|
|
- Jessie Hutchinson
- 5 years ago
- Views:
Transcription
1
2
3
4 O( ) O( )
5 O( ) O( )
6 O( ) O( )
7 O( ) O( )
8 O( ) O( )
9 O( ) O( )
10 C A G C A C G A C A C U A G C A G U C A G U G U C A G A C U G C A I A C A G C A C G A C A C U A G C A G U C A G U G U C A G A C U G C A I A C A G C A C G A C A C U A G C A G U C A G U G U C A G A C U G C A I A GCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCAGACUGCAIACAGCACGACACUAGCAGUCAGUGUCA (((((...(((((...(((((...(((((...)))))...)))))...(((((...(((((...)))))...)))))...))))).
11 i+1 j 1 i i+1 j 1 j i j i i+1 j i i+1 j i j 1 j i j 1 j i k k+1 j i k k+1 j
12 γ(, + ) = = =. γ(, ) = max γ( +, ) + δ(, ); γ( +, ); γ(, ); max <<( ) [γ(, ) + γ( +, )]. {, : δ(, ) = { :, :, :, : } { :, : };,.
13 G G G A A C C U A G G G A A A U C C
14
15
16
17
18
19
20
21
22
23
24
25
26
27 parms wc += gu; descr h5(minlen=6,maxlen=7) ss(len=2) h5(minlen=3,maxlen=4) ss(minlen=4,maxlen=11) h3 ss(len=1) h5(minlen=4,maxlen=5) ss(len=7) h3 ss(minlen=4,maxlen=21) h5(minlen=4,maxlen=5) ss(len=7) h3 h3 ss(len=4)
28
29
30
31
32
33
34
35
36
37
38 O( )
39 O( )
40 O( ) O()
41 O( ) O()
42 O( ) O()
43
44
45
46
47 unrestricted context sensitive context free regular
48 unrestricted context sensitive context free regular
49 α β
50 α β
51 α β
52 α β
53 ϵ ϵ L() { }
54 ϵ ϵ L() { }
55 ϵ ϵ L() { }
56 ϵ ϵ L() { }
57 S0 S1 S2 u S3 S4 S5 S6 a a S7 S8 S9 u S10 g S11 S12 s13 S14 c a S15 S16 g S17 S18 a g
58 S0 S1 S2 u S3 S4 S5 S6 a a S7 S8 S9 u S10 g S11 S12 s13 S14 c a S15 S16 g S17 S18 a g
59 S0 S1 S2 u S3 S4 S5 S6 a a S7 S8 S9 u S10 g S11 S12 s13 S14 c a S15 S16 g S17 S18 a g
60 S0 S1 S2 u S3 S4 S5 S6 a a S7 S8 S9 u S10 g S11 S12 s13 S14 c a S15 S16 g S17 S18 a g
61 ϵ ϵ
62 ϵ ϵ
63 ϵ ϵ
64
65
66
67
68 γ
69 γ
70 γ αβ αγβ
71 γ αβ αγβ
72 γ αβ αγβ α β
73 n-{p}-[st]-{p}
74 n-{p}-[st]-{p}
75 n-{p}-[st]-{p}......
76 n-{p}-[st]-{p}......
77 n-{p}-[st]-{p}......
78 G A A G A G G A N-N N-N N-N N-N N-N N-N
79 G A A G A G G A N-N N-N N-N N-N N-N N-N
80 G A A G A G G A N-N N-N N-N N-N N-N N-N
81
82
83
84
85
86
87
88
89
90
91
92 G A A G G-C A-U U-A
93 G A A G G-C A-U U-A
94 G A A G G-C A-U U-A
95 G A A G G-C A-U U-A
96 G A A G G-C A-U U-A
97 G A A G G-C A-U U-A
98 G A A G G-C A-U U-A
99 G A A G G-C A-U U-A
100 S0 S1 S2 u S3 S4 S5 S6 a a S7 S8 S9 S10 u g S11 S12 c
101 S0 S1 S2 u S3 S4 S5 S6 a a S7 S8 S9 S10 u g S11 S12 s13 S14 c a S15 S16 g S17 S18 a g
102 α α
103 α α
104 α α
105 α α (, ) = { [, + ]}
106 α α (, ) = { [, + ]} =
107 α α (, ) = { [, + ]} =
108 α α (, ) = { [, + ]} = (, ) =
109 α α (, ) = { [, + ]} = (, ) = { [, ] }
110 α α (, ) = { [, + ]} = > (, ) = { [, ] }
111 α α (, ) = { [, + ]} = > (, ) = { [, ] }
112 α α (, ) = { [, + ]} = > (, ) = { [, ] } (, ) = {, [, + ], [ +, + ], < }
113 (, ) = { [, + ]} =,,, =,,, = =,, =,,
114 (, ) = { [, + ]} =,,, =,,, = =,, =,,
115 (, ) = { [, + ]} =,,, =,,, = =,, =,,
116 (, ) = { [, + ]} =,,, =,,, = =,, =,,
117 (, ) = { [, + ]} =,,, =,,, = =,, =,,
118 (, ) = { [, + ]} =,,, =,,, = =,, =,,
119 (, ) = { [, + ]} =,,, =,,, = =,, =,,
120 (, ) = { [, + ]} =,,, =,,, = =,, =,,
121 (, ) = { [, + ]} =,,, =,,, = =,, =,,
122 (, ) = { [, + ]} =,,, =,,, = =,, =,,
123 (, ) = { [, + ]} =,,, =,,, = =,, =,,
124 (, ) = { [, + ]} =,,, =,,, = =,, =,,
125 (, ) = { [, + ]} =,,, =,,, = =,, =,,
126 (, ) = { [, + ]} =,,, =,,, = =,, =,,
127 (, ) = { [, + ]} =,,, =,,, = =,, =,,
128 (, ) = { [, + ]} =,,, =,,, = =,, =,,
129 (, ) = { [, + ]} =,,, =,,, = =,, =,,
130 (, ) = { [, + ]} =,,, =,,, = =,, =,,
131 (, ) = { [, + ]} =,,, =,,, = =,, =,,
132 (, ) = { [, + ]} =,,, =,,, = =,, =,,
133 b a a b a A B S
134 b a a b a A B S
135 b a a b a A B S
136 b a a b a A B S
137 b a a b a A B S
138 b a a b a A B S B A C C
139 b a a b a A B S B A C C
140 b a a b a A B A A C B C B S
141 { Initialization } for i = 1 to n do V(i,1) = { is a production and s[i] = } { Iteration } for l = 2 to n do for i = 1 to n - l + 1 do V(i,l) = for k = 1 to l - 1 do V(i,l) = V(i,l) {, B V(i,k) and C V(i+k,l-k)} O( ) O( )
142 { Initialization } for i = 1 to n do V(i,1) = { is a production and s[i] = } { Iteration } for l = 2 to n do for i = 1 to n - l + 1 do V(i,l) = for k = 1 to l - 1 do V(i,l) = V(i,l) {, B V(i,k) and C V(i+k,l-k)} O( ) O( )
143
144
145
146
147
148 (.. )
149 (.. )
150 (.. )
151
152
153
154 (.) : (.) : (.) : (.) : (.) : (.) :
155
156
157
158 =,..,,, (, ) (),,
159 =,..,,, (, ) (),,
160 =,..,,, (, ) (),,
161 =,..,,, (, ) (),,
162 =,..,,, (, ) (),,
163 { Initialization } for = to, = to γ(,, ) = ( ) { Iteration } for = to, = to +, = to γ(,, ) = max, max =,..., {γ(,, )γ( +,, ) (, )} { Termination } log (, ˆπ θ) = γ(,, ).
164 { Initialization } for i = 1 to n do V(i,1) = { is a production and s[i] = } { Iteration } for l = 2 to n do for i = 1 to n - l + 1 do V(i,l) = for k = 1 to l - 1 do V(i,l) = V(i,l) {, B V(i,k) and C V(i+k,
165 b a a b a A B S B A C C
166 { Initialization } for = to, = to γ(,, ) = ( ) { Iteration } for = to, = to +, = to γ(,, ) = max, max =,..., {γ(,, )+γ(+,, )+log (, )} { Termination } log (, ˆπ θ) = γ(,, ).
167 ( ) ( )
168 { Initialization } for = to, = to α(,, ) = ( ) { Iteration } for = to, = to +, = to α(,, ) = {α(,, )α(+,, )(, )} = = =,..., { Termination } log ( θ) = α(,, ).
169 b a a b a A B S b a a b a A B S B A C C b a a b a A B S B A C C
170
171
172 S1 S2 S3 S4 ( ( ( (.. ) ) ) ) G G A G A U C U C C G G G G A - C C C C U G G G A A C C C A G G G G A U C C C U G G G G A A C C C C ϵ
173 S1 S2 S3 S4 ( ( ( (.. ) ) ) ) G G A G A U C U C C G G G G A - C C C C U G G G A A C C C A G G G G A U C C C U G G G G A A C C C C ϵ
174 # STOCKHOLM 1.0 #=GF AU Koala DA0260 GGGCGAAUAGUGUCAGC.GGGAGCACACCAGACUUGCAUCUGGUAG.GGAGGGUUCGAGUCCCUCUUUGUCCACC #=GR DA0260 SS (((((((..((((...)))).(((((...)))))...(((((...))))))))))))... DA0261 GGGCGAAUAGUGUCAGC.GGGAGCACACCAGACUUGCAUCUGGUAG.GGAGGGUUCGAGUCCCUCUUUGUCCACC #=GR DA0261 SS (((((((..((((...)))).(((((...)))))...(((((...))))))))))))... DA0340 GGGCUCGUAGCUCAGC..GGGAGAGCGCCGCCUUUGCAGGCGGAGGCCGCGGGUUCAAAUCCCGCCGAGUCCA.. #=GR DA0340 SS (((((((..((((...)))).(((((...)))))...(((((...))))))))))))... DA0380 GGGCCCAUAGCUCAGU..GGUAGAGUGCCUCCUUUGCAGGAGGAUGCCCUGGGUUCGAAUCCCAGUGGGUCCA.. #=GR DA0380 SS (((((((..((((...)))).(((((...)))))...(((((...))))))))))))... DA0420 GGGCCCAUAGCUCAGU..GGUAGAGUGCCUCCUUUGCAGGAGGAUGCCCUGGGUUGGAAUCCCAGUGGGUCCA.. #=GR DA0420 SS (((((((..((((...)))).(((((...)))))...(((((...))))))))))))... DA0580 GGGCCCGUAGCUCAGACUGGGAGAGCGCCGCCCUUGCAGGCGGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA.. #=GR DA0580 SS (((((((..((((...)))).(((((...)))))...(((((...))))))))))))... DA0620 GGGCCCGUAGCUCAGACUGGGAGAGCGCCGCCCUUGCAGGCGGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA.. #=GR DA0620 SS (((((((..((((...)))).(((((...)))))...(((((...))))))))))))...
175
176
177
178
179 # STOCKHOLM 1.0 #=GS Holley DE trna-ala that Holley sequenced from Yeast genome Holley GGGCGTGTGGCGTAGTCGGTAGCGCGCTCCCTTAGCATGGGAGAGGtCTCCGGTTCGATTCCGGACTCGTCCA #=GR Holley SS (((((.(..((((...)))).(((((...)))))...(((((...)))))).))))). //
180 O( )
181 O( )
182 O( )
183 O( )
184
185 S0 S1 S2 u S3 S4 S5 S6 a a... S8 u
186 S0 # STOCKHOLM 1.0 S1 S2 #=GC SS_cons <<<<..>>>> seq1 GGAGAUCUCC seq2 GGGGAUCCCC seq3 UGGGAACCCA seq4 GGGGAUCCCU seq5 GGGGAACCCC // u S3 S4 S5 S6 a... a S8 u
187
188
189
190
191
192
193
194
195
196
197
SnoPatrol: How many snorna genes are there? Supplementary
SnoPatrol: How many snorna genes are there? Supplementary materials. Paul P. Gardner 1, Alex G. Bateman 1 and Anthony M. Poole 2,3 1 Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton,
More informationTHEORY OF COMPUTATION (AUBER) EXAM CRIB SHEET
THEORY OF COMPUTATION (AUBER) EXAM CRIB SHEET Regular Languages and FA A language is a set of strings over a finite alphabet Σ. All languages are finite or countably infinite. The set of all languages
More informationContext Free Grammars: Introduction. Context Free Grammars: Simplifying CFGs
Context Free Grammars: Introduction CFGs are more powerful than RGs because of the following 2 properties: 1. Recursion Rule is recursive if it is of the form X w 1 Y w 2, where Y w 3 Xw 4 and w 1, w 2,
More informationRoot Locus (2A) Young Won Lim 10/15/14
Root Locus (2A Copyright (c 2014 Young W. Lim. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.2 or any later version
More informationSalient features of dynamic optimization problems Basics of dynamic programming The principle of optimality
A Z D I A 4 2 B C 5 6 7 2 E F 3 4 3 5 G H 8 6 2 4 J K 3 2 Z D I A 4 2 B C 5 6 7 2 E F 3 4 3 5 G H 8 6 2 4 J K 3 2 Z s x {, 2,..., n} r(x, s) x s r(, A) = 2 r(, D) = 2 r(2, A) = 4 r(2, D) = 8 g(x, s) s
More information98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006
98 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 6, 2006 8.3.1 Simple energy minimization Maximizing the number of base pairs as described above does not lead to good structure predictions.
More informationMikyoung LIM(KAIST) Optimization algorithm for the reconstruction of a conductivity in
Optimization algorithm for the reconstruction of a conductivity inclusion Mikyoung LIM (KAIST) Inclusion Ω in R d For a given entire harmonic function H, consider { (χ(r d \ Ω) + kχ(ω)) u = in R d, u(x)
More informationz 0 > 0 z = 0 h; (x, 0)
n = (q 1,..., q n ) T (,, t) V (,, t) L(,, t) = T V d dt ( ) L q i L q i = 0, i = 1,..., n. l l 0 l l 0 l > l 0 {x} + = max(0, x) x = k{l l 0 } +ˆ, k > 0 ˆ (x, z) x z (0, z 0 ) (0, z 0 ) z 0 > 0 x z =
More informationSubject-specific observed profiles of log(fev1) vs age First 50 subjects in Six Cities Study
Subject-specific observed profiles of log(fev1) vs age First 50 subjects in Six Cities Study 1.4 0.0-6 7 8 9 10 11 12 13 14 15 16 17 18 19 age Model 1: A simple broken stick model with knot at 14 fit with
More informationContext Free Grammars: Introduction
Context Free Grammars: Introduction Context free grammar (CFG) G = (V, Σ, R, S), where V is a set of grammar symbols Σ V is a set of terminal symbols R is a set of rules, where R (V Σ) V S is a distinguished
More informationCALCULATING THE CURVATURE TENSOR FOR THE 3D GODEL-LIKE SPACETIMES
CALCULATING TE CURVATURE TENSOR FOR TE 3 GOEL-LIKE SPACETIMES Abstract. We compute the Riemann curvature tensor for these 3 spacetimes. As the Weyl tensor vanishes the Ricci tensor is the only relevant
More informationRNA secondary structure prediction. Farhat Habib
RNA secondary structure prediction Farhat Habib RNA RNA is similar to DNA chemically. It is usually only a single strand. T(hyamine) is replaced by U(racil) Some forms of RNA can form secondary structures
More informationSupplemental Tables. Investigating the Theoretical Structure of the Differential Ability Scales Second Edition Through Hierarchical Exploratory
Supplemental Tables Investigating the Theoretical Structure of the Differential Ability Scales Second Edition Through Hierarchical Exploratory Factor Analysis By S. C. Dombrowksi et al., Journal of Psychoeducational
More information{ } is an asymptotic sequence.
AMS B Perturbation Methods Lecture 3 Copyright by Hongyun Wang, UCSC Recap Iterative method for finding asymptotic series requirement on the iteration formula to make it work Singular perturbation use
More information3.3 Discrete Hopfield Net An iterative autoassociative net similar to the nets described in the previous sections has been developed by Hopfield
3.3 Discrete Hopfield Net An iterative autoassociative net similar to the nets described in the previous sections has been developed by Hopfield (1982, 1984). - The net is a fully interconnected neural
More informationLIMITS MULTIPLE CHOICE QUESTIONS. (a) 1 (b) 0 (c) 1 (d) does not exist. (a) 0 (b) 1/4 (c) 1/2 (d) 1/8. (a) 1 (b) e (c) 0 (d) none of these
DSHA CLASSES Guidig you to Success LMTS MULTPLE CHOCE QUESTONS.... 5. Te value of + LEVEL (Objective Questios) (a) e (b) e (c) e 5 (d) e 5 (a) (b) (c) (d) does ot et (a) (b) / (c) / (d) /8 (a) (b) (c)
More informationNonlinear Control. Nonlinear Control Lecture # 18 Stability of Feedback Systems
Nonlinear Control Lecture # 18 Stability of Feedback Systems Absolute Stability + r = 0 u y G(s) ψ( ) Definition 7.1 The system is absolutely stable if the origin is globally uniformly asymptotically stable
More informationNesting and Mixed Effects: Part I. Lukas Meier, Seminar für Statistik
Nesting and Mixed Effects: Part I Lukas Meier, Seminar für Statistik Where do we stand? So far: Fixed effects Random effects Both in the factorial context Now: Nested factor structure Mixed models: a combination
More informationMixtures of Rasch Models
Mixtures of Rasch Models Hannah Frick, Friedrich Leisch, Achim Zeileis, Carolin Strobl http://www.uibk.ac.at/statistics/ Introduction Rasch model for measuring latent traits Model assumption: Item parameters
More informationRNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U. Bases can only pair with one other base. wobble pairing. 23 Hydrogen Bonds more stable
RNA STRUCTURE RNA Basics RNA bases A,C,G,U Canonical Base Pairs A-U G-C G-U wobble pairing Bases can only pair with one other base. 23 Hydrogen Bonds more stable RNA Basics transfer RNA (trna) messenger
More informationThe wonderful world of RNA informatics
December 9, 2012 Course Goals Familiarize you with the challenges involved in RNA informatics. Introduce commonly used tools, and provide an intuition for how they work. Give you the background and confidence
More informationHidden Markov Models. x 1 x 2 x 3 x K
Hidden Markov Models 1 1 1 1 2 2 2 2 K K K K x 1 x 2 x 3 x K Viterbi, Forward, Backward VITERBI FORWARD BACKWARD Initialization: V 0 (0) = 1 V k (0) = 0, for all k > 0 Initialization: f 0 (0) = 1 f k (0)
More informationUtility Maximizing Routing to Data Centers
0-0 Utility Maximizing Routing to Data Centers M. Sarwat, J. Shin and S. Kapoor (Presented by J. Shin) Sep 26, 2011 Sep 26, 2011 1 Outline 1. Problem Definition - Data Center Allocation 2. How to construct
More information( ) ( = ) = ( ) ( ) ( )
( ) Vρ C st s T t 0 wc Ti s T s Q s (8) K T ( s) Q ( s) + Ti ( s) (0) τs+ τs+ V ρ K and τ wc w T (s)g (s)q (s) + G (s)t(s) i G and G are transfer functions and independent of the inputs, Q and T i. Note
More informationCarleson measures and elliptic boundary value problems Abstract. Mathematics Subject Classification (2010). Keywords. 1.
2 3 4 5 6 7 8 9 0 A 2 3 4 5 6 7 8 9 20 2 22 23 24 25 26 27 28 29 30 3 32 33 34 BMO BMO R n R n+ + BMO Q R n l(q) T Q = {(x, t) R n+ + : x I, 0 < t < l(q)} Q T Q dµ R n+ + C Q R n µ(t (Q)) < C Q Q 35 36
More informationOn the Weak Convergence of the Extragradient Method for Solving Pseudo-Monotone Variational Inequalities
J Optim Theory Appl 208) 76:399 409 https://doi.org/0.007/s0957-07-24-0 On the Weak Convergence of the Extragradient Method for Solving Pseudo-Monotone Variational Inequalities Phan Tu Vuong Received:
More informationIntroduction to Polymer Physics
Introduction to Polymer Physics Enrico Carlon, KU Leuven, Belgium February-May, 2016 Enrico Carlon, KU Leuven, Belgium Introduction to Polymer Physics February-May, 2016 1 / 28 Polymers in Chemistry and
More informationTranscriptional Circuitry and the Regulatory Conformation of the Genome
Transcriptional Circuitry and the Regulatory Conformation of the Genome I-CORE for Gene Regulation in Complex Human Disease. Feb. 1 st, 2015 The Hebrew University Introduction to Next-generation sequencing
More informationTopic # Feedback Control. State-Space Systems Closed-loop control using estimators and regulators. Dynamics output feedback
Topic #17 16.31 Feedback Control State-Space Systems Closed-loop control using estimators and regulators. Dynamics output feedback Back to reality Copyright 21 by Jonathan How. All Rights reserved 1 Fall
More informationContraction Methods for Convex Optimization and Monotone Variational Inequalities No.16
XVI - 1 Contraction Methods for Convex Optimization and Monotone Variational Inequalities No.16 A slightly changed ADMM for convex optimization with three separable operators Bingsheng He Department of
More informationA Sequential Bayesian Approach with Applications to Circadian Rhythm Microarray Gene Expression Data
A Sequential Bayesian Approach with Applications to Circadian Rhythm Microarray Gene Expression Data Faming Liang, Chuanhai Liu, and Naisyin Wang Texas A&M University Multiple Hypothesis Testing Introduction
More informationCOMP 633: Parallel Computing Fall 2018 Written Assignment 1: Sample Solutions
COMP 633: Parallel Computing Fall 2018 Written Assignment 1: Sample Solutions September 12, 2018 I. The Work-Time W-T presentation of EREW sequence reduction Algorithm 2 in the PRAM handout has work complexity
More informationAll s Well That Ends Well: Supplementary Proofs
All s Well That Ens Well: Guarantee Resolution of Simultaneous Rigi Boy Impact 1:1 All s Well That Ens Well: Supplementary Proofs This ocument complements the paper All s Well That Ens Well: Guarantee
More informationVectors in the Plane
Vectors in the Plane MATH 311, Calculus III J. Robert Buchanan Department of Mathematics Fall 2011 Vectors vs. Scalars scalar quantity having only a magnitude (e.g. temperature, volume, length, area) and
More informationLecture 8 Learning Sequence Motif Models Using Expectation Maximization (EM) Colin Dewey February 14, 2008
Lecture 8 Learning Sequence Motif Models Using Expectation Maximization (EM) Colin Dewey February 14, 2008 1 Sequence Motifs what is a sequence motif? a sequence pattern of biological significance typically
More informationPart III - Bioinformatics Study of Aminoacyl trna Synthetases. VMD Multiseq Tutorial Web tools. Perth, Australia 2004 Computational Biology Workshop
Part III - Bioinformatics Study of Aminoacyl trna Synthetases VMD Multiseq Tutorial Web tools Perth, Australia 2004 Computational Biology Workshop Multiple Sequence Alignments The aminoacyl-trna synthetases,
More informationNOTICE TO CUSTOMER: The sale of this product is intended for use of the original purchaser only and for use only on a single computer system.
NOTICE TO CUSTOMER: The sale of this product is intended for use of the original purchaser only and for use only on a single computer system. Duplicating, selling, or otherwise distributing this product
More informationParaproducts in One and Several Variables M. Lacey and J. Metcalfe
Paraproducts in One and Several Variables M. Lacey and J. Metcalfe Kelly Bickel Washington University St. Louis, Missouri 63130 IAS Workshop on Multiparameter Harmonic Analysis June 19, 2012 What is a
More informationProfessor Fearing EE C128 / ME C134 Problem Set 7 Solution Fall 2010 Jansen Sheng and Wenjie Chen, UC Berkeley
Professor Fearing EE C8 / ME C34 Problem Set 7 Solution Fall Jansen Sheng and Wenjie Chen, UC Berkeley. 35 pts Lag compensation. For open loop plant Gs ss+5s+8 a Find compensator gain Ds k such that the
More informationProblem Set #3: 2.11, 2.15, 2.21, 2.26, 2.40, 2.42, 2.43, 2.46 (Due Thursday Feb. 27th)
Chapter Electrostatics Problem Set #3:.,.5,.,.6,.40,.4,.43,.46 (Due Thursday Feb. 7th). Coulomb s Law Coulomb showed experimentally that for two point charges the force is - proportional to each of the
More informationCurved spacetime tells matter how to move
Curved spacetime tells matter how to move Continuous matter, stress energy tensor Perfect fluid: T 1st law of Thermodynamics Relativistic Euler equation Compare with Newton =( c 2 + + p)u u /c 2 + pg j
More informationFoundations of Computation
The Australian National University Semester 2, 2018 Research School of Computer Science Tutorial 6 Dirk Pattinson Foundations of Computation The tutorial contains a number of exercises designed for the
More informationIIT JEE (2012) (Calculus)
L.K. Gupta (Mathematic Classes) www.pioneermathematics.com MOBILE: 985577, 4677 PAPER B IIT JEE (0) (Calculus) TOWARDS IIT JEE IS NOT A JOURNEY, IT S A BATTLE, ONLY THE TOUGHEST WILL SURVIVE TIME: 60 MINS
More information16.5 Surface Integrals of Vector Fields
16.5 Surface Integrals of Vector Fields Lukas Geyer Montana State University M73, Fall 011 Lukas Geyer (MSU) 16.5 Surface Integrals of Vector Fields M73, Fall 011 1 / 19 Parametrized Surfaces Definition
More information2. Diffraction as a means to determine crystal structure
Page 1 of 22 2. Diffraction as a means to determine crystal structure Recall de Broglie matter waves: 2 p h E = where p = 2m λ h 1 E = ( ) 2m λ hc E = hυ = ( photons) λ ( matter wave) He atoms: [E (ev)]
More informationBasics on the Graphcut Algorithm. Application for the Computation of the Mode of the Ising Model
Basics on the Graphcut Algorithm. Application for the Computation of the Mode of the Ising Model Bruno Galerne bruno.galerne@parisdescartes.fr MAP5, Université Paris Descartes Master MVA Cours Méthodes
More informationDomain Decomposition-based contour integration eigenvalue solvers
Domain Decomposition-based contour integration eigenvalue solvers Vassilis Kalantzis joint work with Yousef Saad Computer Science and Engineering Department University of Minnesota - Twin Cities, USA SIAM
More informationReview Exercises for Chapter 2
Review Eercises for Chapter 367 Review Eercises for Chapter. f 1 1 f f f lim lim 1 1 1 1 lim 1 1 1 1 lim 1 1 lim lim 1 1 1 1 1 1 1 1 1 4. 8. f f f f lim lim lim lim lim f 4, 1 4, if < if (a) Nonremovable
More informationNanoscale interfacial heat transfer: insights from molecular dynamics
Nanoscale interfacial heat transfer: insights from molecular dynamics S. Merabia, A. Alkurdi, T. Albaret ILM CNRS and Université Lyon 1, France K.Termentzidis, D. Lacroix LEMTA, Université Lorraine, France
More informationOH BOY! Story. N a r r a t iv e a n d o bj e c t s th ea t e r Fo r a l l a g e s, fr o m th e a ge of 9
OH BOY! O h Boy!, was or igin a lly cr eat ed in F r en ch an d was a m a jor s u cc ess on t h e Fr en ch st a ge f or young au di enc es. It h a s b een s een by ap pr ox i ma t ely 175,000 sp ect at
More informationOutline. Classical Control. Lecture 5
Outline Outline Outline 1 What is 2 Outline What is Why use? Sketching a 1 What is Why use? Sketching a 2 Gain Controller Lead Compensation Lag Compensation What is Properties of a General System Why use?
More informationMath 53 Homework 7 Solutions
Math 5 Homework 7 Solutions Section 5.. To find the mass of the lamina, we integrate ρ(x, y over the box: m a b a a + x + y dy y + x y + y yb y b + bx + b bx + bx + b x ab + a b + ab a b + ab + ab. We
More informationExercises. . Evaluate f (, ) xydawhere. 2, 1 x< 3, 0 y< (Answer: 14) 3, 3 x 4, 0 y 2. (Answer: 12) ) f x. ln 2 1 ( ) = (Answer: 1)
Eercises Eercises. Let = {(, : 4, }. Evaluate f (,,
More information1. Tensor of Rank 2 If Φ ij (x, y) satisfies: (a) having four components (9 for 3-D). (b) when the coordinate system is changed from x i to x i,
1. Tensor of Rank 2 If Φ ij (x, y satisfies: (a having four components (9 for 3-D. Φ i j (x 1, x 2 = β i iβ j jφ ij (x 1, x 2. Example 1: ( 1 0 0 1 Φ i j = ( 1 0 0 1 To prove whether this is a tensor or
More informationChomsky Normal Form for Context-Free Gramars
Chomsky Normal Form for Context-Free Gramars Deepak D Souza Department of Computer Science and Automation Indian Institute of Science, Bangalore. 17 September 2014 Outline 1 CNF 2 Converting to CNF 3 Correctness
More information28% 13% 76% 60% 20% 0.15 12 11 10 9 8 7 6 BA SIAB 1995 2000 2005 2010 2015 12 SIAB 11 SIAB adj. BA 10 9 8 7 6 1995 2000 2005 2010 2015 130 120 110 100 90 80 70 130 120 110 100 90 80 70 1995 2000
More informationAlexander Invariant of Tangles
The.nb (source) file is at http://www.math.toronto.edu/vohuan/, based on the original program at http://- drorbn.net/academicpensieve/2015-07/polypoly/. 1. Γ-Calculus Alexander Invariant of Tangles The
More informationOff-Lattice KMC Simulation of Quantum Dot Formation
Off-Lattice KMC Simulation of Quantum Dot Formation T. P. Schulze University of Tennessee Peter Smereka & Henry Boateng University of Michigan Research supported by NSF-DMS-0854920 Heteroepitaxy and Quantum
More informationT h e C S E T I P r o j e c t
T h e P r o j e c t T H E P R O J E C T T A B L E O F C O N T E N T S A r t i c l e P a g e C o m p r e h e n s i v e A s s es s m e n t o f t h e U F O / E T I P h e n o m e n o n M a y 1 9 9 1 1 E T
More informationContext-Free Grammars. 2IT70 Finite Automata and Process Theory
Context-Free Grammars 2IT70 Finite Automata and Process Theory Technische Universiteit Eindhoven Quartile2, 2014-2015 Generating strings language L 1 èa n b n Ë n 0 í ab L 1 if w L 1 then awb L 1 2 IT70
More informationr ADD. TEMP. WORKSPACE
SSIG 6 F--4 9 6 49 6 998 469 G -F-- 69 F--4 -F--S 98 F--4 S F-- 8 IG - F - Y F 9 9 G I 9-9 8 9 4 F 9 I 9 6 9 G FI F G F 9 9 8 9 9 9 8 G FI F G F - S 9 9 Q I F 4 9 9 8 4 9 8 6 8 SS I SIG F : IF 4 F 8 89
More informationLecture 9 Translation.
1 Translation Summary of important events in translation. 2 Translation Reactions involved in peptide bond formation. Lecture 9 3 Genetic code Three types of RNA molecules perform different but complementary
More informationevery hour 8760 A every minute 525,000 A continuously n A
In the previous lesson we introduced Eponential Functions and their graphs, and covered an application of Eponential Functions (Compound Interest). We saw that when interest is compounded n times per year
More informationAdvanced Control Theory
State Space Solution and Realization chibum@seoultech.ac.kr Outline State space solution 2 Solution of state-space equations x t = Ax t + Bu t First, recall results for scalar equation: x t = a x t + b
More informationCountry
Total EU-12 89,6 89,4 85,7 82,9 85,9 86,9 87,4 EU-15 89,6 85,7 83,1 86,2 87,0 87,5 EU-25 87,9 A 95,1 90,2 88,0 90,8 88,2 93,7 B 80,7 91,1 84,6 84,3 86,3 89,6 85,8 D 95,1 94,1 86,1 86,3 88,0 86,4 89,4 D-W
More informationCompare the growth rate of functions
Compare the growth rate of functions We have two algorithms A 1 and A 2 for solving the same problem, with runtime functions T 1 (n) and T 2 (n), respectively. Which algorithm is more efficient? We compare
More informationPredicting RNA Secondary Structure
7.91 / 7.36 / BE.490 Lecture #6 Mar. 11, 2004 Predicting RNA Secondary Structure Chris Burge Review of Markov Models & DNA Evolution CpG Island HMM The Viterbi Algorithm Real World HMMs Markov Models for
More informationGene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji
Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC
More informationMethod of marks for propositional linear temporal logic
Lietuvos matematikos rinkinys ISSN 0132-2818 Proc. of the Lithuanian Mathematical Society, Ser. A www.mii.lt/lmr/ Vol. 55, 2014, 46 50 Method of marks for propositional linear temporal logic Regimantas
More informationCorrecting Localized Deletions Using Guess & Check Codes
55th Annual Allerton Conference on Communication, Control, and Computing Correcting Localized Deletions Using Guess & Check Codes Salim El Rouayheb Rutgers University Joint work with Serge Kas Hanna and
More informationOptimal multilevel preconditioning of strongly anisotropic problems.part II: non-conforming FEM. p. 1/36
Optimal multilevel preconditioning of strongly anisotropic problems. Part II: non-conforming FEM. Svetozar Margenov margenov@parallel.bas.bg Institute for Parallel Processing, Bulgarian Academy of Sciences,
More informationDr. Allen Back. Nov. 5, 2014
Dr. Allen Back Nov. 5, 2014 12 lectures, 4 recitations left including today. a Most of what remains is vector integration and the integral theorems. b We ll start 7.1, 7.2,4.2 on Friday. c If you are not
More informationATHS FC Math Department Al Ain Revision worksheet
ATHS FC Math Department Al Ain Revision worksheet Section Name ID Date Lesson Marks 3.3, 13.1 to 13.6, 5.1, 5.2, 5.3 Lesson 3.3 (Solving Systems of Inequalities by Graphing) Question: 1 Solve each system
More informationSynchronous Machine Modeling
ECE 53 Session ; Page / Fall 07 Synchronous Machine Moeling Reference θ Quarature Axis B C Direct Axis Q G F D A F G Q A D C B Transient Moel for a Synchronous Machine Generator Convention ECE 53 Session
More information1.5 MM and EM Algorithms
72 CHAPTER 1. SEQUENCE MODELS 1.5 MM and EM Algorithms The MM algorithm [1] is an iterative algorithm that can be used to minimize or maximize a function. We focus on using it to maximize the log likelihood
More informationDouble Integrals. Advanced Calculus. Lecture 2 Dr. Lahcen Laayouni. Department of Mathematics and Statistics McGill University.
Lecture Department of Mathematics and Statistics McGill University January 9, 7 Polar coordinates Change of variables formula Polar coordinates In polar coordinates, we have x = r cosθ, r = x + y y = r
More informationVariable selection with error control: Another look at Stability Selection
Variable selection with error control: Another look at Stability Selection Richard J. Samworth and Rajen D. Shah University of Cambridge RSS Journal Webinar 25 October 2017 Samworth & Shah (Cambridge)
More informationFLAC Context-Free Grammars
FLAC Context-Free Grammars Klaus Sutner Carnegie Mellon Universality Fall 2017 1 Generating Languages Properties of CFLs Generation vs. Recognition 3 Turing machines can be used to check membership in
More informationP SS P SS P SS P SS P SS
P SS 1963 2017 P SS P SS P SS P SS t P SS t t P SS P SS P SS P SS P SS P SS P SS P SS i t r i,t E t 1 [r i,t r f,t ] = γ M,t Cov t 1 (r i,t, r M,t ) + γ M 2,tCov t 1 ( ri,t, r 2 M,t ) r f,t t r M,t t
More informationOptimal input design for nonlinear dynamical systems: a graph-theory approach
Optimal input design for nonlinear dynamical systems: a graph-theory approach Patricio E. Valenzuela Department of Automatic Control and ACCESS Linnaeus Centre KTH Royal Institute of Technology, Stockholm,
More informationA Benders Algorithm for Two-Stage Stochastic Optimization Problems With Mixed Integer Recourse
A Benders Algorithm for Two-Stage Stochastic Optimization Problems With Mixed Integer Recourse Ted Ralphs 1 Joint work with Menal Güzelsoy 2 and Anahita Hassanzadeh 1 1 COR@L Lab, Department of Industrial
More informationMinimized Logic Gates Number Of Components In The Chien Search Block For Reed-Solomon (RS)
Research Paper American Journal of Engineering Research (AJER) e-issn: 2320-0847 p-issn : 2320-0936 Volume-7, Issue-2, pp-110-116 www.ajer.org Open Access Minimized Logic Gates Number Of Components In
More informationFunctions of Several Variables: Chain Rules
Functions of Several Variables: Chain Rules Calculus III Josh Engwer TTU 29 September 2014 Josh Engwer (TTU) Functions of Several Variables: Chain Rules 29 September 2014 1 / 30 PART I PART I: MULTIVARIABLE
More informationIntroduction to Root Locus. What is root locus?
Introduction to Root Locus What is root locus? A graphical representation of the closed loop poles as a system parameter (Gain K) is varied Method of analysis and design for stability and transient response
More informationMath 221 Examination 2 Several Variable Calculus
Math Examination Spring Instructions These problems should be viewed as essa questions. Before making a calculation, ou should explain in words what our strateg is. Please write our solutions on our own
More informationDiscrete Systems. Step response and pole locations. Mark Cannon. Hilary Term Lecture
Discrete Systems Mark Cannon Hilary Term 22 - Lecture 4 Step response and pole locations 4 - Review Definition of -transform: U() = Z{u k } = u k k k= Discrete transfer function: Y () U() = G() = Z{g k},
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationDaniel Price Monash University Melbourne, Australia. Guillaume Laibe University of St Andrews, Scotland
Dust+gas in SPH en.wikipedia.org Daniel Price Monash University Melourne, Australia Guillaume Laie University of St Andrews, Scotland Image: Gemini Oservatory/ AURA Artwork y Lynette Cook HST/ 10th SPHERIC
More informationMoreover, the circular logic
Moreover, the circular logic How do we know what is the right distance without a good alignment? And how do we construct a good alignment without knowing what substitutions were made previously? ATGCGT--GCAAGT
More informationy y i LB k+1 f(x, y k+1 ) Ax + By k+1 b,
a b b a b min x,y f(x, y) g j (x, y) 0 j = 1,... l, Ax + By b, x R n, y Z m. f, g 1,..., g l : R n R m R y x { (x i, y i ) } k i=0 k y k+1 min x,y,µ µ [ ] f(x i, y i ) + f(x i, y i ) T x x i y y i g j
More informationMath Double Integrals in Polar Coordinates
Math 213 - Double Integrals in Polar Coordinates Peter A. Perry University of Kentucky October 22, 2018 Homework Re-read section 15.3 Begin work on 1-4, 5-31 (odd), 35, 37 from 15.3 Read section 15.4 for
More informationPhylogenetic Tree Reconstruction
I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven
More informationJim Lambers MAT 280 Fall Semester Practice Final Exam Solution
Jim Lambers MAT 8 Fall emester 6-7 Practice Final Exam olution. Use Lagrange multipliers to find the point on the circle x + 4 closest to the point (, 5). olution We have f(x, ) (x ) + ( 5), the square
More informationC3 Revision Questions. (using questions from January 2006, January 2007, January 2008 and January 2009)
C3 Revision Questions (using questions from January 2006, January 2007, January 2008 and January 2009) 1 2 1. f(x) = 1 3 x 2 + 3, x 2. 2 ( x 2) (a) 2 x x 1 Show that f(x) =, x 2. 2 ( x 2) (4) (b) Show
More informationRadial Basis Functions generated Finite Differences (RBF-FD) for Solving High-Dimensional PDEs in Finance
1 / 27 Radial Basis Functions generated Finite Differences (RBF-FD) for Solving High-Dimensional PDEs in Finance S. Milovanović, L. von Sydow Uppsala University Department of Information Technology Division
More informationParts Manual. EPIC II Critical Care Bed REF 2031
EPIC II Critical Care Bed REF 2031 Parts Manual For parts or technical assistance call: USA: 1-800-327-0770 2013/05 B.0 2031-109-006 REV B www.stryker.com Table of Contents English Product Labels... 4
More informationNoncollinear spins in QMC: spiral Spin Density Waves in the HEG
Noncollinear spins in QMC: spiral Spin Density Waves in the HEG Zoltán Radnai and Richard J. Needs Workshop at The Towler Institute July 2006 Overview What are noncollinear spin systems and why are they
More informationLecture 5: Loop Invariants and Insertion-sort
Lecture 5: Loop Invariants and Insertion-sort COMS10007 - Algorithms Dr. Christian Konrad 11.01.2019 Dr. Christian Konrad Lecture 5: Loop Invariants and Insertion-sort 1 / 12 Proofs by Induction Structure
More informationLecture 5. Theorems of Alternatives and Self-Dual Embedding
IE 8534 1 Lecture 5. Theorems of Alternatives and Self-Dual Embedding IE 8534 2 A system of linear equations may not have a solution. It is well known that either Ax = c has a solution, or A T y = 0, c
More informationKostas Triantafyllopoulos University of Sheffield. Motivation / algorithmic pairs trading. Model set-up Detection of local mean-reversion
Detecting Mean Reverted Patterns in Statistical Arbitrage Outline Kostas Triantafyllopoulos University of Sheffield Motivation / algorithmic pairs trading Model set-up Detection of local mean-reversion
More information