIFE CHANGE OVER TIME? Textbook pages 85 88 Big Ideas Concept 4-2A The scientific theory of evolution explains how life on Earth changes over time through changes in the

More information

Supplementary Information

Supplementary Information 1 Supplementary Information 2 3 Supplementary Note 1 Further analysis of the model 4 5 6 7 8 In Supplementary Note 1 we further analyze our model, investigating condition (5) presented in the Methods under

More information

8/23/2014. Phylogeny and the Tree of Life

8/23/2014. Phylogeny and the Tree of Life Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major

More information

Inferring Molecular Phylogeny

Inferring Molecular Phylogeny Dr. Walter Salzburger he tree of life, ustav Klimt (1907) Inferring Molecular Phylogeny Inferring Molecular Phylogeny 55 Maximum Parsimony (MP): objections long branches I!! B D long branch attraction

More information

Computational Biology: Basics & Interesting Problems

Computational Biology: Basics & Interesting Problems Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information

More information

The neutral theory of molecular evolution

The neutral theory of molecular evolution The neutral theory of molecular evolution Introduction I didn t make a big deal of it in what we just went over, but in deriving the Jukes-Cantor equation I used the phrase substitution rate instead of

More information

Formalizing the gene centered view of evolution

Formalizing the gene centered view of evolution Chapter 1 Formalizing the gene centered view of evolution Yaneer Bar-Yam and Hiroki Sayama New England Complex Systems Institute 24 Mt. Auburn St., Cambridge, MA 02138, USA yaneer@necsi.org / sayama@necsi.org

More information

Reproduction- passing genetic information to the next generation

Reproduction- passing genetic information to the next generation 166 166 Essential Question: How has biological evolution led to the diversity of life? B-5 Natural Selection Traits that make an organism more or less likely to survive in an environment and reproduce

More information

Creating a Dichotomous Key

Creating a Dichotomous Key Dichotomous Keys A tool used that allows users to determine the identity of unknown species Keys consist of a series of choices, where the user selects from a series of connected pairs Each pair of choices

More information

Coevolution of learning and niche construction. Reiji Suzuki, Yasunori Noba and Takaya Arita

Coevolution of learning and niche construction. Reiji Suzuki, Yasunori Noba and Takaya Arita Coevolution of learning and niche construction Reiji Suzuki, Yasunori Noba and Takaya Arita Graduate School of Information Science, Nagoya University Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan {reiji,

More information

COMP3411: Artificial Intelligence 10a. Evolutionary Computation

COMP3411: Artificial Intelligence 10a. Evolutionary Computation COMP3411 16s1 Evolutionary Computation 1 COMP3411: Artificial Intelligence 10a. Evolutionary Computation Outline Darwinian Evolution Evolutionary Computation paradigms Simulated Hockey Evolutionary Robotics

More information

AP Curriculum Framework with Learning Objectives

AP Curriculum Framework with Learning Objectives Big Ideas Big Idea 1: The process of evolution drives the diversity and unity of life. AP Curriculum Framework with Learning Objectives Understanding 1.A: Change in the genetic makeup of a population over

More information

EVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION

EVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION Friday, July 27th, 11:00 EVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION Karan Pattni karanp@liverpool.ac.uk University of Liverpool Joint work with Prof.

More information

1. T/F: Genetic variation leads to evolution. 2. What is genetic equilibrium? 3. What is speciation? How does it occur?

1. T/F: Genetic variation leads to evolution. 2. What is genetic equilibrium? 3. What is speciation? How does it occur? 1. T/F: Genetic variation leads to evolution. 2. What is genetic equilibrium? 3. What is speciation? How does it occur? Warm UP Notes on Environmental Factor Concept Map Brief 6 questions and Concept Map

More information

2. Overproduction: More species are produced than can possibly survive

2. Overproduction: More species are produced than can possibly survive Name: Date: What to study? Class notes Graphic organizers with group notes Review sheets What to expect on the TEST? Multiple choice Short answers Graph Reading comprehension STRATEGIES Circle key words

More information

Biology Unit Overview and Pacing Guide

Biology Unit Overview and Pacing Guide This document provides teachers with an overview of each unit in the Biology curriculum. The Curriculum Engine provides additional information including knowledge and performance learning targets, key

More information

Critical Mutation Rate Has an Exponential Dependence on Population Size

Critical Mutation Rate Has an Exponential Dependence on Population Size Critical Mutation Rate Has an Exponential Dependence on Population Size Alastair Channon 1, Elizabeth Aston 1, Charles Day 1, Roman V. Belavkin 2 and Christopher G. Knight 3 1 Research Institute for the

More information

Tracing the Sources of Complexity in Evolution. Peter Schuster

Tracing the Sources of Complexity in Evolution. Peter Schuster Tracing the Sources of Complexity in Evolution Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Springer Complexity Lecture

More information

An Adaptive Association Test for Microbiome Data

An Adaptive Association Test for Microbiome Data An Adaptive Association Test for Microbiome Data Chong Wu 1, Jun Chen 2, Junghi 1 Kim and Wei Pan 1 1 Division of Biostatistics, School of Public Health, University of Minnesota; 2 Division of Biomedical

More information

Population Genetics and Evolution III

Population Genetics and Evolution III Population Genetics and Evolution III The Mechanisms of Evolution: Drift São Paulo / January 2019 SMRI (Italy) luca@peliti.org 1 Drift 2 The Population Genetics Triad Sewall Wright Ronald A. Fisher Motoo

More information

Evolution on simple and realistic landscapes

Evolution on simple and realistic landscapes Evolution on simple and realistic landscapes An old story in a new setting Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA

More information

Evolutionary computation

Evolutionary computation Evolutionary computation Andrea Roli andrea.roli@unibo.it Dept. of Computer Science and Engineering (DISI) Campus of Cesena Alma Mater Studiorum Università di Bologna Outline 1 Basic principles 2 Genetic

More information

Review of Exponential Change Model and Forces

Review of Exponential Change Model and Forces Physics 7B-1 (A/B) Professor Cebra Winter 2010 Lecture 5 Review of Exponential Change Model and Forces Slide 1 of 37 Exponential Growth Slide 2 of 37 Slide 3 of 37 Exponential decay Slide 4 of 37 The half

More information

Understanding relationship between homologous sequences

Understanding relationship between homologous sequences Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective

More information

Evolution on Realistic Landscapes

Evolution on Realistic Landscapes Evolution on Realistic Landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Santa Fe Institute Seminar Santa Fe, 22.05.2012

More information

A. Incorrect! In the binomial naming convention the Kingdom is not part of the name.

A. Incorrect! In the binomial naming convention the Kingdom is not part of the name. Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific

More information

Major questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.

Major questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics. Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary

More information

Identify stages of plant life cycle Botany Oral/written pres, exams

Identify stages of plant life cycle Botany Oral/written pres, exams DPI Standards Biology Education (for students) 1. Characteristics of organisms Know Properties of living organisms, including: Acquire and use energy and materials Sense and respond to stimuli Reproduce

More information

Course ID May 2017 COURSE OUTLINE. Biology 102 (C-ID Number: BIOL 140) General Biology (C-ID Title: Organismal Biology)

Course ID May 2017 COURSE OUTLINE. Biology 102 (C-ID Number: BIOL 140) General Biology (C-ID Title: Organismal Biology) Degree Applicable Glendale Community College Course ID 005073 May 2017 COURSE OUTLINE Biology 102 (C-ID Number: BIOL 140) General Biology (C-ID Title: Organismal Biology) Catalog Statement BIOL 102 provides

More information

Topic 09 Evolution. I. Populations A. Evolution is change over time. (change in the frequency of heritable phenotypes & the alleles that govern them)

Topic 09 Evolution. I. Populations A. Evolution is change over time. (change in the frequency of heritable phenotypes & the alleles that govern them) Topic 09 Evolution I. Populations A. Evolution is change over time (change in the frequency of heritable phenotypes & the alleles that govern them) 1 I. Populations A. Evolution is change over time (change

More information

Gecco 2007 Tutorial / Grammatical Evolution

Gecco 2007 Tutorial / Grammatical Evolution Gecco 2007 Grammatical Evolution Tutorial Conor Ryan Biocomputing and Developmental Systems Group Department of Computer Science and Information Systems University of Limerick Copyright is held by the

More information

Normalised evolutionary activity statistics and the need for phenotypic evidence

Normalised evolutionary activity statistics and the need for phenotypic evidence Open Ended Evolution workshop, ECAL 2015 20 July 2015 Normalised evolutionary activity statistics and the need for phenotypic evidence Dr Alastair Channon School of Computing and Mathematics Keele University

More information

Chapter 8: Evolution and Natural Selection

Chapter 8: Evolution and Natural Selection Darwin s dangerous idea: evolution by natural selection Lectures by Mark Manteuffel, St. Louis Community College Chapter 8: Evolution and Natural Selection Use new chapter opening photo here Do Now: Scientific

More information

CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES

CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:

More information

Contrasts for a within-species comparative method

Contrasts for a within-species comparative method Contrasts for a within-species comparative method Joseph Felsenstein, Department of Genetics, University of Washington, Box 357360, Seattle, Washington 98195-7360, USA email address: joe@genetics.washington.edu

More information

How Nature Circumvents Low Probabilities: The Molecular Basis of Information and Complexity. Peter Schuster

How Nature Circumvents Low Probabilities: The Molecular Basis of Information and Complexity. Peter Schuster How Nature Circumvents Low Probabilities: The Molecular Basis of Information and Complexity Peter Schuster Institut für Theoretische Chemie Universität Wien, Austria Nonlinearity, Fluctuations, and Complexity

More information

It all depends on barriers that prevent members of two species from producing viable, fertile hybrids.

It all depends on barriers that prevent members of two species from producing viable, fertile hybrids. Name: Date: Theory of Evolution Evolution: Change in a over a period of time Explains the great of organisms Major points of Origin of Species Descent with Modification o All organisms are related through

More information

Classical Selection, Balancing Selection, and Neutral Mutations

Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected

More information

AP Biology. Read college-level text for understanding and be able to summarize main concepts

AP Biology. Read college-level text for understanding and be able to summarize main concepts St. Mary's College AP Biology Continuity and Change Consider how specific changes to an ecosystem (geological, climatic, introduction of new organisms, etc.) can affect the organisms that live within it.

More information

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics

ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Human Population Genomics Heritability & Environment Feasibility of identifying

More information