Tunable Nanoparticle Arrays at Charged Interfaces

Transcription

1 Tunable Nanoparticle Arrays at Charged Interfaces Supporting Material Sunita Srivastava 1, Dmytro Nykypanchuk 1, Masafumi Fukuto 2 and Oleg Gang 1* 1 Center for Functional Nanomaterials, Brookhaven National Laboratory, Upton, NY, Condensed Matter Physics and Materials Science Department, Brookhaven National Laboratory, Upton, NY, 11973

2 I. Small angle x-ray scattering (SAXS) for free particles. The size and polydispersity of the gold nanoparticle (NP) used in our studies were measured using SAXS at the beam line X9 of NSLS-I. The fit to the scattering data obtained from dilute DNA-NP solution to extract the form factor, is shown in Figure S1. Figure S1 Scattering intensity from free gold nanoparticles (black) before functionalization with ssdna and the corresponding fit (solid red line) using spherical form factor of particles. The particles sizes were estimated as 8.5 nm ± 0.75 nm using Gaussian distribution for the particle size. We used Irena: tool suite for modeling and analysis of small-angle scattering ( 1. II. In-situ GISAXS data on nanoparticle monolayer. The CCD images from in-situ GISAXS measurements of nanoparticle monolayer for system S C100_B65 at different NaCl concentration are shown in Figure S2. For neutral lipid with no added composition of cationic lipid, the scattering pattern shows no signature of Bragg rod due to absence of NPs at the interface. This confirms that cationic lipid facilitates the NP adsorption at the lipid surface through electrostatic attraction between negatively charge DNA-NPs and a positively charged lipid layer. With increase in salt concentration the in-plane interparticle spacing decrease as discussed in the main text. 2

3 Figure S2 GISAXS data from neutral lipid monolayer with 100% composition of cationic lipid and for system S C100_B65 at various added salt concentration in the sub-phase. To note the absence of Brag diffraction peak for neutral lipid monolayer confirms that cationic lipid facilitates the adsorption of DNA-NP to the interface through electrostatic attraction. Presence of brag diffraction rods in the data for S C100_B65 reveals formation of long ordered NP arrays at the lipid interface (refer main text). The in-plane line profiles, i.e. in-plane structure factors S(q r ), for various salt concentration are shown in Figure S3 for system S C100_B65 and S C50_B50. As discussed above and in main text, with increase in salt concentration the first peak position of S(q r ) moves towards higher in-plane scattering wave-vector q r, indicating a decrease in the in-plane interparticle spacing due to the shrinkage in DNA corona as well as adsorption of additional NPs from bulk sub-phase to the interface, as explained in the main text. 3

4 Figure S3 In-plane structure factor S(q r ) vs. salt concentration, as obtained from GISAXS measurements for (a) S C100_B65 and (b) S C50_B50. The first diffraction peak shifts towards higher in-plane scattering wave-vector indicating a decrease in the in-plane particle-particle separation with increase in salt concentration. 4

5 III. Sample preparation for SEM. Silicon substrates were cleaned with Piranha solution to remove any surface contaminants. The surfaces of freshly cleaned substrates were charged positively using layer-by-layer (LBL) deposition of polyelectrolytes. More specifically, firstly substrates were dip coated with solution of positively charged polymer, poly (diallyldimethylammonium chloride) (PDDA) of concentration 1 mg/ml for ~ 30 mins. After incubation for 30mins the substrates were rinsed several times with pure DI water. The alternate layer of negatively charged polymer, poly(acrylic acid) (PAA, 1 mg/ml) and PDDA layer were deposited by drop casting solution and incubation for ~ 15 mins followed by subsequent rinsing with clean water. To transfer the gold monolayer at the air/water interface the substrate was gently brought in contact with the monolayer from the top. The transferred monolayer were rinsed and dried under gentle airflow before the microscopy measurements. Figure S4 Ex-situ SEM data on DNA-NP monolayer transferred to charged silicon substrate at different (0 mm, 5 mm and 20 mm) concentration of NaCl. The increase in 2D particle density with increase in salt concentration is evident from the data. In Figure S4 we shows the ex-situ SEM data on DNA-NP layer transferred on charged silicon substrate at different salt concentration (0 mm, 5 mm and 20 mm). The NP monolayer at the water-vapor interface was prepared through adsorption of DNA-NP (50bases) on cationic lipid layer (100%). The increase in 2D packing density with increase in salt concentration is evident from the images. We note that the monolayer is homogeneous over several of microns in length and do not show any signature of voids within the NP layer or large scale empty regions. The DNA-NP monolayer at high salt concentration couldn t be measured using SEM during to charging effects on the sample. 5

6 IV. In-situ x-ray reflectivity at the interface We performed in-situ x-ray reflectivity (XRR) measurements to investigate the structural evoution of the NP monolayer normal to the surface as a function of a salt concentrations (Figure 3, main text). The XRR profile from a lipid monolayer exhibits a minimum at the high normal wavevector ~ 0.3Å -1 corresponding to the thickness of the lipid monolayer. Oscillations in the XRR profile appear at low normal wavevector on addition of nanoparticles due to the scattering from adsorbed gold nanoparticles at the interface. With increase in a salt concentration, the oscillations increase and well-defined Kiessig fringes appear. To extract a quantitaive information about surface density and thickness of the nanoparticle layer we model our data using the Parratt algorithm 2 for multiple interfaces. The fit to the data (solid line Figure 3 main text) was obtained by applying box model, where boxes account for the nanoparticle layer, lipid layer, water sub phase, and roughness between all interfaces. The lipid monolayer consists of individual boxes for the head group and hydrocarbon chains of the lipid molecules as shown in Figure 3b of main text. The DNA nanoparticle layer comprises of a box for DNA chains in vicinity of the surface along with a separate box for gold nanoparticles. Roughness between the lipid and nanoparticle layer was allowed to vary to account for any inhomogeneity of the monolayer. The density of the gold nanoparticle increase with increasaes with salt concentration as shown in electron density profile (Figure 3b, main text). We first fitted lipid layer with no absorbed nanoparticles at the interface. The parameters obtained from this fit for lipid layer were kept fixed for all DNA nanoparticle systems. In some cases the roughness was allowed to vary to obtain a better fit, however, the obtained values did not differ significantly. The extracted electron density profiles confirm the increase in surface density of gold in the NP monolayer with the increase of salt concentration. Below we provide the fitting paramters during different stages of the assembly for system S C100_B50. a) For lipid layer 6

7 b) With DNA-NP solution at 20mM NaCl. c) With DNA-NP solution at 70mM NaCl. 7

8 d) With DNA-NP solution at 100mM NaCl. V. Daoud-Cotton Model : The Daoud-Cotton (DC) model 3 was developed for star polymers in solution, and it can be applied for nanoparticles with DNA shells due to the morphological similarities of these objects 4. In the modified model for polyelectrolyte chains 5, 6, the length of corona, H can be expressed as, where, and d is the in-plane center- center distance, D is the diameter of the nanoparticle core, K is proportionality constant ~1, N is number of bases in ssdna chain tethered to particle surface, b (0.65 nm) is a base length), is a grafting density of DNA chains on NP surface, ~., is Debye screening and C s is the ionic strength (= salt concentration for monovalent NaCl) 7. 8

9 Figure S5 Power law analysis over extended range of salt concentration up to 500mM for S C50_B50. The DNA-NP adsorption exhibit weak dependence at salt concentration > 100 mm, with exponent γ ~ Table ST1: The DNA sequence design (5 to 3 ) for system presented in paper. HSC 6 H 12 represents the thiol modification. DNA sequence comprises of total n bases. B50 HSC 6 H 12 -(T) 12 CGTTGGCTGGATAGCTGTGTT CTTAACCTAACCTTCAT B65 HSC 6 H 12 -(T) 27 CGTTGGCTGGATAGCTGTGTTCTA TGAAGGTTAGGTTA 9

10 References 1. Ilavsky, J.; Jemian, P. R. Irena: Tool Suite for Modeling and Analysis of Small-Angle Scattering. J Appl Crystallogr 2009, 42, Parratt, L. G. Surface Studies of Solids by Total Reflection of X-Rays. Physics Review 1954, 95, Daoud, M.; Cotton, J. P. Star Shaped Polymers - a Model for the Conformation and Its Concentration-Dependence. J Phys-Paris 1982, 43, Xiong, H. M.; van der Lelie, D.; Gang, O. Phase Behavior of Nanoparticles Assembled by DNA Linkers. Phys Rev Lett 2009, Hariharan, R.; Biver, C.; Mays, J.; Russel, W. B. Ionic Strength and Curvature Effects in Flat and Highly Curved Polyelectrolyte Brushes. Macromolecules 1998, 31, Hariharan, R.; Biver, C.; Russel, W. B. Ionic Strength Effects in Polyelectrolyte Brushes: The Counterion Correction. Macromolecules 1998, 31, Barrat, J. L.; Joanny, J. F. Persistence Length of Polyelectrolyte Chains. Europhysics Letters 1993, 24,