Supporting Information

Transcription

1 Supporting Information SnS2 Quantum Dots as New Emitters with Strong Electrochemiluminescence for Ultrasensitive Antibody Detection Yan-Mei Lei, Jia Zhou, Ya-Qin Chai, Ying Zhuo, Ruo Yuan Key Laboratory of Luminescent and Real-Time Analytical Chemistry (Southwest University), Ministry of Education, College of Chemistry and Chemical Engineering, Southwest University, Chongqing Corresponding authors at: Tel.: , fax: addresses: (R. Yuan);. S-1

2 Table of Contents for Supporting Information 1.1 Reagents and Material Apparatus The Scanning Electron Microscopy Characterization of 3D Hierarchical Ag NFs The EDX Analysis Spectrum of the Prepared SnS2 QDs The Characterization of the Prepared ECL Biosensor Comparison of the Other Test Platforms for Antibody Detection S-2

3 1.1 Reagents and Material Tin (IV) chloride pentahydrate (SnCl4 5H2O), dimethylformamide (DMF), and potassium persulfate (K2S2O8) were purchased from Chengdu Chemical Reagent Company (Chengdu, China). L-cysteine (99%), silver nitrate (AgNO3), sodium citrate dihydrate (C6H5O7Na3 2H2O), hexanethiol (HT, 96%), N-hydroxy succinimide (NHS), N-(3-dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDC), tris(2-carboxyethyl) phosphine hydrochloride (TCEP), polyvinylpyrrolidone (PVP), ethylenediaminetetraacetic acid (EDTA) and tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl) were received from Sigma Chemical Co. (St. Louis, MO, USA). 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester sodium salt (sulfo-smcc) was provided by the J&K Chemical Co. Ltd. (Beijing, China). The nicking endonuclease (Nt.BbvCI) and polymerase Klenow Fragment exowere purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Mouse monoclonal anti-cytomegalovirus (anti-cmv) pp65 antibody was purchased from Yanmeng of Bio.Tech. Co., Ltd, (Shanghai, China). CMV pp65 peptides ( , NLVPMVATV) was obtained from the Meilun of Bio.Tech. Co., Ltd, (Dalian, China). All HPLC-purified DNA oligonucleotides (list Table S1) and the solution of deoxyribonucleoside tripho sphate (dntps) mixture were purchased from Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (China). The underlined base sequence could hybridize with the same color underlined base S-3

4 sequence. Table S2 Sequence information for the nucleic acids used in this study. Name AP DNA-Fc DNA-SH Fuel 1 Sequences(5-3 ) NH 2-(CH 2) 6-CACCACCTCCACGTTCTCTCTTCTATGC Fc-TTACGTGGAGGTGGTT-Fc GAGAAGAGGGAGGATT-SH CCACCTCCACGTTCTCTCTTCTATGC*TGAGGTCCTCCCTCTTCTCTTTT ACACGC Fuel 2 CCACCTCCACGTTCTCTCTTCTATGC*TGAGGTCCTCCCTCTTCTCTTT GCGTGTA 1 TE buffer (10 mm Tris-HCl, 1.0 mm EDTA, ph 8.0) was used for dissolving and storing all oligonucleotides. Phosphate buffered saline (0.1 M, PBS) containing 5 mm K2S2O8 (ph 7.4) was used for ECL measurements. All other chemicals not mentioned here were of analytical reagent (A.R.) grade and used as received. Ultrapure water was purified by a Millipore Milli-Q water purification system with an electric resistance of 18.2 MΩ/cm and further used throughout the whole experiment. S-4

5 1.2 Apparatus The measurements of cyclic voltammetry (CV) and ECL were recorded on MPI-E multifunctional electrochemical and chemiluminescent analytical system (Xi'an Remax Electronic Science &Technology Co. Ltd., Xi'an, China). A homemade three-electrode system consisted of a Ag/AgCl (saturated KCl) as reference electrode, a platinum wire as auxiliary electrode, and a glassy carbon electrode (GCE) as the working electrode, respectively. The photophysical characterizations were recorded with a UV-2550 UV/Vis spectrophotometer (Shimadzu, Tokyo, Japan). The morphologies and sizes of the prepared SnS2 QDs were characterized on a high resolution transmission electron microscopy (HRTEM, H600, Hitachi, Japan) at an acceleration voltage of 200 kv. The morphologies of the prepared 3D hierarchical Ag NFs were characterized by using a scanning electron microscope (SEM, S-4800, Hitachi, Tokyo, Japan) at an acceleration voltage of kv. Elemental compositions of the prepared SnS2 QDs were determined by an energy-dispersive X-ray spectroscopy (EDS) connected to field-emission scanning electron microscopy (FESEM, Hitachi, S-4800). The thickness of the prepared SnS2 QDs was analyzed by Multimode 8 atomic force microscopy (AFM, Bruker, Germany). The ECL emission spectrum were obtained on a CHI 760E combined with a Newton EMCCD spectroscopy detector (Andor Co., Tokyo, Japan). S-5

6 1.3 The Scanning Electron Microscopy Characterization of 3D Hierarchical Ag NFs. Figure S1. The scanning electron microscopy characterization of 3D hierarchical Ag NFs. S-6

7 1.4 The EDX Analysis Spectrum of the Prepared SnS2 QDs. Figure S2. EDX analysis of the prepared SnS 2 QDs. S-7

8 1.5 The Characterization of the Prepared ECL Biosensor. Figure S3. (A) ECL profiles and (B) EIS plots of the electrode at different stages: (a) bare GCE, (b) GCE/Ag NFs, (c) GCE/Ag NFs/SnS 2 QDs, (d) GCE/Ag NFs/SnS 2 QDs/CS, (e) GCE/Ag NFs/SnS 2 QDs/CS/APs, (f) GCE/Ag NFs/SnS 2 QDs/CS/APs/HT, (g) GCE/Ag NFs/SnS 2 QDs/CS/APs/HT/DNA-Fc, (h) GCE/Ag NFs/SnS 2 QDs/CS/AP/HT/MT. ECL measured in 5.0 mm K 2S 2O 8 solution (ph = 7.4) and EIS tracked 0.1 M PBS solution (ph = 7.4) containing 5.0 mm [Fe(CN) 6] 3 /4 as redox probe. The stepwise assembly of the prepared ECL biosensor was confirmed with ECL measurements in 5.0 mm S2O8 2 solution, as shown in Figure S3A. First, the bare GCE displayed a low ECL intensity (curve a) corresponding to the emission of 1 (O2)2 *. [1] When the 3D hierarchical silver nanoflowers (Ag NFs) were electrodeposited on the electrode surface, the ECL intensity increased slightly (curve b). The reason for this may be that the Ag NFs could accelerate the reduction of S2O8 2- to output more SO4 and achieve a slightly strong emission of 1 (O2)2 *. After the self-assemble of layered SnS2 QDs on the Ag NFs/GCE surface, a remarkable ECL signal was observed (curve c). This could be attributed to the fact that the Ag NFs as coreaction accelerator could improve ERR of SnS2 QDs and S2O8 2- and thus enhanced the ECL intensity of the binary (SnS2 QDs/S2O8 2- ) system. When the electrode was incubated with CS solution (curve d), a slightly decreased ECL signal S-8

9 was observed owing to the hindering effect of the CS between the SnS2 QDs and S2O8 2-. After the successive immobilization of AP and HT, the ECL intensity decreased sequentially (curve e and f ), because the formation of molecules layers hindered the electron transfer. After hybridizing with the quencher probes of DNA-Fc, the ECL intensity was decreased sharply (curve g) corresponding to the quenching reaction between Fc and SnS2 QDs*. However, when the electrode was incubated with mimic target (MT) solution (curve h), an enhanced ECL signal was observed again. The reason was that the MT hybridized with AP to release the DNA-Fc from the electrode surface. The electrochemical impedance spectroscopy (EIS) profiles of different modified electrodes were monitored in PBS solution containing 5 mm Fe(CN)6 3 /4, as shown in Figure S3B. The semicircle diameter of EIS is equal to Ret in the Nyquist plots. A small semicircle was observed on the bare GCE (curve a). After the successive modification of Ag NFs, SnS2 QDs and CS, the Ret value increased sequentially (curve b, c and d ). After the successive modification of AP (curve e), HT (curve f ), DNA-Fc (curve g) and MT (curve h), the resistance increased sequentially (curve e, f and g). The reason was that the insulation and steric hindrance of these molecules retarded the electron transfer on the electrode surface. The experiment results clearly demonstrated that ECL measurements were in accordance with the EIS profiles. S-9

10 1.6 Comparison of the Other Test Platforms for Antibody Detection. Table S2. Comparison of the Other Test Platforms for Antibody Detection. Methods Target Antibody Detection Limit Dynamic Range Ref fluorescence anti-dig M M ~ M 2 colorimetric anti-dig pm M ~ M 3 electrochemical anti-dig M M ~ M 4 ECL anti-pseudorabies virus 0.40 pg ml 1 1 pg ml 1 ~ 50 ng ml 1 5 ECL anti-pedv 0.05 pg ml pg ml 1 ~ 5 ng ml 1 6 ECL anti-cmv pp M (21.45 fg ml 1 ) M ~ M (65 fg ml 1 ~ 65 ng ml 1 ) This work S-10

11 REFERENCES (1) Yu, Y. Q.; Zhang, H. Y.; Chai, Y. Q.; Yuan, R.; Zhuo, Y. Biosens. Bioelectron., 2016, 85, (2) Peng, Y.; Li, X.; Yuan, R.; Xiang, Y. Chem. Commun. 2016, 52, (3) Hu, X.; Li, C.; Feng, C.; Mao, X.; Xiang, Y.; Li, G. Chem. Commun., 2017, 53, (4) Dou, B. T.; Yang, J. M.; Shi, K.; Yuan, R.; Xiang, Y. Biosens. Bioelectron. 2016, 83, (5) Shao, K.; Wang, J.; Jiang, X.; Shao, F.; Li, T.; Ye, S.; Chen, L.; Han, H. Anal. Chem. 2014, 86, (6) Ma, J.; Wu, L.; Li, Z.; Lu, Z.; Yin, W.; Nie, A.; Ding, F.; Wang, B.; Han, H. Anal. Chem. 2018, 90, S-11