Supporting Information

Transcription

1 Supporting Information Silver Ion As a Novel Coreaction Accelerator for Remarkably Enhanced Electrochemiluminescence of PTCA/S 2 O 2-8 System and Its Application in Ultrasensitive Assay of Mercury Ion Yan-Mei Lei, Rui-Xin Wen, Jia Zhou, Ya-Qin Chai, Ruo Yuan, Ying Zhuo Key Laboratory of Luminescent and Real-Time Analytical Chemistry (Southwest University), Ministry of Education, College of Chemistry and Chemical Engineering, Southwest University, Chongqing Corresponding authors at: Tel.: , fax: addresses: yuanruo@swu.edu.cn (R. Yuan).yingzhuo@swu.edu.cn(Y.Zhuo);. S-1

2 Table of Contents for Supporting Information 1.1 Reagents and Material Apparatus Schematic Illustration of Possible Luminescence Mechanism of Different Systems ECL And CV Characterization of the Stepwise Assembly of the ECL Biosensor Pretreatment of the Soil Samples S-2

3 1.1 Reagents and Material Perylene-3,4,9,10-tetracarboxylic dianhydride (PTCDA) was purchased from Lian Gang Dyestuff Chemical Industry Co. Ltd. (Liaoning, China). Acetonitrile ( 99.7 %) was supplied from Kelong Chemicals Inc. (Chengdu, China). Hydrogen tetrachloroaurate (HAuCl 4 4H 2 O, 99.9%) and silver nitrate (Ag NO 3 ) were obtained from Shanghai Reagent Company (Shanghai, China). Tris(2-carboxyethyl) phosphine hydrochloride (TCEP), mercury perchlorate trihydrate (Hg(ClO 4 ) 2 3H 2 O), tris (hydroxymethyl) aminomethane hydrochloride (Tris-HCl), ethylenediaminetetraacetic acid (EDTA) and hexanethiol (HT, 96%) were bought from Sigma-Aldrich (St. Louis, MO, USA). The nicking endonuclease (Nt.BbvCI), 10 CutSmart Buffer, phi29 DNA polymerase and 10 phi29 DNA polymerase reaction buffer were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). All HPLC-purified DNA oligonucleotides (list Table S1), and deoxyribonucleoside triphosphate (dntps) were purchased from Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (China). Prior to use, H1, H2 and H3 were heated to 95 o C for 5 min and then allowed to cool to room temperature for 1 h. The underlined base sequence could hybridize with the same color underlined base sequence. Table S2 Sequence Information for the Nucleic Acids Used in This Study. Name machine DNA H1 Sequences*(5-3 ) TTGTGTAAGTAGTCTAGACGTAGCTGAGGTTCCCCAGATTCTTTCTTCC CTTGTTTGTTTCTG SH-TACTATATTGTGTAAGTAGTCTAGACGTAGCTGATTTTATTACACGC S-3

4 H2 H3 CGAATCCTAGACTACTT CCTCCTTCCTCCAACCGAATCCTAGACTACTCAAGTTAAAAGTAGTCT AGGATTCGGCGTGTAA AACTTGAGTAGTCTAGGATTCGGAATTACACGCCGAATCCTAGACTACTT AACCTCCTTCCTCC NEB buffer (ph 7.9) was obtained by using 50 mm NaCl, 10 mm Tris-HCl, 10 mm MgCl 2, and 1 mm dithiothreitol. Phosphate buffer solution (PBS, ph 7.4) was prepared by using 0.1 M Na 2 HPO 4, 0.1 M KH 2 PO 4, and 0.1 m KNO 3. All other chemicals not mentioned here were of analytical reagent (A.R.) grade and used as received. Ultrapure water was purified by a Millipore Milli-Q water purification system with an electric resistance of 18.2 MΩ/cm. 1.2 Apparatus The cyclic voltammetric (CV) and ECL emission measurements were simultaneously conducted on a model MPI-E multifunctional electrochemical and chemiluminescent analytical system (Xi an Remax Electronic Science and Technology Co. Ltd., Xi an, China) with a conventional three-electrode system containing a modified glassy carbon electrode (GCE, Φ = 4.0 mm) as working electrode, Ag/AgCl (saturated KCl) as reference electrode, and a platinum wire as the auxiliary electrode, respectively. Besides, the voltage of the photomultiplier tube (PMT) was set at 800 V, the potential scanning ranged from 1.7 to 0 V. The morphologies and sizes of samples were obtained by scanning electronmicroscopy (SEM, S-4800, Hitachi, Tokyo, Japan) at voltage of 20 kv. X-ray photoelectron spectroscopy (XPS) measurements were recorded on a VG Scientific ESCALAB 250 S-4

5 spectrometer (Thermoelectricity Instruments, USA). S-5

6 1.3 Schematic Illustration of Possible Luminescence Mechanism of Different Systems. Figure S1. Schematic illustration of possible luminescence mechanism of the different systems (a ~ f ). S-6

7 1.5. ECL And CV Characterization of the Stepwise Assembly of the Solid-state ECL Biosensing Platform. Figure S2. (A) ECL responses of the electrode at different stages in 5 mm K 2 S 2 O 8 (ph = 7.4) and (B) CV responses of the electrode at different stages in 0.1 M PBS buffer (ph = 7.4) containing 5.0 mm [Fe(CN) 6 ] 3 /4 as redox probe: (a) bare GCE, (b) GCE/PTCA, (c) GCE/PTCA/AuNPs, d. GCE/PTCA/AuNPs/H1, (e) GCE/PTCA/AuNPs/H1/HT, (f) GCE/PTCA/AuNPs/H1/HT/MT, (g) GCE/PTCA/AuNPs/H1/HT/MT/ds DNA, (h) GCE/PTCA/AuNPs/H1/HT/MT/MT/DNA-Ag(I). The stepwise assembly of the solid-state ECL biosensing platform was confirmed with ECL measurements in 5 mm S 2 O 2 8 solution (ph = 7.4), as shown in Figure 2SA. First, the bare GCE exhibited a relatively low ECL intensity (curve a), which could be attributed to the emission of 1 (O 2 ) * 2 in S 2 O 2-8 solution. [1] After the modification of PTCA on the GCE surface, a remarkable ECL response was observed (curve b). The reason for this was that the S 2 O 2 8 served as the co-reactant of PTCA to improve the ECL response. [2] However, when AuNPs were electrodeposited on the electrode surface, the ECL intensity slightly decreased (curve c). The reason may be that the hindering effect of AuNPs between the PTCA and S 2 O 2 8 made the ECL S-7

8 intensity decrease slightly. After successive modification with H1 (curve d), HT (curve e), and MT (curve f), the ECL signal further decreased sequentially. The reason may be that the insulation and steric hindrance of nonelectroactive molecule retarded the electron transfer on the electrode surface. When the above resultant electrode was incubated with the H2 and H3, the ECL intensity was sharply decreased (curve g). The reason may be that the long dsdna polymers on the electrode surface retarded the electron transfer. Finally, after incubation with the AgNO 3 solution, the ECL emission was significantly enhanced (curve h). It was mainly attributed to the fact that the Ag (I) ion, as a robust coreaction accelerator, were successfully intercalated into the dsdna grooves. To further characterize the interfacial changes of the biosensor at different stages, CVs were also performed in 0.1 M PBS (ph 7.4) solution containing 5 mm Fe(CN) 3 /4 6 (acting as the redox probe) with the scan range of -0.2 to 0.6 V, as shown in Figure 2SB. A pair of reversible, well-defined redox peaks was observed on the bare GCE (curve a). When the bare GCE was successivly modified with PTCA (curve b) and Au NPs (curve c), the peak currents of the electrode increased sequentially, which could be assigned to the excellent conductivity and large surface area of the PTCA and Au NPs. After successive modification with H1 (curve d) and HT (curve e), the peak currents of the electrode decreased sequentially. As expected, after hybridizing MT (curve f ), followed by HCR (curve g), the redox peak currents further decreased, which could be ascribed to the electrostatic repulsion of [Fe(CN) 6 ] 3-/4- from the electrode surface by the negative charges on the DNA S-8

9 backbones. Finally, after incubated with the AgNO 3 solution, the current response was greatly increased (curve h). The reason may be that the positively charged Ag (I) ions were intercalated into the dsdna grooves (curve g), which could decrease the density of negative charges of dsdna, resulting in the [Fe(CN) 6 ] 3-/4- reaching electrode surface easily. S-9

10 1.6 Pretreatment of the Soil Samples The soil solution was sequentially extracted by the well-known Tessier method with a sample of purple soil. [3] The reagents and operating conditions were summarized in Table S2. The procedure started with the extraction of 1.0 g dry sediment sample in 10 ml polypropylene centrifuge tubes. The supernatant was removed with a pipette and analyzed for trace metals, whereas the residue was washed with 4 ml ultrapure water. Before running the test, the ph of the extracted soil solution was adjusted to 7.4 with NaOH or HCl. Then, the prepared sample solution was further diluted with ultrapure water about times and kept at 4 o C for analysis. Table S2. Operating Conditions Required in the Tessier Sequential Extraction Method. Stage Fraction Reagent Experimental conditions 1 exchangeable 0.8 ml of 1 M MgCl 2 (ph 7) 1 h at 25 o C 2 carbonate 0.8 ml of 1 M NaAc (ph 5) 5 h at 25 o C 3 Fe-Mn oxides 2 ml of NH 2 OH HCl, 0.04 M in 25% m/v 6 h at 96 o C HAc 4 organic fractions 0.3 ml of 0.02 M HNO 3 / 0.5 ml of 30% 2 h at 85 o C m/v H 2 O ml of 30% m/v H 2 O 2 3 h at 85 o C ml of 3.2 M NH 4 Ac 30 min at 25 o C S-10

11 REFERENCES (1) Yu, Y. Q.; Zhang, H. Y.; Chai, Y. Q.; Yuan, R.; Zhuo, Y. Biosens. Bioelectron., 2016, 85, (2) Lei, Y. M.; Zhao, M.; Wang, A.; Yu, Y. Q.; Chai, Y. Q.; Yuan, R.; Zhuo, Y. Chem. - Eur. J. 2016, 22, (3) Tessier, A.; Campbell, P. G.; Bisson, M. Anal. Chem., 1979, 51, S-11