Complexity in Evolutionary Processes
|
|
- Kristian Taylor
- 5 years ago
- Views:
Transcription
1
2 Complexity in Evolutionary Processes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA 7th Vienna Central European Seminar on Particle Physics and Quantum Field Theory Vienna,
3 Web-Page for further information:
4 1. Exponential growth and selection 2. Evolution as replication and mutation 3. A phase transition in evolution 4. Fitness landscapes as source of complexity 5. Molecular landscapes from biopolymers 6. The role of stochasticity 7. Neutrality and selection 8. Computer simulation of evolution
5 1. Exponential growth and selection 2. Evolution as replication and mutation 3. A phase transition in evolution 4. Fitness landscapes as source of complexity 5. Molecular landscapes from biopolymers 6. The role of stochasticity 7. Neutrality and selection 8. Computer simulation of evolution
6 F 1 = Fn + Fn 1 ; F0 = 0, 1 = 1 n+ F Thomas Robert Malthus , 2, 4, 8,16, 32, 64, 128,... geometric progression exponential growth Leonardo da Pisa Fibonacci ~1180 ~1240 f n n The history of exponential growth
7 Three necessary conditions for Darwinian evolution are: 1. Multiplication, 2. Variation, and 3. Selection. Darwin discovered the principle of natural selection from empirical observations in nature.
8 dx dt x x C r x (0) = 1, x( t) = C x(0) + ) r t ( C x(0 ) e Pierre-François Verhulst, The logistic equation, 1828
9 s = f f 2 1 = 1 f 0.1 Two variants with a mean progeny of ten or eleven descendants
10 Numbers N 1 (n) and N 2 (n) N 1 (0) = 9999, N 2 (0) = 1 ; s = 0.1, 0.02, 0.01 Selection of advantageous mutants in populations of N = individuals
11 ( ) Φ r x x C Φ x r x r C x x r x C x x r x = = = = dt d 1: (t), dt d 1 dt d Darwin [ ] ( ) ( ) = = = = = = = = = n i i i j j n i i i j j j n i i i i n x f Φ Φ f x x f f x x C x x ; dt d 1 ; X :,X,,X X K ( ) { } 0 var 2 2 dt d 2 2 = > > < < = f f f Φ Generalization of the logistic equation to n variables yields selection
12 1. Exponential growth and selection 2. Evolution as replication and mutation 3. A phase transition in evolution 4. Fitness landscapes as source of complexity 5. Molecular landscapes from biopolymers 6. The role of stochasticity 7. Neutrality and selection 8. Computer simulation of evolution
13 Taq = thermus aquaticus Accuracy of replication: Q = q 1 q 2 q 3 q n The logics of DNA replication
14 Point mutation
15 Manfred Eigen = = = = = = n i i n i i i j i n i ji j x x f Φ n j Φ x x W x 1 1 1, 1,2, ; dt d K Mutation and (correct) replication as parallel chemical reactions M. Eigen Naturwissenschaften 58:465, M. Eigen & P. Schuster Naturwissenschaften 64:541, 65:7 und 65:341
16 = = = = = = = = n i i n i i i j i i n i ji j i n i ji j x x f Φ n j Φ x x f Q Φ x x W x , 1,2, ; dt d K Factorization of the value matrix W separates mutation and fitness effects.
17 integrating factor transformation eigenvalue problem Solution of the mutation-selection equation
18 1. Exponential growth and selection 2. Evolution as replication and mutation 3. A phase transition in evolution 4. Fitness landscapes as source of complexity 5. Molecular landscapes from biopolymers 6. The role of stochasticity 7. Neutrality and selection 8. Computer simulation of evolution
19 Quasispecies Uniform distribution Stationary population or quasispecies as a function of the mutation or error rate p Error rate p = 1-q
20 The no-mutational backflow or zeroth order approximation
21 quasispecies The error threshold in replication and mutation
22 1. Exponential growth and selection 2. Evolution as replication and mutation 3. A phase transition in evolution 4. Fitness landscapes as source of complexity 5. Molecular landscapes from biopolymers 6. The role of stochasticity 7. Neutrality and selection 8. Computer simulation of evolution
23 single peak landscape Rugged fitness landscapes
24 Error threshold on the single peak landscape
25 linear and multiplicative landscape Smooth fitness landscapes
26 The linear fitness landscape shows no error threshold
27 Make things as simple as possible, but not simpler! Albert Einstein Albert Einstein s razor, precise refence is unknown.
28 Sewall Wright Evolution in Mendelian populations. Genetics 16: The roles of mutation, inbreeding, crossbreeding, and selection in evolution. In: D.F.Jones, ed. Proceedings of the Sixth International Congress on Genetics, Vol.I. Brooklyn Botanical Garden. Ithaca, NY, pp Surfaces of selective value revisited. The American Naturalist 131:
29 Build-up principle of binary sequence spaces
30
31 single peak landscape realistic landscape Rugged fitness landscapes over individual binary sequences with n = 10
32 Error threshold: Individual sequences n = 10, = 2, s = 491 and d = 0, 1.0, 1.875
33 d = d = Case I: Strong Quasispecies n = 10, f 0 = 1.1, f n = 1.0, s = 919
34 d = d = Case III: Multiple transitions n = 10, f 0 = 1.1, f n = 1.0, s = 637
35 d = d = Case III: Multiple transitions n = 10, f 0 = 1.1, f n = 1.0, s = 637
36 Paul E. Phillipson, Peter Schuster. (2009) Modeling by nonlinear differential equations. Dissipative and conservative processes. World Scientific, Singapore, pp.9-60.
37 1, 1 largest eigenvalue and eigenvector diagonalization of matrix W complicated but not complex W = G F mutation matrix fitness landscape ( complex ) complex sequence structure complex mutation selection Complexity in molecular evolution
38 1. Exponential growth and selection 2. Evolution as replication and mutation 3. A phase transition in evolution 4. Fitness landscapes as source of complexity 5. Molecular landscapes from biopolymers 6. The role of stochasticity 7. Neutrality and selection 8. Computer simulation of evolution
39 N = 4 n N S < 3 n Criterion: Minimum free energy (mfe) Rules: _ ( _ ) _ {AU,CG,GC,GU,UA,UG} A symbolic notation of RNA secondary structure that is equivalent to the conventional graphs
40
41 The inverse folding algorithm searches for sequences that form a given RNA secondary structure under the minimum free energy criterion.
42 What is neutrality? Selective neutrality = = several genotypes having the same fitness. Structural neutrality = = several genotypes forming molecules with the same structure.
43 Space of genotypes: I = { I, I, I, I,..., I } ; Hamming metric N Space of phenotypes: S = { S, S, S, S,..., S } ; metric (not required) M N M ( I) = j S k -1 G k = ( S ) U I ( I) = S k j j k A mapping and its inversion
44 many genotypes one phenotype
45 GGCAAUCAG GCCAAUCAG GACAAUCAG CUCAAUCAG UUCAAUCAG AUCAAUCAG GUCAAUCAC GUCAAUCAU GUCAAUCAA GUCAAUCCG GUCAAUCGG GUUAAUCAG GUAAAUCAG GUCAAUCAG One-error neighborhood GUCAAUCUG GUCAAUGAG GUGAAUCAG GUCAAUUAG GUCUAUCAG GUCAAUAAG GUCGAUCAG GUCCAUCAG GUCAUUCAG GUCAGUCAG GUCACUCAG GUCAAACAG GUCAAGCAG GUCAACCAG The surrounding of GUCAAUCAG in sequence space
46 One error neighborhood Surrounding of an RNA molecule of chain length n=50 in sequence and shape space
47 One error neighborhood Surrounding of an RNA molecule of chain length n=50 in sequence and shape space
48 One error neighborhood Surrounding of an RNA molecule of chain length n=50 in sequence and shape space
49 One error neighborhood Surrounding of an RNA molecule of chain length n=50 in sequence and shape space
50 GGCUAUCGUAUGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACG GGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUAGACG GGCUAUCGUACGUUUACUCAAAAGUCUACGUUGGACCCAGGCAUUGGACG GGCUAUCGUACGCUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACG GGCCAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACG GGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACG GGCUAUCGUACGUGUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACG GGCUAACGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACG GGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCUGGCAUUGGACG GGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCACUGGACG GGCUAUCGUACGUUUACCCAAAAGUCUACGUUGGUCCCAGGCAUUGGACG GGCUAGCGUACGUUUACCCAAAAGUCUACGUUGGACCCAGGCAUUGGACG GGCUAUCGUACGUUUACCCGAAAGUCUACGUUGGACCCAGGCAUUGGACG GGCUAUCGUACGUUUACCCAAAAGCCUACGUUGGACCCAGGCAUUGGACG One error neighborhood Surrounding of an RNA molecule of chain length n=50 in sequence and shape space U U A C A A C C A A A G G U C U G A C G G C C C C A GG U U A C U GG A G U C A A CG U G U U G U C
51 Number Mean Value Variance Std.Dev. Total Hamming Distance: Nonzero Hamming Distance: Degree of Neutrality: Number of Structures: (((((.((((..(((...)))..)))).))).)) (((.((((..(((...)))..)))).))) ((((((((((..(((...)))..)))))))).)) (((((.((((..((((...))))..)))).))).)) (((((.((((.((((...)))).)))).))).)) (((((.(((((.(((...))).))))).))).)) (((((..(((..(((...)))..)))..))).)) (((((.((((..((...))..)))).))).)) ((((..((((..(((...)))..))))..)).)) (((((.((((..(((...)))..)))).))))) ((((.((((..(((...)))..)))).)))) (((((.(((...(((...)))...))).))).)) (((((.((((..(((...)))..)))).)).))) (((((.((((...((...))...)))).))).)) (((((.((((...)))).))).)) ((.((.((((..(((...)))..)))).))..)) (.(((.((((..(((...)))..)))).))).) (((((.(((((((((...))))))))).))).)) ((((..((((..(((...)))..))))...)))) ((...((((..(((...)))..))))...)) G G C Shadow Surrounding of an RNA structure in shape space: AUGC alphabet, chain length n=50 A C C A C A C A G U U U A AG U C G U U AC U U A C G U UG A G G U C U G A G C GA CC C A G
52 1. Exponential growth and selection 2. Evolution as replication and mutation 3. A phase transition in evolution 4. Fitness landscapes as source of complexity 5. Molecular landscapes from biopolymers 6. The role of stochasticity 7. Neutrality and selection 8. Computer simulation of evolution
53 Stochastic phenomena in evolutionary processes 1. Finite population size effects 2. Low numbers of individual species ODEs (in population genetics) describe expectation values in infinite populations. Every mutant starts from a single copy. 3. Selective neutrality Populations drift randomly in the space of neutral variants.
54 probabilistic notion of particle numbers X j master equation flow reactor
55 Evolution of RNA molecules as a Markow process
56 Evolution of RNA molecules as a Markow process
57 Evolution of RNA molecules as a Markow process
58 Evolution of RNA molecules as a Markow process
59 RNA replication and mutation as a multitype branching process
60
61 1. Exponential growth and selection 2. Evolution as replication and mutation 3. A phase transition in evolution 4. Fitness landscapes as source of complexity 5. Molecular landscapes from biopolymers 6. The role of stochasticity 7. Neutrality and selection 8. Computer simulation of evolution
62 Population size N e = 10000, s = 0 Stochastic population genetics of neutral, asexually reproducing species
63 Motoo Kimura s population genetics of neutral evolution. Evolutionary rate at the molecular level. Nature 217: , The Neutral Theory of Molecular Evolution. Cambridge University Press. Cambridge, UK, 1983.
64 The average time of replacement of a dominant genotype in a population is the reciprocal mutation rate, 1/, and therefore independent of population size. Fixation of mutants in neutral evolution (Motoo Kimura, 1955)
65 Is the Kimura scenario correct for frequent mutations? Fixation of mutants in neutral evolution (Motoo Kimura, 1955)
66 0.5 ) ( ) ( lim = = p x p x p d H = 1 a p x a p x p p = = 1 ) ( lim ) ( lim d H = 2 d H 3 1 ) ( 0,lim ) ( lim or 0 ) ( 1,lim ) ( lim = = = = p x p x p x p x p p p p Random fixation in the sense of Motoo Kimura Pairs of neutral sequences in replication networks P. Schuster, J. Swetina Bull. Math. Biol. 50:
67 A fitness landscape including neutrality
68 Neutral network: Individual sequences n = 10, = 1.1, d = 1.0
69 Consensus sequence of a quasispecies of two strongly coupled sequences of Hamming distance d H (X i,,x j ) = 1.
70 Neutral network: Individual sequences n = 10, = 1.1, d = 1.0
71 Consensus sequence of a quasispecies of two strongly coupled sequences of Hamming distance d H (X i,,x j ) = 2.
72 N = 7 Adjacency matrix Neutral networks with increasing : = 0.10, s = 229
73 1. Exponential growth and selection 2. Evolution as replication and mutation 3. A phase transition in evolution 4. Fitness landscapes as source of complexity 5. Molecular landscapes from biopolymers 6. The role of stochasticity 7. Neutrality and selection 8. Computer simulation of evolution
74 Computer simulation using Gillespie s algorithm: Replication rate constant: f k = / [ + d S (k) ] d S (k) = d H (S k,s ) Selection constraint: Population size, N = # RNA molecules, is controlled by the flow N ( t) N ± N Mutation rate: p = / site replication The flowreactor as a device for studies of evolution in vitro and in silico
75 Evolution in silico W. Fontana, P. Schuster, Science 280 (1998),
76 Structure of randomly chosen initial sequence Phenylalanyl-tRNA as target structure
77 In silico optimization in the flow reactor: Evolutionary Trajectory
78 28 neutral point mutations during a long quasi-stationary epoch Transition inducing point mutations change the molecular structure Neutral point mutations leave the molecular structure unchanged Neutral genotype evolution during phenotypic stasis
79 Evolutionary trajectory Spreading of the population on neutral networks Drift of the population center in sequence space
80
81
82 Coworkers Peter Stadler, Bärbel M. Stadler, Universität Leipzig, GE Walter Fontana, Harvard Medical School, MA Ivo L.Hofacker, Christoph Flamm, Universität Wien, AT Universität Wien Martin Nowak, Harvard University, MA Christian Reidys, Nankai University, Tien Tsin, China Christian Forst, Los Alamos National Laboratory, NM Kurt Grünberger, Michael Kospach, Andreas Wernitznig, Stefanie Widder, Stefan Wuchty, Jan Cupal, Stefan Bernhart, Lukas Endler, Ulrike Langhammer, Rainer Machne, Ulrike Mückstein, Erich Bornberg-Bauer, Universität Wien, AT Thomas Wiehe, Ulrike Göbel, Walter Grüner, Stefan Kopp, Jaqueline Weber, Institut für Molekulare Biotechnologie, Jena, GE
83 Acknowledgement of support Fonds zur Förderung der wissenschaftlichen Forschung (FWF) Projects No , 10578, 11065, , and Universität Wien Wiener Wissenschafts-, Forschungs- und Technologiefonds (WWTF) Project No. Mat05 Jubiläumsfonds der Österreichischen Nationalbank Project No. Nat-7813 European Commission: Contracts No , (NEST) Austrian Genome Research Program GEN-AU: Bioinformatics Network (BIN) Österreichische Akademie der Wissenschaften Siemens AG, Austria Universität Wien and the Santa Fe Institute
84 Thank you for your attention!
85 Web-Page for further information:
86
Error thresholds on realistic fitness landscapes
Error thresholds on realistic fitness landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Evolutionary Dynamics:
More informationEvolution of Biomolecular Structure 2006 and RNA Secondary Structures in the Years to Come. Peter Schuster
Evolution of Biomolecular Structure 2006 and RNA Secondary Structures in the Years to Come Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe,
More informationEvolution on simple and realistic landscapes
Evolution on simple and realistic landscapes An old story in a new setting Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA
More informationIs the Concept of Error Catastrophy Relevant for Viruses? Peter Schuster
Is the Concept of Error Catastrophy Relevant for Viruses? Quasispecies and error thresholds on realistic landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa
More informationHow Nature Circumvents Low Probabilities: The Molecular Basis of Information and Complexity. Peter Schuster
How Nature Circumvents Low Probabilities: The Molecular Basis of Information and Complexity Peter Schuster Institut für Theoretische Chemie Universität Wien, Austria Nonlinearity, Fluctuations, and Complexity
More informationRNA Bioinformatics Beyond the One Sequence-One Structure Paradigm. Peter Schuster
RNA Bioinformatics Beyond the One Sequence-One Structure Paradigm Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA 2008 Molecular
More informationMathematical Modeling of Evolution
Mathematical Modeling of Evolution Solved and Open Problems Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Emerging Modeling
More informationTracing the Sources of Complexity in Evolution. Peter Schuster
Tracing the Sources of Complexity in Evolution Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Springer Complexity Lecture
More informationNeutral Networks of RNA Genotypes and RNA Evolution in silico
Neutral Networks of RNA Genotypes and RNA Evolution in silico Peter Schuster Institut für Theoretische Chemie und Molekulare Strukturbiologie der Universität Wien RNA Secondary Structures in Dijon Dijon,
More informationRNA From Mathematical Models to Real Molecules
RNA From Mathematical Models to Real Molecules 3. Optimization and Evolution of RNA Molecules Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien IMPA enoma
More informationEvolution on Realistic Landscapes
Evolution on Realistic Landscapes Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Santa Fe Institute Seminar Santa Fe, 22.05.2012
More informationHow computation has changed research in chemistry and biology
How computation has changed research in chemistry and biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA IWR - 25 Jahre-Jubiläum
More informationEvolution and Molecules
Evolution and Molecules Basic questions of biology seen with phsicists eyes. Peter Schuster Institut für Theoretische Chemie, niversität Wien, Österreich und The Santa Fe Institute, Santa Fe, New Mexico,
More informationDesigning RNA Structures
Designing RN Structures From Theoretical Models to Real Molecules Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der niversität Wien Microbiology Seminar Mount Sinai School
More informationMathematische Probleme aus den Life-Sciences
Mathematische Probleme aus den Life-Sciences Peter Schuster Institut für Theoretische Chemie und Molekulare Strukturbiologie der Universität Wien Vortragsreihe Mathematik im Betrieb Dornbirn, 27.05.2004
More informationRNA From Mathematical Models to Real Molecules
R From Mathematical Models to Real Molecules 1. Sequences and Structures Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der niversität Wien IMP enoma School Valdivia, 12.
More informationThe Advantage of Using Mathematics in Biology
The Advantage of Using Mathematics in Biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Erwin Schrödinger-Institut
More informationProblem solving by inverse methods in systems biology
Problem solving by inverse methods in systems biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA High-erformance comutational
More informationMechanisms of molecular cooperation
Mechanisms of molecular cooperation Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Homo Sociobiologicus Evolution of human
More informationChemistry and Evolution at the Origin of Life. Visions and Reality
hemistry and Evolution at the rigin of Life Visions and Reality Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien Madrid, Astrobiology Meeting 30.11.2001
More informationOrigin of life and early evolution in the light of present day molecular biology. Peter Schuster
Origin of life and early evolution in the light of present day molecular biology Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico,
More informationDifferent kinds of robustness in genetic and metabolic networks
Different kinds of robustness in genetic and metabolic networks Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien Seminar lecture Linz, 15.12.2003 enomics
More informationEvolutionary Dynamics and Optimization. Neutral Networks as Model-Landscapes. for. RNA Secondary-Structure Folding-Landscapes
Evolutionary Dynamics and Optimization Neutral Networks as Model-Landscapes for RNA Secondary-Structure Folding-Landscapes Christian V. Forst, Christian Reidys, and Jacqueline Weber Mailing Address: Institut
More informationVon der Thermodynamik zu Selbstorganisation, Evolution und Information
Von der Thermodynamik zu Selbstorganisation, Evolution und Information Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien Kolloquium des Physikalischen
More informationSelf-Organization and Evolution
Self-Organization and Evolution Peter Schuster Institut für Theoretische hemie und Molekulare Strukturbiologie der Universität Wien Wissenschaftliche esellschaft: Dynamik Komplexität menschliche Systeme
More informationChemistry on the Early Earth
Chemistry on the Early Earth Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Germany-Japan Round Table Heidelberg, 01. 03.11.2011
More informationCOMP598: Advanced Computational Biology Methods and Research
COMP598: Advanced Computational Biology Methods and Research Modeling the evolution of RNA in the sequence/structure network Jerome Waldispuhl School of Computer Science, McGill RNA world In prebiotic
More informationBridging from Chemistry to the Life Sciences Evolution seen with the Glasses of a Physicist a
Manfred Eigen-Lecture, Göttingen 09.05.2018 Bridging from Chemistry to the Life Sciences Evolution seen with the Glasses of a Physicist a Peter Schuster, Institut für Theoretische Chemie, Universität Wien
More informationCritical Mutation Rate Has an Exponential Dependence on Population Size
Critical Mutation Rate Has an Exponential Dependence on Population Size Alastair Channon 1, Elizabeth Aston 1, Charles Day 1, Roman V. Belavkin 2 and Christopher G. Knight 3 1 Research Institute for the
More informationarxiv:physics/ v1 [physics.bio-ph] 27 Jun 2001
Maternal effects in molecular evolution Claus O. Wilke Digital Life Laboratory, Mail Code 36-93, Caltech, Pasadena, CA 925 wilke@caltech.edu (Printed: May 3, 27) arxiv:physics/693v [physics.bio-ph] 27
More informationReplication and Mutation on Neutral Networks: Updated Version 2000
Replication and Mutation on Neutral Networks: Updated Version 2000 Christian Reidys Christian V. Forst Peter Schuster SFI WORKING PAPER: 2000-11-061 SFI Working Papers contain accounts of scientific work
More informationThe Role of Topology in the Study of Evolution
The Role of Topology in the Study of Evolution Avery Broome August 31, 2015 Abstract In this paper, we will attempt to understand the role topology plays in analyzing RNA secondary structures by providing
More informationSystems Biology: A Personal View IX. Landscapes. Sitabhra Sinha IMSc Chennai
Systems Biology: A Personal View IX. Landscapes Sitabhra Sinha IMSc Chennai Fitness Landscapes Sewall Wright pioneered the description of how genotype or phenotypic fitness are related in terms of a fitness
More informationSystems biology and complexity research
Systems biology and complexity research Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Interdisciplinary Challenges for
More informationChance and necessity in evolution: lessons from RNA
Physica D 133 (1999) 427 452 Chance and necessity in evolution: lessons from RNA Peter Schuster a,, Walter Fontana b,1 a Institut für Theoretische Chemie und Molekulare Strukturbiologie, Universität Wien,
More informationEVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION
Friday, July 27th, 11:00 EVOLUTIONARY DYNAMICS AND THE EVOLUTION OF MULTIPLAYER COOPERATION IN A SUBDIVIDED POPULATION Karan Pattni karanp@liverpool.ac.uk University of Liverpool Joint work with Prof.
More informationA Method for Estimating Mean First-passage Time in Genetic Algorithms
A Method for Estimating Mean First-passage Time in Genetic Algorithms Hiroshi Furutani Department of Information Science, Kyoto University of Education, Fushimi-ku, Kyoto, 612-8522 Japan This paper presents
More informationQuasispecies distribution of Eigen model
Vol 16 No 9, September 2007 c 2007 Chin. Phys. Soc. 1009-1963/2007/16(09)/2600-08 Chinese Physics and IOP Publishing Ltd Quasispecies distribution of Eigen model Chen Jia( ), Li Sheng( ), and Ma Hong-Ru(
More informationError Propagation in the Hypercycle
Error Propagation in the Hypercycle Paulo R. A. Campos J. F. Fontanari Peter F. Stadler SFI WORKING PAPER: 1999-9-63 SFI Working Papers contain accounts of scientific work of the author(s) and do not necessarily
More informationExploration of population fixed-points versus mutation rates for functions of unitation
Exploration of population fixed-points versus mutation rates for functions of unitation J Neal Richter 1, Alden Wright 2, John Paxton 1 1 Computer Science Department, Montana State University, 357 EPS,
More informationEvolution and Design
Evolution and Design Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Traunkirchner Gedankenexperimente Traunkirchen, 13.09.2005
More informationLinear Algebra of the Quasispecies Model
Linear Algebra of the Quasispecies Model Artem Novozhilov Department of Mathematics North Dakota State University SIAM Conference on the Life Sciences, Charlotte, North Caroline, USA August 6, 2014 Artem
More informationEndowed with an Extra Sense : Mathematics and Evolution
Endowed with an Extra Sense : Mathematics and Evolution Todd Parsons Laboratoire de Probabilités et Modèles Aléatoires - Université Pierre et Marie Curie Center for Interdisciplinary Research in Biology
More informationLinear Algebra of Eigen s Quasispecies Model
Linear Algebra of Eigen s Quasispecies Model Artem Novozhilov Department of Mathematics North Dakota State University Midwest Mathematical Biology Conference, University of Wisconsin La Crosse May 17,
More informationPopulation Genetics and Evolution III
Population Genetics and Evolution III The Mechanisms of Evolution: Drift São Paulo / January 2019 SMRI (Italy) luca@peliti.org 1 Drift 2 The Population Genetics Triad Sewall Wright Ronald A. Fisher Motoo
More informationEvolution of Model Proteins on a Foldability Landscape
PROTEINS: Structure, Function, and Genetics 29:461 466 (1997) Evolution of Model Proteins on a Foldability Landscape Sridhar Govindarajan 1 and Richard A. Goldstein 1,2 * 1 Department of Chemistry, University
More informationFitness landscapes and seascapes
Fitness landscapes and seascapes Michael Lässig Institute for Theoretical Physics University of Cologne Thanks Ville Mustonen: Cross-species analysis of bacterial promoters, Nonequilibrium evolution of
More informationThe Mathematics of Darwinian Systems
The Mathematics of Darwinian Systems By Peter Schuster Abstract: Optimization is studied as the interplay of selection, recombination and mutation. The underlying model is based on ordinary differential
More informationEVOLUTIONARY DYNAMICS ON RANDOM STRUCTURES SIMON M. FRASER CHRISTIAN M, REIDYS DISCLAIMER. United States Government or any agency thereof.
i LA-UR-, Title: Author@): Submitted io: EVOLUTONARY DYNAMCS ON RANDOM STRUCTURES SMON M. FRASER CHRSTAN M, REDYS OPTMZATON AND SSMULATWS CONFERENCE SNGAPORE SEPTEMBER 1-4, 1997 DSCLAMER This report was
More informationEffects of Neutral Selection on the Evolution of Molecular Species
Effects of Neutral Selection on the Evolution of Molecular Species M. E. J. Newman Robin Engelhardt SFI WORKING PAPER: 1998-01-001 SFI Working Papers contain accounts of scientific work of the author(s)
More informationProblems on Evolutionary dynamics
Problems on Evolutionary dynamics Doctoral Programme in Physics José A. Cuesta Lausanne, June 10 13, 2014 Replication 1. Consider the Galton-Watson process defined by the offspring distribution p 0 =
More informationVom Modell zur Steuerung
Vom Modell zur Steuerung Sind wir überfordert von der Komplexität der Welt? Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria und The Santa Fe Institute, Santa Fe, New Mexico,
More informationModeling Evolution DAVID EPSTEIN CELEBRATION. John Milnor. Warwick University, July 14, Stony Brook University
Modeling Evolution John Milnor Stony Brook University DAVID EPSTEIN CELEBRATION Warwick University, July 14, 2007 A First Model for Evolution: The Phylogenetic Tree, U time V W X A B C D E F G 1500 1000
More informationMolecular evolution - Part 1. Pawan Dhar BII
Molecular evolution - Part 1 Pawan Dhar BII Theodosius Dobzhansky Nothing in biology makes sense except in the light of evolution Age of life on earth: 3.85 billion years Formation of planet: 4.5 billion
More informationRNA folding at elementary step resolution
RNA (2000), 6:325 338+ Cambridge University Press+ Printed in the USA+ Copyright 2000 RNA Society+ RNA folding at elementary step resolution CHRISTOPH FLAMM, 1 WALTER FONTANA, 2,3 IVO L. HOFACKER, 1 and
More informationNeutral Evolution of Mutational Robustness
Neutral Evolution of Mutational Robustness Erik van Nimwegen James P. Crutchfield Martijn Huynen SFI WORKING PAPER: 1999-03-021 SFI Working Papers contain accounts of scientific work of the author(s) and
More informationMATHEMATICAL MODELS - Vol. III - Mathematical Modeling and the Human Genome - Hilary S. Booth MATHEMATICAL MODELING AND THE HUMAN GENOME
MATHEMATICAL MODELING AND THE HUMAN GENOME Hilary S. Booth Australian National University, Australia Keywords: Human genome, DNA, bioinformatics, sequence analysis, evolution. Contents 1. Introduction:
More informationConvergence of a Moran model to Eigen s quasispecies model
Convergence of a Moran odel to Eigen s quasispecies odel Joseba Dalau Université Paris Sud and ENS Paris June 6, 2018 arxiv:1404.2133v1 [q-bio.pe] 8 Apr 2014 Abstract We prove that a Moran odel converges
More informationComplete Suboptimal Folding of RNA and the Stability of Secondary Structures
Stefan Wuchty 1 Walter Fontana 1,2 Ivo L. Hofacker 1 Peter Schuster 1,2 1 Institut für Theoretische Chemie, Universität Wien, Währingerstrasse 17, A-1090 Wien, Austria Complete Suboptimal Folding of RNA
More informationPopulation Genetics I. Bio
Population Genetics I. Bio5488-2018 Don Conrad dconrad@genetics.wustl.edu Why study population genetics? Functional Inference Demographic inference: History of mankind is written in our DNA. We can learn
More informationSI Appendix. 1. A detailed description of the five model systems
SI Appendix The supporting information is organized as follows: 1. Detailed description of all five models. 1.1 Combinatorial logic circuits composed of NAND gates (model 1). 1.2 Feed-forward combinatorial
More informationQUANTIFYING SLOW EVOLUTIONARY DYNAMICS IN RNA FITNESS LANDSCAPES
Journal of Bioinformatics and Computational Biology Vol. 8, No. 6 (2010) 1027 1040 c Imperial College Press DOI: 10.1142/S0219720010005075 QUANTIFYING SLOW EVOLUTIONARY DYNAMICS IN RNA FITNESS LANDSCAPES
More informationHow robust are the predictions of the W-F Model?
How robust are the predictions of the W-F Model? As simplistic as the Wright-Fisher model may be, it accurately describes the behavior of many other models incorporating additional complexity. Many population
More informationLecture Notes in Mathematics Editors: J.-M. Morel, Cachan F. Takens, Groningen B. Teissier, Paris
Lecture Notes in Mathematics 1915 Editors: J.-M. Morel, Cachan F. Takens, Groningen B. Teissier, Paris Türker Bıyıkoğlu Josef Leydold Peter F. Stadler Laplacian Eigenvectors of Graphs Perron-Frobenius
More informationThe Amoeba-Flagellate Transformation
The Amoeba-Flagellate Transformation Camille Stephan-Otto Attolini Institute for Theoretical Chemistry and Structural Biology, Vienna University, Austria Bled, Slovenia. March, 2005 The Amoeba-Flagellate
More informationPhylogeny and evolution of structure
Phylogeny and evolution of structure Tanja Gesell and Peter Schuster Abstract Darwin s conviction that all living beings on Earth are related and the graph of relatedness is tree-shaped has been essentially
More informationThe tree of life: Darwinian chemistry as the evolutionary force from cyanic acid to living molecules and cells
The tree of life: Darwinian chemistry as the evolutionary force from cyanic acid to living molecules and cells Nils G. Walter Chemistry So far we are here Chemistry Chemical Evolution Self-organization
More informationWright-Fisher Models, Approximations, and Minimum Increments of Evolution
Wright-Fisher Models, Approximations, and Minimum Increments of Evolution William H. Press The University of Texas at Austin January 10, 2011 1 Introduction Wright-Fisher models [1] are idealized models
More informationTo appear in the American Naturalist
Unifying within- and between-generation bet-hedging theories: An ode to J.H. Gillespie Sebastian J. Schreiber Department of Evolution and Ecology, One Shields Avenue, University of California, Davis, California
More informationA Note On Minimum Path Bases
A Note On Minimum Path Bases Petra M. Gleiss a, Josef Leydold b, Peter F. Stadler a,c a Institute for Theoretical Chemistry and Structural Biology, University of Vienna, Währingerstrasse 17, A-1090 Vienna,
More informationChemical Organization Theory
Chemical Organization Theory How are living systems organized? How do they evolve? Peter Dittrich Bio Systems Analysis Group FSU Jena Friedrich-Schiller-Universität Jena Jena Centre for Bioinformatics
More informationIIASA. Continuity in Evolution: On the Nature of Transitions INTERIM REPORT. IR / April
IIASA International Institute for Applied Systems Analysis A-2361 Laxenburg Austria Tel: +43 2236 807 Fax: +43 2236 71313 E-mail: info@iiasa.ac.at Web: www.iiasa.ac.at INTERIM REPORT IR-98-039 / April
More informationMA 777: Topics in Mathematical Biology
MA 777: Topics in Mathematical Biology David Murrugarra Department of Mathematics, University of Kentucky http://www.math.uky.edu/~dmu228/ma777/ Spring 2018 David Murrugarra (University of Kentucky) Lecture
More informationQuantifying slow evolutionary dynamics in RNA fitness landscapes
Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2010 Quantifying slow evolutionary dynamics in RNA fitness landscapes Sulc,
More informationComplexity in social dynamics : from the. micro to the macro. Lecture 4. Franco Bagnoli. Lecture 4. Namur 7-18/4/2008
Complexity in Namur 7-18/4/2008 Outline 1 Evolutionary models. 2 Fitness landscapes. 3 Game theory. 4 Iterated games. Prisoner dilemma. 5 Finite populations. Evolutionary dynamics The word evolution is
More informationProvided for non-commercial research and educational use. Not for reproduction, distribution or commercial use.
Provided for non-commercial research and educational use. Not for reproduction, distribution or commercial use. This article was originally published in the Encyclopedia of Ecology, Volumes 1-5 published
More informationNetworks in Molecular Evolution
PETER SCHUSTER & PETER F. STADLER Institut für Theoretische Chemie und Molekulare Strukturbiologie Universität Wien, Währingerstrasse 17,A-1090 Wien, Austria Tel: ++43 1 4277 52745, Fax: ++43 1 4277 52793,
More informationarxiv:physics/ v1 [physics.bio-ph] 19 Apr 2000
Optimal Mutation Rates in Dynamic Environments Martin Nilsson Santa Fe Institute, 1399 Hyde Park Road, Santa Fe, New Mexico 87501 USA Institute of Theoretical Physics, Chalmers University of Technology
More informationPredicting Fitness Effects of Beneficial Mutations in Digital Organisms
Predicting Fitness Effects of Beneficial Mutations in Digital Organisms Haitao Zhang 1 and Michael Travisano 1 1 Department of Biology and Biochemistry, University of Houston, Houston TX 77204-5001 Abstract-Evolutionary
More informationStatistics of RNA Melting Kinetics
Statistics of RNA Melting Kinetics By Manfred Tacker a, Walter Fontana b, Peter F. Stadler a;b and Peter Schuster a;b;c; a Institut fur Theoretische Chemie, Universitat Wien b Santa Fe Institute, Santa
More informationEvolutionary Dynamics & its Tendencies. David Krakauer, Santa Fe Institute.
Evolutionary Dynamics & its Tendencies David Krakauer, Santa Fe Institute. A Talk in 2 Parts Part 1: What is Evolution, What has it generated & What are its limits? Part II: The Evolutionary dynamics of
More informationCelloS: a Multi-level Approach to Evolutionary Dynamics
CelloS: a Multi-level Approach to Evolutionary Dynamics Camille Stephan-Otto Attolini 1, Peter F. Stadler 12, and Christoph Flamm 1 1 Institut für Theoretische Chemie, Universität Wien, Währingerstraße
More informationInstitut für Mathematik, Universität Wien, Strudlhofgasse 4, A-1090 Wien, Austria.
Letters in Math. Phys. 28 (1993), 251 255 A QUANTUM GROUP LIKE STRUCTURE ON NON COMMUTATIVE 2 TORI Andreas Cap Peter W. Michor Hermann Schichl Institut für Mathematik, Universität Wien, Strudlhofgasse
More informationPhylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?
Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species
More informationRelaxation Property and Stability Analysis of the Quasispecies Models
Commun. Theor. Phys. (Beijing, China) 52 (2009) pp. 726 734 c Chinese Physical Society and IOP Publishing Ltd Vol. 52, No. 4, October 15, 2009 Relaxation Property and Stability Analysis of the Quasispecies
More informationA coarse-grained Schrödinger cat
A coarse-grained Schrödinger cat Johannes KOFLER and Časlav BRUKNER Institut für Quantenoptik und Quanteninformation, Österreichische Akademie der Wissenschaften, Boltzmanngasse 3, 1090 Wien, Austria;
More informationPeter Schuster, Institut für Theoretische Chemie der Universität Wien, Austria Darwin s Optimization in the looking glasses of physics and chemistry
Peter Schuster, Institut für Theoretische Chemie der Universität Wien, Austria Darwin s Optimization in the looking glasses of physics and chemistry Prologue The traditions of scientific research in physics
More informationMolecular models of biological evolution have attracted
Exact solution of the Eigen model with general fitness functions and degradation rates David B. Saakian* and Chin-Kun Hu* *Institute of Physics, Academia Sinica, ankang, Taipei 11529, Taiwan; and Yerevan
More informationThe Evolution of Gene Dominance through the. Baldwin Effect
The Evolution of Gene Dominance through the Baldwin Effect Larry Bull Computer Science Research Centre Department of Computer Science & Creative Technologies University of the West of England, Bristol
More informationThe Wright-Fisher Model and Genetic Drift
The Wright-Fisher Model and Genetic Drift January 22, 2015 1 1 Hardy-Weinberg Equilibrium Our goal is to understand the dynamics of allele and genotype frequencies in an infinite, randomlymating population
More informationPopulation Genetics: a tutorial
: a tutorial Institute for Science and Technology Austria ThRaSh 2014 provides the basic mathematical foundation of evolutionary theory allows a better understanding of experiments allows the development
More informationWhy EvoSysBio? Combine the rigor from two powerful quantitative modeling traditions: Molecular Systems Biology. Evolutionary Biology
Why EvoSysBio? Combine the rigor from two powerful quantitative modeling traditions: Molecular Systems Biology rigorous models of molecules... in organisms Modeling Evolutionary Biology rigorous models
More informationEvolving Antibiotic Resistance in Bacteria by Controlling Mutation Rate
Evolving Antibiotic Resistance in Bacteria by Controlling Mutation Rate Roman V. Belavkin 1 1 School of Science and Technology Middlesex University, London NW4 4BT, UK December 11, 2015, Tokyo University
More informationWhen to use bit-wise neutrality
Nat Comput (010) 9:83 94 DOI 10.1007/s11047-008-9106-8 When to use bit-wise neutrality Tobias Friedrich Æ Frank Neumann Published online: 6 October 008 Ó Springer Science+Business Media B.V. 008 Abstract
More information6 Introduction to Population Genetics
70 Grundlagen der Bioinformatik, SoSe 11, D. Huson, May 19, 2011 6 Introduction to Population Genetics This chapter is based on: J. Hein, M.H. Schierup and C. Wuif, Gene genealogies, variation and evolution,
More informationThe Phenotype-Genotype- Phenotype (PGP) Map. Nayely Velez-Cruz and Dr. Manfred Laubichler
The Phenotype-Genotype- Phenotype (PGP) Map Nayely Velez-Cruz and Dr. Manfred Laubichler Overview 1. The role of the genotype to phenotype map in current evolutionary theory 2. Origins of phenotypic variation
More informationScientists have been measuring organisms metabolic rate per gram as a way of
1 Mechanism of Power Laws in Allometric Scaling in Biology Thursday 3/22/12: Scientists have been measuring organisms metabolic rate per gram as a way of comparing various species metabolic efficiency.
More informationPlasticity, Evolvability, and Modularity in RNA
242 JOURNAL L. OF ANCEL EXPERIMENTAL AND W. FONTANA ZOOLOGY (MOL DEV EVOL) 288:242 283 (2000) Plasticity, Evolvability, and Modularity in RNA LAUREN W. ANCEL 1 AND WALTER FONTANA 2,3 * 1 Department of
More informationThe Time Scale of Evolutionary Innovation
Krishnendu Chatterjee 1 *, Andreas Pavlogiannis 1, Ben Adlam 2, Martin A. Nowak 2 1 IST Austria, Klosterneuburg, Austria, 2 Program for Evolutionary Dynamics, Department of Organismic and Evolutionary
More information6 Introduction to Population Genetics
Grundlagen der Bioinformatik, SoSe 14, D. Huson, May 18, 2014 67 6 Introduction to Population Genetics This chapter is based on: J. Hein, M.H. Schierup and C. Wuif, Gene genealogies, variation and evolution,
More information