Supporting Information

Transcription

1 Supporting Information Label-Free Photoelectrochemical Off-On Platform Coupled with G-wire-Enhanced Strategy for Highly Sensitive MicroRNA Sensing in Cancer Cells Cui Ye, Min Qiang Wang, Hong Qun Luo *, and Nian Bing Li * Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing , People s Republic of China Institute for Clean Energy & Advanced Materials, Faculty of Materials and Energy, Southwest University, Chongqing , People s Republic of China * Corresponding author. Tel: ; Fax: ; E mail address: linb@swu.edu.cn (N. B. Li), luohq@swu.edu.cn (H.Q. Luo) S-1

2 Contents Chemicals and Reagents S-3 Apparatus S-3 Preparation of the Au-CuPi NSs......S-4 Preparation of the GNPs..S-4 Application....S-4 Optimal Conditions..... S-5 Figure of LSV Scanning S-6 Figure of Overlaps of Band Alignment....S-7 Figure of GNPs Characterization...S-8 Figure of AFM Characterization...S-9 Figure of Optimal Conditions.....S-10 Figure of Relative Calibration Curve Comparison...S-11 Figure of Matrix Effect...S-12 Figure of Copies of MiR-141 per Cell...S-13 Table of Sequence Information...S-14 Table of Analytical Comparison S-15 References....S-16 S-2

3 EXPERIMENTAL SECTION Chemicals and Reagents. 2-Amino-2-(hydroxymethyl)-1,3-propanediol (Tris), 5,10,15,20-tetra (4- sulfonatophenyl)-21h,23h-porphyrin (TSPP), lactic acid lithium salt, 6-mercaptohexanol (MCH), and H 2 AuCl 4 4H 2 O were purchased from Sigma-Aldrich (St. Louis, MO, U.S.A.). The nicking enzyme Nb.BbvCI and 10 NEB buffer were bought from the New England Biolabs, Inc. (Ipswich, MA, USA). Sodium dodecyl benzene sulfonate (SDBS), isooctane, copper nitrate (Cu(NO 3 ) 2 6H 2 O), and n-butyl alcohol were obtained from Aladdin Industrial Co., Ltd (Shanghai, China). All chemicals used as received are of analytical reagent grade, and ultrapure water with an 18.2 MΩ cm resistivity was utilized throughout the work. The Fe(CN) 6 3 /4 solution (5 mm) was prepared by dissolving the mixture of potassium ferrocyanide and potassium ferricyanide in phosphate buffer (0.1 M Na 2 HPO 4, 0.1 M KH 2 PO 4, 0.1 M KCl, ph 7.4). Table S1 depicts the detailed oligonucleotides sequences, which were synthesized and purified by Sangon Inc. (Shanghai, China). The mirna sequences were dissolved in TM buffer (20 mm Tris-HCl, 50 mm MgCl 2, ph 8.0), and the other sequences were dissolved in phosphate buffer (50 mm, 0.2 M KCl, ph 7.0). Apparatus. The morphologies were characterized by a JEOL-7800F field-emission scanning electron microscopy (FESEM), coupled with the INCA X-Max 250 energy-dispersive X-ray spectroscopy (EDS). The morphologies and structure were further characterized via a JEM-2100 field-emission scanning electron microscopy (FESEM) using a field emission gun (FEG) at 200 kv (Japan Electron Optics Laboratory Co., Japan). The structure of G-wire was analyzed by an atomic force microscope (AFM, Bruker-Icon SPM, Germany). The photophysical characterizations were studied on a UV-2550 spectrophotometer (Hitachi High-Tech Science Co., Japan) UV-light irradiation was carried out on a CHF-XM35-500W Xenon lamp parallel light source system, equipped with a 365 nm UV transmissions filter (Beijing Trusttech Co. Ltd, China). CHI 660D electrochemical workstation (Shanghai Chenhua Instruments Co., China) was utilized for electrochemical and PEC S-3

4 measurements, in which PEAC 200A (Tianjin AiDa Hengsheng Technology Co., Ltd., China) was configured throughout the PEC measurements process for visible-light irradiation. In the whole measurement procedure, a three-electrode system was employed, containing a glassy carbon electrode (GCE, Φ = 3 mm) modified or not as the working electrode, saturated calomel electrode (SCE) or Ag/AgCl as the reference electrode for electrochemical or PEC measurements, a platinum wire as the auxiliary electrode. Preparation of Au-CuPi NSs. For the W/O micro-emulsion system, SDBS (1.5 g), n-butyl alcohol (6.0 ml), and isooctane (18.0 ml) were mixed, and then Cu(NO 3 ) 2 aqueous solution (0.45 mol L 1, 3.0 ml) was added to the above mixture, followed by 15 min ultrasonic treatment. Next, K 3 PO 4 aqueous solution (0.3 mol L 1, 6.0 ml) was injected into the micro-emulsion cell by a microsyringe with continuous ultrasonic treatment for 30 min. The resultant CuPi NSs were obtained by being washed with ethanol and ultrapure water, centrifuged (10000 rpm, 10 min) for several times, and vacuum freeze drying overnight. Afterwards, the H 2 AuCl 4 aqueous solution (1 wt %, 100 µl) was added to the prepared CuPi NSs aqueous solution (4.0 mg ml -1, 1.0 ml), followed by the continuous UV-light irradiation and magnetic stirring for various time. Notably, the resultant composite was gathered with continuous UV-light irradiation for 30 min. Preparation of the GNPs. GNPs were prepared by diluting HAuCl 4 (1 wt %, 1.0 ml) in 90 ml of ultrapure water with magnetic stirring for 1 min. Then, CTAB (0.1 M, 2.0 ml), and NaBH 4 (0.2 mm, 1.0 ml) was successively added to the reaction mixture, followed by magnetic stirring for 1 and 5 min. Analysis Application in Human Cancer Cells. We chose the low and high mirna-141 expressions cells, such as human cervical cancer cells (HeLa) and human prostate carcinoma cells (22Rv1) for the practical sample analysis. After the cell counting treatment, a column type commercial mirna extraction kit was utilized to extract their lysates. All of the extracted mirna lysates were respectively diluted using 30 µl of DEPC-treated water for mirna assay based on the prepared PEC S-4

5 platform. Optimal Conditions for Constructing PEC Sensing Platform. To acquire the superior analytical performance of the PEC sensing platform for mirna measurement, we investigated several possible factors, and we utilized 1 nm mirna as an example in this case. As a well-designed protocol, we devised an off-on configuration to realize ultrasensitive mirna assay platform. GNPs and TSPP were introduced and served as the quencher and enhancer for PEC response. Figure S2a depicts the influence of GNPs incubation time. The result manifests that the photocurrent signals decline rapidly with the increase of GNPs incubation time before 60 min, then the photocurrent signals sustain. The optimal quenching effect is gained after 60 min for GNPs incubation time. Furthermore, the concentration and incubation time of enhancer TSPP were investigated. As displayed in Figure S2b,c, both of the photocurrent signals augment quickly, and then level off until the TSPP concentration and incubation time are 0.1 mg ml -1, and 60 min, respectively. Hence, 0.1 mg ml -1 and 60 min are employed in the following test. S-5

6 Figure S1. LSV scanning from 0.1 to -0.7 V for Au-CuPi NSs photocathode under dark (red line) and visible-light irradiation (blue line). S-6

7 Figure S2. (a) UV vis absorption spectrum of GNPs, and (b) fluorescence emission spectrum of CuPi NSs. S-7

8 Figure S3 (a) TEM, and (b) HRTEM images of Au-CuPi NSs. (c) Corresponding size distributions. (d) UV vis absorption spectrum of GNPs. S-8

9 Figure S4. AFM images of the mixture (H1, 2 µm; H2, 2 µm; C, 2 µm; mirna-141, 1 nm; Nb.BbvCI, 10 U) (a) with and (b) without Mg 2+. S-9

10 Figure S5. Influences of a) GNPs incubation time, b) TSPP concentration, and c) TSPP incubation time. S-10

11 Figure S6. Relative calibration curve for mirna detection based on the sensing platform i) with and ii) without the quencher-motivating switch-off procedure. S-11

12 Figure S7. Photocurrent responses of the PEC sensing platform towards 0.1 fm, 10 fm, and 10 pm mirna in (a) buffer solution and (b) lysates from 10 2 cells of HeLa. S-12

13 Figure S8. The number of copies of mirna-141 per cell determined through our method in HeLa cell and 22Rv1 cell compared with the previous reports. S-13

14 Table S1. Sequence Information Used in This Work. Name MiRNA-141 mir-200a mir-200b mir-200c mir-429 H1 H2 C P1 P2 Sequence (5 3 ) UAACACUGUCUGGUAAAGAUGG UAACACUGUCUGGUAACGAUGU. UAAUACUGCCUGGUAAUGAUGA. UAAUACUGCCGGGUAAUGAUGGA UAAUACUGUCUGGUAAAACCGU CCATCTTTACCCCTCAGCAGGGTGGGGAGGGTGGGGTA GTCTGC AGGGTGGGGAGGGTGGGGCCTCAGCAGACAGTGTTA GCTGAGGGCTGAGG AAAAAAAAAAAGGGTGGGGAGGGTGGGGGCTGAGGATTCCTCAGC AAAAAAAAAAAGGGTGGGGAGGGTGGGGGCTGAGGAATCCTCAGC S-14

15 Table S2. Comparison with Reported MiRNA Detection Methods. Method Detection limit Dynamic range (fm) (fm nm) Ref Electrochemistry (1) Electrochemistry (2) Electrochemistry (3) Fluorescence (4) Fluorescence (5) SERS (6) SERS (7) SERS (8) ECL (9) ECL (10) PEC (11) PEC This work S-15

16 REFERENCES (1) Fang, C. S.; Kim, K.; Yu, B.; Jon, S. Y.; Kim, M.; Yang, H. Anal. Chem. 2017, 89, (2) Ma, J.; Qiu, Z.; Zardan Gomez de la Torre, T.; Donolato, M.; Hansen, M. F.; Svedlindh, P.; Stromberg, M. ACS Nano 2017, 11, (3) Zhang, K.; Dong, H. F.; Dai, W. H.; Meng, X. D.; Lu, H. T.; Wu, TT. T.; Zhang, X. J. Anal. Chem. 2017, 89, (4) Du, W. F.; Lv, M. M.; Li, J. J.; Yu R. Q.; Jiang, J. H. Chem. Commun. 2016, 52, (5) Zhang, C. H.; Tang, Y.; Sheng, Y. Y.; Wang, H.; Wu, Z.; Jiang, J. H. Chem. Commun. 2016, 52, (6) Zhou, W.; Tian, Y. F.; Yin, B. C.; Ye, B. C. Anal. Chem. 2017, 89, (7) Su, J.; Wang, D. F.; Nörbel, L.; Shen, J. L.; Zhao, Z. H.; Dou, Y. Z.; Peng, T. H.; Shi, J. Y.; Mathur, S. J.; Fan, C. H.; Song, S. P. Anal. Chem. 2017, 89, (8) Song, C. Y.; Yang, Y. J.; Yang, B. Y.; Sun, Y. Z.; Zhao, Y. P.; Wang, L. H. Nanoscale 2016, 8, (9) Feng, Q. M.; Shen, Y. Z.; Li, M. X.; Zhang, Z. L.; Zhao, W.; Xu, J. J.; Chen, H. Y. Anal. Chem. 2016, 88, (10) Li, Z. Y.; Lin, Z. F.; Wu, X. Y.; Chen, H. T.; Chai, Y. Q.; Yuan, R. Anal. Chem. 2017, 89, (11) Ye, C.; Wang, M. Q.; Gao, Z. F.; Zhang, Y.; Lei, J. L.; Luo, H. Q.; Li, N. B. Anal. Chem. 2016, 88, S-16