Evolutionary Dynamics & its Tendencies. David Krakauer, Santa Fe Institute.
|
|
- Tyler Randall
- 5 years ago
- Views:
Transcription
1 Evolutionary Dynamics & its Tendencies David Krakauer, Santa Fe Institute.
2 A Talk in 2 Parts Part 1: What is Evolution, What has it generated & What are its limits? Part II: The Evolutionary dynamics of Minimal Forms - microbes
3 Evolutionary questions? Why is there life-like dynamics on earth? Why are organisms so diverse? Why are organisms so complex? What is the relationship of genetic information to learned information? When does cultural evolution outpace genetic evolution? Is self-awareness inevitable?
4
5 What is Evolutionary Theory? A Physics like theory searching for Laws? A Statistical/Inferential Theory like Bayesian learning or approximate dynamic programming? An algorithmic/computational theory?
6 The Darwinian Polynucleotide Machine 1,3,7,1,6,1,7,1,1,5,5,4,3,15,7,1,10,1,15,8,19,1 0,68,2,6,1,4,5,3,1,6,9,2,4,3,1,2,6,5,2,6,20,1,3, 2,176,2,1,1,2 (in MegaBases)
7
8 Ciccarelli et al. Science, 311,
9 Lynch, PNAS, 104,
10 Evolutionary Theory Population genetics/ neutral theory Quantitative genetics Quasispecies theory Game theory/adaptive dynamics Phylogenetic reconstruction/inference Niche Construction Gene-Culture Coevolution
11 Evolutionary Stoichiometry replication g i r i Energy + Resources 2g i
12 Evolutionary Stoichiometry competition g i + g j c ij g j
13 Evolutionary Stoichiometry mutation g i m ij Radiation g j m ij = µ H(i,j) (1 µ) L H(i,j)
14 Evolutionary Stoichiometry recombination g j + g l b ijl g i b ijl = 1, if i = j = l b ijl = ( ) 1 2 (1 c) + c ( ) H(j,l) 1 if i = j or i = l 2 b ijl = c ( ) H(j,l) 1 if H(i, j) + H(i, l) = H(j, l) 2
15 Replicator Equation g i r i 2g i c ij g i + g j g j n genomes ġ i = g i (r i f) where f = n r i g i and c ij = 1 i
16 Evolutionary Game Theory: Frequency dependent Replicator Equation g i r i (g) 2g i c ij g i + g j g j n genomes ġ i = g i (r i (g) f) where f = n r i (g)g i and c ij = 1 i
17 Evolutionary Game Theory: Frequency dependent Replicator Equation ġ i = g i (r i (g) f) Payoff Matrix P = [p ij ] with linear payoffs: n r i (g) = g j p ij j
18 Evolutionary Game Theory: Frequency dependent Replicator Equation n n n ġ i = g i ( g j p ij g j g k p jk ) j j k
19 Evolutionary Game Theory: Adaptive Dynamics for Continuous Traits dx dt = 1 δf(x 2 µσ2 N(x),x) δx x =x
20 Freq-dep Replicator Equation & Bayesian Inference An Insight by Cosma Shalizi
21 g i (t) t = g i (t 1)(r i (g) f) P (X Y ) = P (X) P (Y X) P (Y ) P (X Y ) = P (X) L X L L = P (Y ) = x ω P (Y X)P (X) P X (t) = P X (t 1) L X L P X (t) = P X (t 1)( L X L 1) = P X (t 1) 1 L(L X L) P X (t) = P X (t 1)(f t f), where f t = L X / L
22 Sequence Space & Limits to Evolution
23 I Z 10 ol o
24 Replicator-Mutator Equation 2 n ġ i = g j r j (g)m ij g i f) j m ij = µ H(i,j) (1 µ) L H(i,j)
25
26
27
28
29
30
31
32 Error Threshold g i µ
33 Fitness Landscape Delta function: µ < s L = 1 L Multiplicative function: µ < s
34 Kimura s Neutrality Inequality Expectation of Mutation Nµ Probability of Fixation 1 N Condition for Neutrality sn < 1
35 Evolutionary Information Storage Information Conserved organismal regularity Environmental regularity s µl N Information Lost s< µl N
36 Evolution, Localization & Information (with a 4 letter alphabet)
37 Information as Selective Uniformity ACGTC...T ATGTG...T ATCTG...A Aligned genomes l H i = j p (i) j log 4p (i) j I i = H max H i Information in Population C = L i H i
38 Information-Selection as a Compression Ratio ACGTC...T ATGTG...T ATCTG...A Aligned genomes l H i = j p (i) j log 4p (i) j C = LH max L i H i = L L i H i
39 sn > µl The Tendency to Population Multiplicity & Individual Minimality
40 The Space God versus the andromeda strain
41
42 KEY virus catalyzed host A catalyzed host B catalyzed
43 N = E v i s i h i Minimality Autonomy v i h v i i s i h i v h = N v h = N v h = 0 v h N
44 w = i E f(g i ) j NE h(g j ) w E = i E f(g i ) v i h i g i
45 v i h i g i g i = h i v i P rob(h i = 1) = q P rob(v i = 1) = p L v = i v i, < L v >= pn w = i N g i (1 + L v ) < w >= (q + p qp)n 1 + pn
46 N=4 N=8 host genome virus genome N=16 N=32
47 Evolution & Minimality Evolutionary theory is concerned largely with the frequency, variety & relationships among chemically improbable sequences Genomes tend to neutralize and/or eliminate redundant sequences - genomes need not encode perfectly predictable resources Replicator/Mutator Dynamics tends to favor small sequences which can be preserved Increasing autonomy (often size) reflects greater inferential uncertainty Neutral theory requires large populations for effective selection of target sequences -- more likely with small sequences Evolution can be thought of as an inferential, model fitting process (Bayesian) and selection as a mechanism for injecting information into sequences Genetic dissipation in coevolutionary contexts requires a consideration of rates of gene inactivation in all interacting agents Genome growth beyond competitive persistence is driven by, e.g. robustness & control
48 Whence Complexity?
Complex Systems Theory and Evolution
Complex Systems Theory and Evolution Melanie Mitchell and Mark Newman Santa Fe Institute, 1399 Hyde Park Road, Santa Fe, NM 87501 In Encyclopedia of Evolution (M. Pagel, editor), New York: Oxford University
More informationSymbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype
Symbiotic Sympatric Speciation: Compliance with Interaction-driven Phenotype Differentiation from a Single Genotype Kunihiko Kaneko (Univ of Tokyo, Komaba) with Tetsuya Yomo (Osaka Univ.) experiment Akiko
More informationSimple Models of Evolutive Population Dynamics
October 20, 2010 Replicators Living cells (mono and multicellular organisms, sexual and asexual, etc.): DNA, mithocondries, Viruses. Transposable elements, plasmids. Computer viruses. Memes (cultural replicators).
More informationPopulation Genetics I. Bio
Population Genetics I. Bio5488-2018 Don Conrad dconrad@genetics.wustl.edu Why study population genetics? Functional Inference Demographic inference: History of mankind is written in our DNA. We can learn
More informationPhylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
More informationEvolutionary Genetics: Part 0.2 Introduction to Population genetics
Evolutionary Genetics: Part 0.2 Introduction to Population genetics S. chilense S. peruvianum Winter Semester 2012-2013 Prof Aurélien Tellier FG Populationsgenetik Population genetics Evolution = changes
More informationNatural Computation. Transforming Tools of NBIC: Complex Adaptive Systems. James P. Crutchfield Santa Fe Institute
Natural Computation Transforming Tools of NBIC: Complex Adaptive Systems James P. Crutchfield www.santafe.edu/~chaos Santa Fe Institute Nanotechnology, Biotechnology, Information Technology, and Cognitive
More informationHaploid & diploid recombination and their evolutionary impact
Haploid & diploid recombination and their evolutionary impact W. Garrett Mitchener College of Charleston Mathematics Department MitchenerG@cofc.edu http://mitchenerg.people.cofc.edu Introduction The basis
More informationError thresholds on realistic fitness landscapes
Error thresholds on realistic fitness landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Evolutionary Dynamics:
More informationLecture Notes: BIOL2007 Molecular Evolution
Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits
More informationPopulation Genetics: a tutorial
: a tutorial Institute for Science and Technology Austria ThRaSh 2014 provides the basic mathematical foundation of evolutionary theory allows a better understanding of experiments allows the development
More informationNEUROEVOLUTION. Contents. Evolutionary Computation. Neuroevolution. Types of neuro-evolution algorithms
Contents Evolutionary Computation overview NEUROEVOLUTION Presenter: Vlad Chiriacescu Neuroevolution overview Issues in standard Evolutionary Computation NEAT method Complexification in competitive coevolution
More informationMicrobiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities
More informationNeutral Theory of Molecular Evolution
Neutral Theory of Molecular Evolution Kimura Nature (968) 7:64-66 King and Jukes Science (969) 64:788-798 (Non-Darwinian Evolution) Neutral Theory of Molecular Evolution Describes the source of variation
More informationCHAPTER 23 THE EVOLUTIONS OF POPULATIONS. Section C: Genetic Variation, the Substrate for Natural Selection
CHAPTER 23 THE EVOLUTIONS OF POPULATIONS Section C: Genetic Variation, the Substrate for Natural Selection 1. Genetic variation occurs within and between populations 2. Mutation and sexual recombination
More informationEvolution of Genotype-Phenotype mapping in a von Neumann Self-reproduction within the Platform of Tierra
Evolution of Genotype-Phenotype mapping in a von Neumann Self-reproduction within the Platform of Tierra Declan Baugh and Barry Mc Mullin The Rince Institute, Dublin City University, Ireland declan.baugh2@mail.dcu.ie,
More informationRise and Fall of Mutator Bacteria
Rise and Fall of Mutator Bacteria The Evolution of Mutation Rates in Bacteria Yoav Ram Hadany Evolutionary Theory Lab 29 May 2011 Bacteria Bacteria are unicellular, haploid and asexual Reproduce by binary
More informationEvolution & Learning in Games
1 / 28 Evolution & Learning in Games Econ 243B Jean-Paul Carvalho Lecture 5. Revision Protocols and Evolutionary Dynamics 2 / 28 Population Games played by Boundedly Rational Agents We have introduced
More informationThe theory of evolution continues to be refined as scientists learn new information.
Section 3: The theory of evolution continues to be refined as scientists learn new information. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the conditions of the
More informationComplexity in social dynamics : from the. micro to the macro. Lecture 4. Franco Bagnoli. Lecture 4. Namur 7-18/4/2008
Complexity in Namur 7-18/4/2008 Outline 1 Evolutionary models. 2 Fitness landscapes. 3 Game theory. 4 Iterated games. Prisoner dilemma. 5 Finite populations. Evolutionary dynamics The word evolution is
More informationChapter 8: Introduction to Evolutionary Computation
Computational Intelligence: Second Edition Contents Some Theories about Evolution Evolution is an optimization process: the aim is to improve the ability of an organism to survive in dynamically changing
More informationAn Introduction to Evolutionary Game Theory: Lecture 2
An Introduction to Evolutionary Game Theory: Lecture 2 Mauro Mobilia Lectures delivered at the Graduate School on Nonlinear and Stochastic Systems in Biology held in the Department of Applied Mathematics,
More informationMutual Information & Genotype-Phenotype Association. Norman MacDonald January 31, 2011 CSCI 4181/6802
Mutual Information & Genotype-Phenotype Association Norman MacDonald January 31, 2011 CSCI 4181/6802 2 Overview What is information (specifically Shannon Information)? What are information entropy and
More informationEvolution and Epigenetics. Seminar: Social, Cognitive and Affective Neuroscience Speaker: Wolf-R. Brockhaus
Evolution and Epigenetics Seminar: Social, Cognitive and Affective Neuroscience Speaker: Wolf-R. Brockhaus 1. History of evolutionary theory The history of evolutionary theory ~ 1800: Lamarck 1859: Darwin's
More informationMechanisms of molecular cooperation
Mechanisms of molecular cooperation Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Homo Sociobiologicus Evolution of human
More informationFitness landscapes and seascapes
Fitness landscapes and seascapes Michael Lässig Institute for Theoretical Physics University of Cologne Thanks Ville Mustonen: Cross-species analysis of bacterial promoters, Nonequilibrium evolution of
More informationarxiv:physics/ v1 [physics.bio-ph] 19 Apr 2000
Optimal Mutation Rates in Dynamic Environments Martin Nilsson Santa Fe Institute, 1399 Hyde Park Road, Santa Fe, New Mexico 87501 USA Institute of Theoretical Physics, Chalmers University of Technology
More informationChapter 15: Darwin and Evolution
Chapter 15: Darwin and Evolution AP Curriculum Alignment Big Idea 1 is about evolution. Charles Darwin is called the father of evolution because his theory of natural selection explains how evolution occurs.
More informationEvolution and Computation. Christos H. Papadimitriou The Simons Institute
Evolution and Computation Christos H. Papadimitriou The Simons Institute The Algorithm as a Lens It started with Alan Turing, 60 years ago Algorithmic thinking as a novel and productive point of view for
More informationSex accelerates adaptation
Molecular Evolution Sex accelerates adaptation A study confirms the classic theory that sex increases the rate of adaptive evolution by accelerating the speed at which beneficial mutations sweep through
More informationObservation: we continue to observe large amounts of genetic variation in natural populations
MUTATION AND GENETIC VARIATION Observation: we continue to observe large amounts of genetic variation in natural populations Problem: How does this variation arise and how is it maintained. Here, we look
More informationLecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012
Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based
More informationUnifying theories of molecular, community and network evolution 1
Carlos J. Melián National Center for Ecological Analysis and Synthesis, University of California, Santa Barbara Microsoft Research Ltd, Cambridge, UK. Unifying theories of molecular, community and network
More informationThe Advantage of Using Mathematics in Biology
The Advantage of Using Mathematics in Biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Erwin Schrödinger-Institut
More informationCode: ECTS Credits: 6. Degree Type Year Semester
2017/2018 Evolution Code: 101961 ECTS Credits: 6 Degree Type Year Semester 2500890 Genetics OB 3 2 Contact Name: Francisco José Rodríguez-Trelles Astruga Email: FranciscoJose.RodriguezTrelles@uab.cat Prerequisites
More informationCOMP3411: Artificial Intelligence 7a. Evolutionary Computation
COMP3411 14s1 Evolutionary Computation 1 COMP3411: Artificial Intelligence 7a. Evolutionary Computation Outline Darwinian Evolution Evolutionary Computation paradigms Simulated Hockey Evolutionary Robotics
More informationEvolution of Populations
Evolution of Populations Gene Pools 1. All of the genes in a population - Contains 2 or more alleles (forms of a gene) for each trait 2. Relative frequencies - # of times an allele occurs in a gene pool
More informationIntroduction to population genetics & evolution
Introduction to population genetics & evolution Course Organization Exam dates: Feb 19 March 1st Has everybody registered? Did you get the email with the exam schedule Summer seminar: Hot topics in Bioinformatics
More informationEvolutionary Algorithms
Evolutionary Algorithms a short introduction Giuseppe Narzisi Courant Institute of Mathematical Sciences New York University 31 January 2008 Outline 1 Evolution 2 Evolutionary Computation 3 Evolutionary
More informationEvolutionary Theory. Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A.
Evolutionary Theory Mathematical and Conceptual Foundations Sean H. Rice Sinauer Associates, Inc. Publishers Sunderland, Massachusetts U.S.A. Contents Preface ix Introduction 1 CHAPTER 1 Selection on One
More informationUNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology
UNIT V Chapter 11 Evolution of Populations UNIT 4: EVOLUTION Chapter 11: The Evolution of Populations I. Genetic Variation Within Populations (11.1) A. Genetic variation in a population increases the chance
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationMicrobial Taxonomy and the Evolution of Diversity
19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy
More informationNatural selection, Game Theory and Genetic Diversity
Natural selection, Game Theory and Genetic Diversity Georgios Piliouras California Institute of Technology joint work with Ruta Mehta and Ioannis Panageas Georgia Institute of Technology Evolution: A Game
More informationUnderstanding Science Through the Lens of Computation. Richard M. Karp Nov. 3, 2007
Understanding Science Through the Lens of Computation Richard M. Karp Nov. 3, 2007 The Computational Lens Exposes the computational nature of natural processes and provides a language for their description.
More informationEvolutionary Computation. DEIS-Cesena Alma Mater Studiorum Università di Bologna Cesena (Italia)
Evolutionary Computation DEIS-Cesena Alma Mater Studiorum Università di Bologna Cesena (Italia) andrea.roli@unibo.it Evolutionary Computation Inspiring principle: theory of natural selection Species face
More informationIs the Concept of Error Catastrophy Relevant for Viruses? Peter Schuster
Is the Concept of Error Catastrophy Relevant for Viruses? Quasispecies and error thresholds on realistic landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa
More information7. Tests for selection
Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info
More informationGene regulation: From biophysics to evolutionary genetics
Gene regulation: From biophysics to evolutionary genetics Michael Lässig Institute for Theoretical Physics University of Cologne Thanks Ville Mustonen Johannes Berg Stana Willmann Curt Callan (Princeton)
More informationTHE EVOLVING WORLD CHAPTERS 4 & 5. Preethy Subramanian & Adam Booth
THE EVOLVING WORLD CHAPTERS 4 & 5 Preethy Subramanian & Adam Booth Chapter 4 Evolution and Conservation Mindell s Main Idea Our understanding of evolutionary history allows us to better focus our resources
More informationEvolutionary computation
Evolutionary computation Andrea Roli andrea.roli@unibo.it DEIS Alma Mater Studiorum Università di Bologna Evolutionary computation p. 1 Evolutionary Computation Evolutionary computation p. 2 Evolutionary
More informationRobust Predictions in Games with Incomplete Information
Robust Predictions in Games with Incomplete Information joint with Stephen Morris (Princeton University) November 2010 Payoff Environment in games with incomplete information, the agents are uncertain
More informationCAUGHT IN THE ACT APSQ 01
ANNEXE A.1 CAUGHT IN THE ACT APSQ 01 Document PowerPoint, disponible en téléchargement seulement à l adresse suivante : http://www.apsq.org/sautquantique/tresors.html CAUGHT IN TH E A CT : AG E NTS O F
More informationGenetic Algorithm: introduction
1 Genetic Algorithm: introduction 2 The Metaphor EVOLUTION Individual Fitness Environment PROBLEM SOLVING Candidate Solution Quality Problem 3 The Ingredients t reproduction t + 1 selection mutation recombination
More informationEvolution of Populations. Chapter 17
Evolution of Populations Chapter 17 17.1 Genes and Variation i. Introduction: Remember from previous units. Genes- Units of Heredity Variation- Genetic differences among individuals in a population. New
More informationInDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9
Lecture 5 Alignment I. Introduction. For sequence data, the process of generating an alignment establishes positional homologies; that is, alignment provides the identification of homologous phylogenetic
More informationDynamics of Coexistence of Asexual and Sexual Reproduction in Adaptive Landscape
Dynamics of Coexistence of Asexual and Sexual Reproduction in Adaptive Landscape Shuyun Jiao,Yanbo Wang, Ping Ao Shanghai Center for Systems Biomedicine, Key Laboratory of Systems Biomedicine of Ministry
More informationSWEEPFINDER2: Increased sensitivity, robustness, and flexibility
SWEEPFINDER2: Increased sensitivity, robustness, and flexibility Michael DeGiorgio 1,*, Christian D. Huber 2, Melissa J. Hubisz 3, Ines Hellmann 4, and Rasmus Nielsen 5 1 Department of Biology, Pennsylvania
More information-SQA-SCOTTISH QUALIFICATIONS AUTHORITY. Hanover House 24 Douglas Street GLASGOW G2 7NQ NATIONAL CERTIFICATE MODULE DESCRIPTOR
-SQA-SCOTTISH QUALIFICATIONS AUTHORITY Hanover House 24 Douglas Street GLASGOW G2 7NQ NATIONAL CERTIFICATE MODULE DESCRIPTOR -Module Number- 7312012 -Session-1992-93 -Superclass- RH -Title- EVOLUTION (x
More informationEvolutionary games of condensates in coupled birth-death processes
Evolutionary games of condensates in coupled birth-death processes Simon Kirschler, Asmar Nayis Universität Augsburg 21. March 2016 Simon Kirschler, Asmar Nayis (Universität Augsburg)Evolutionary games
More informationAPES C4L2 HOW DOES THE EARTH S LIFE CHANGE OVER TIME? Textbook pages 85 88
APES C4L2 HOW DOES THE EARTH S LIFE CHANGE OVER TIME? Textbook pages 85 88 Big Ideas Concept 4-2A The scientific theory of evolution explains how life on Earth changes over time through changes in the
More informationSupplementary Information
1 Supplementary Information 2 3 Supplementary Note 1 Further analysis of the model 4 5 6 7 8 In Supplementary Note 1 we further analyze our model, investigating condition (5) presented in the Methods under
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationInferring Molecular Phylogeny
Dr. Walter Salzburger he tree of life, ustav Klimt (1907) Inferring Molecular Phylogeny Inferring Molecular Phylogeny 55 Maximum Parsimony (MP): objections long branches I!! B D long branch attraction
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationThe neutral theory of molecular evolution
The neutral theory of molecular evolution Introduction I didn t make a big deal of it in what we just went over, but in deriving the Jukes-Cantor equation I used the phrase substitution rate instead of
More informationFormalizing the gene centered view of evolution
Chapter 1 Formalizing the gene centered view of evolution Yaneer Bar-Yam and Hiroki Sayama New England Complex Systems Institute 24 Mt. Auburn St., Cambridge, MA 02138, USA yaneer@necsi.org / sayama@necsi.org
More informationReproduction- passing genetic information to the next generation
166 166 Essential Question: How has biological evolution led to the diversity of life? B-5 Natural Selection Traits that make an organism more or less likely to survive in an environment and reproduce
More informationCreating a Dichotomous Key
Dichotomous Keys A tool used that allows users to determine the identity of unknown species Keys consist of a series of choices, where the user selects from a series of connected pairs Each pair of choices
More informationCoevolution of learning and niche construction. Reiji Suzuki, Yasunori Noba and Takaya Arita
Coevolution of learning and niche construction Reiji Suzuki, Yasunori Noba and Takaya Arita Graduate School of Information Science, Nagoya University Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan {reiji,
More informationCOMP3411: Artificial Intelligence 10a. Evolutionary Computation
COMP3411 16s1 Evolutionary Computation 1 COMP3411: Artificial Intelligence 10a. Evolutionary Computation Outline Darwinian Evolution Evolutionary Computation paradigms Simulated Hockey Evolutionary Robotics
More informationAP Curriculum Framework with Learning Objectives
Big Ideas Big Idea 1: The process of evolution drives the diversity and unity of life. AP Curriculum Framework with Learning Objectives Understanding 1.A: Change in the genetic makeup of a population over
More informationEVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION
Friday, July 27th, 11:00 EVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION Karan Pattni karanp@liverpool.ac.uk University of Liverpool Joint work with Prof.
More information1. T/F: Genetic variation leads to evolution. 2. What is genetic equilibrium? 3. What is speciation? How does it occur?
1. T/F: Genetic variation leads to evolution. 2. What is genetic equilibrium? 3. What is speciation? How does it occur? Warm UP Notes on Environmental Factor Concept Map Brief 6 questions and Concept Map
More information2. Overproduction: More species are produced than can possibly survive
Name: Date: What to study? Class notes Graphic organizers with group notes Review sheets What to expect on the TEST? Multiple choice Short answers Graph Reading comprehension STRATEGIES Circle key words
More informationBiology Unit Overview and Pacing Guide
This document provides teachers with an overview of each unit in the Biology curriculum. The Curriculum Engine provides additional information including knowledge and performance learning targets, key
More informationCritical Mutation Rate Has an Exponential Dependence on Population Size
Critical Mutation Rate Has an Exponential Dependence on Population Size Alastair Channon 1, Elizabeth Aston 1, Charles Day 1, Roman V. Belavkin 2 and Christopher G. Knight 3 1 Research Institute for the
More informationTracing the Sources of Complexity in Evolution. Peter Schuster
Tracing the Sources of Complexity in Evolution Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Springer Complexity Lecture
More informationAn Adaptive Association Test for Microbiome Data
An Adaptive Association Test for Microbiome Data Chong Wu 1, Jun Chen 2, Junghi 1 Kim and Wei Pan 1 1 Division of Biostatistics, School of Public Health, University of Minnesota; 2 Division of Biomedical
More informationPopulation Genetics and Evolution III
Population Genetics and Evolution III The Mechanisms of Evolution: Drift São Paulo / January 2019 SMRI (Italy) luca@peliti.org 1 Drift 2 The Population Genetics Triad Sewall Wright Ronald A. Fisher Motoo
More informationEvolution on simple and realistic landscapes
Evolution on simple and realistic landscapes An old story in a new setting Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA
More informationEvolutionary computation
Evolutionary computation Andrea Roli andrea.roli@unibo.it Dept. of Computer Science and Engineering (DISI) Campus of Cesena Alma Mater Studiorum Università di Bologna Outline 1 Basic principles 2 Genetic
More informationReview of Exponential Change Model and Forces
Physics 7B-1 (A/B) Professor Cebra Winter 2010 Lecture 5 Review of Exponential Change Model and Forces Slide 1 of 37 Exponential Growth Slide 2 of 37 Slide 3 of 37 Exponential decay Slide 4 of 37 The half
More informationUnderstanding relationship between homologous sequences
Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective
More informationEvolution on Realistic Landscapes
Evolution on Realistic Landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Santa Fe Institute Seminar Santa Fe, 22.05.2012
More informationA. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
More informationMajor questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.
Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary
More informationIdentify stages of plant life cycle Botany Oral/written pres, exams
DPI Standards Biology Education (for students) 1. Characteristics of organisms Know Properties of living organisms, including: Acquire and use energy and materials Sense and respond to stimuli Reproduce
More informationCourse ID May 2017 COURSE OUTLINE. Biology 102 (C-ID Number: BIOL 140) General Biology (C-ID Title: Organismal Biology)
Degree Applicable Glendale Community College Course ID 005073 May 2017 COURSE OUTLINE Biology 102 (C-ID Number: BIOL 140) General Biology (C-ID Title: Organismal Biology) Catalog Statement BIOL 102 provides
More informationTopic 09 Evolution. I. Populations A. Evolution is change over time. (change in the frequency of heritable phenotypes & the alleles that govern them)
Topic 09 Evolution I. Populations A. Evolution is change over time (change in the frequency of heritable phenotypes & the alleles that govern them) 1 I. Populations A. Evolution is change over time (change
More informationGecco 2007 Tutorial / Grammatical Evolution
Gecco 2007 Grammatical Evolution Tutorial Conor Ryan Biocomputing and Developmental Systems Group Department of Computer Science and Information Systems University of Limerick Copyright is held by the
More informationNormalised evolutionary activity statistics and the need for phenotypic evidence
Open Ended Evolution workshop, ECAL 2015 20 July 2015 Normalised evolutionary activity statistics and the need for phenotypic evidence Dr Alastair Channon School of Computing and Mathematics Keele University
More informationChapter 8: Evolution and Natural Selection
Darwin s dangerous idea: evolution by natural selection Lectures by Mark Manteuffel, St. Louis Community College Chapter 8: Evolution and Natural Selection Use new chapter opening photo here Do Now: Scientific
More informationCREATING PHYLOGENETIC TREES FROM DNA SEQUENCES
INTRODUCTION CREATING PHYLOGENETIC TREES FROM DNA SEQUENCES This worksheet complements the Click and Learn developed in conjunction with the 2011 Holiday Lectures on Science, Bones, Stones, and Genes:
More informationContrasts for a within-species comparative method
Contrasts for a within-species comparative method Joseph Felsenstein, Department of Genetics, University of Washington, Box 357360, Seattle, Washington 98195-7360, USA email address: joe@genetics.washington.edu
More informationHow Nature Circumvents Low Probabilities: The Molecular Basis of Information and Complexity. Peter Schuster
How Nature Circumvents Low Probabilities: The Molecular Basis of Information and Complexity Peter Schuster Institut für Theoretische Chemie Universität Wien, Austria Nonlinearity, Fluctuations, and Complexity
More informationIt all depends on barriers that prevent members of two species from producing viable, fertile hybrids.
Name: Date: Theory of Evolution Evolution: Change in a over a period of time Explains the great of organisms Major points of Origin of Species Descent with Modification o All organisms are related through
More informationClassical Selection, Balancing Selection, and Neutral Mutations
Classical Selection, Balancing Selection, and Neutral Mutations Classical Selection Perspective of the Fate of Mutations All mutations are EITHER beneficial or deleterious o Beneficial mutations are selected
More informationAP Biology. Read college-level text for understanding and be able to summarize main concepts
St. Mary's College AP Biology Continuity and Change Consider how specific changes to an ecosystem (geological, climatic, introduction of new organisms, etc.) can affect the organisms that live within it.
More informationACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG Human Population Genomics
ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG 010101100010010100001010101010011011100110001100101000100101 Human Population Genomics Heritability & Environment Feasibility of identifying
More information