Supporting Information for: Engineering the structure and properties of DNA-nanoparticle superstructures using polyvalent counterions
|
|
- Letitia Atkins
- 5 years ago
- Views:
Transcription
1 Supporting Information for: Engineering the structure and properties of DNA-nanoparticle superstructures using polyvalent counterions Leo Y.T. Chou 1 ǂ, Fayi Song 1 ǂ, Warren C.W. Chan*ǂǁ ǂ Institute of Biomaterials and Biomedical Engineering, Rosebrugh Building, Room 407, 164 College Street, Toronto, Ontario M5S 3G9, Canada ǁ Terrence Donnelly Centre for Cellular and Biomolecular Research, University of Toronto, 160 College Street, Room 230, Toronto, Ontario M5S 3E1, Canada Department of Chemical Engineering, 200 College Street, Toronto, Ontario M5S 3E5, Canada Department of Chemistry, 80 St George Street, Toronto, Ontario M5S 3H6, Canada Department of Material Science and Engineering, Wallberg Building, 184 College Street, Suite 140, University of Toronto, Toronto, Ontario M5S 3E4, Canada *Corresponding author (warren.chan@utoronto.ca) S1
2 Figure S1. Quantification of DNA grafting density on gold nanoparticles. Oligonucleotidefunctionalized nanoparticles were treated with dithiothreitol to release bound oligonucleotides and quantified using an Oligreen assay. The Y-axis refers to the number of oligonucleotides per nanoparticle. Figure S2. Transmission electron micrographs of DNA-nanoparticle superstructures. Core (15 nm) and satellite nanoparticles (5 nm) were assembled using DNA and stored in 1X PBST (left). Before incubation with polyelectrolytes, nanoparticle assemblies were exchanged into 1 mm MgCl 2 (middle). After incubation with polyelectrolytes, the sample was washed in 1 mm MgCl 2 and stored at 4 o C prior to further use. In all cases, samples remained monodisperse and stable. S2
3 Figure S3. Optimizing solvent conditions for polyelectrolyte coating of DNA assembled nanoparticles. (A) Chemical structures of three types of cationic polyelectrolytes tested in this study. Molecular weights are listed in Methods. (B) We incubated oligonucleotide-functionalized gold nanoparticles with polyelectrolytes in 1X PBST, which is a solvent we have previously shown to stabilize DNA assembled nanoparticles. However, UV-Vis absorbance measurements of the nanoparticle solution indicated aggregation following incubation with polyelectrolytes, both with and without subsequent isolation by centrifugation at 8000 g for 60 min. Aggregation was assessed by taking the ratio of the UV-Vis absorbance at 520 nm to 700 nm, corresponding to the surface plasmon resonance peaks of monodisperse and aggregated nanoparticles, respectively. The values presented in the graph were normalized to a control that has not been incubated with polyelectrolytes. This result prompted us to test whether exchanging nanoparticles into a different buffer before incubation with polyelectrolytes could eliminate aggregation. (C) We next assayed the stability of DNA duplexes on nanoparticles in solutions of either water, 10 mm NaCl, or 1 mm MgCl 2, with the hypothesis that these lower ionic strength solvents would improve colloidal stability. We assayed dsdna stability by determining the amount of a fluorescently-labeled oligonucleotide that remain hybridized to the nanoparticles following repeated washing in these buffers. Briefly, FAM-labeled oligonucleotide (FAM-Link2) was incubated with Core1-functionalized 13 nm nanoparticles. These nanoparticles were washed to remove unbound oligonucleotides and resuspended in 1X PBST. Nanoparticles were then washed two times in the respective new buffer conditions. Nanoparticles were then treated with dithiothreitol (10 mm) at 60 o C to liberate the oligonucleotides, followed by centrifugation at 16,000 g for 30 minutes to pellet nanoparticle aggregates. The amount of FAM-labeled oligonucleotides in the supernatant was determined using a plate reader. The stability of DNA duplex was reported as the ratio of the fluorescence intensity relative to a sample treated with 1X S3
4 PBST, which is expected to be stable. As a complementary strategy to stabilize DNA duplexes in these buffers, we also compared whether treating samples by photo-crosslinking with 8- methoxypsoralen (Pso) for varying amount of time further improves duplex DNA stability. We observed that DNA duplexes were unstable in water and 10 mm NaCl, with psoralen crosslinking having modest improvement in stability. On the other hand, 1 mm MgCl 2 quantitatively stabilized the DNA duplex. (D) Finally, we re-tested whether low millimolar concentrations of MgCl 2 could preserve the colloidal stability of oligonucleotide-coated nanoparticles in the presence of various polyelectrolytes (PAH, PLA, PLL). We found that oligonucleotide-coated nanoparticles were stable in the range of MgCl 2 that we tested (1 to 4 mm), whereas they rapidly aggregated in solutions containing 10 to 100 mm NaCl. We therefore conclude that 1 mm MgCl 2 preserved both colloidal stability and DNA duplex stability, and conducted all subsequent experiments with polyelectrolyte coating using this solvent condition. Figure S4. Effect of polyelectrolyte molecular weight on the optimal properties of core-satellite nanoparticle assemblies. (A) UV-Vis absorbance spectrum of 60 nm 30 nm core-satellite nanoparticles before and after coating with poly(l-lysine) of different chain lengths (n) = 5, 10, 30, 100, and 250. The spectrum for 60 nm gold nanoparticles is also included for comparison. (B) Shift in the surface plasmon resonance (SPR) of the core-satellite nanoparticles when coated with poly(l-lysine) of different chain lengths. Note the sharp transition above poly(l-lysine) of chain length n = 10. S4
5 Zeta Potential (mv) Polyelectrolyte Layer Figure S5. Zeta potential of DNA functionalized core-satellite nanoparticles after sequential deposition with alternating layers of poly(allylamine) (layers 1 and 3) and poly(styrene sulfonate) (layers 2 and 4). Figure S6. Effect of polyelectrolyte coating on the structural rigidity of DNA-metal superstructures. (A) Tilted-TEM images of non-coated 60 nm 30 nm and 60 nm 15 nm coresatellite nanoparticle assemblies. Dotted circles help guide the eye to changes in the relative S5
6 position between nanoparticles as a function of tilt angle. In general, non-coated assemblies show less change in the relative nanoparticle positions because they lay flat on the TEM grid. (B) Scheme showing the single stranded regions and nicking sites within the DNA-nanoparticle assembly. Nanoparticle assemblies shown in our study are not considered rigid in solution for a number of reasons. First, there are several nicks (indicated by the black arrows) along the DNA duplex linking core and satellite nanoparticles, which allow the DNA duplex to bend in solution. This movement will transiently change interparticle distance and plasmon coupling efficiency. Second, the persistence of double-stranded DNA has been reported to range from 35 to 50 nm depending on salt concentration. The linker used in our study is ~31 nm, which is on the order of the persistence length and hence can be considered to be semi-flexible. Third, there are two single-stranded poly(a) 10 regions in the DNA (indicated by the red arrows). These regions can rotate, swing, and stretch similar to worm-like polymer chains. These motions in turn make the structures flexible and labile in solution. On the other hand, when superstructures are incubated with polyamines, these DNA strands are strongly complexed with the polyvalent cations through electrostatic interactions, as evidenced by DNA condensation. Since nanoparticles are multivalent, these interactions effectively crosslink neighboring nanoparticles as well as between core and satellite nanoparticles. With additional layers deposited by the layer-by-layer approach, these interactions become stronger and much long-lived. Hence, we believe that the nanoparticles must experience much less freedom to move about. Figure S7. Transmission electron microscopy images of core-satellite superstructures encapsulated within four layers of poly(allylamine) and poly(styrene sulfonate). The sample was stored at 4 o C in 1 mm MgCl 2 (left) or deionized water (right) for one month before imaging. S6
7 Figure S8. UV-Vis absorbance spectra of core-satellite superstructures (shown in Figure 6) coated with poly(l-lysine) and poly(l-glutamic acid), before and following treatment with DNase I and/or Trypsin. Figure S9. UV-Vis absorbance spectra of core-satellite superstructures coated with four layers of the non-biodegradable polymers poly(allyamine) and poly(styrene sulfonate) before and after treatment with 0.1% trypsin. S7
8 Supporting Table S1. List of materials used in this study Reagent Description Source Gold (III) chloride trihydrate Sigma Aldrich (520918) Cetyl trimethylammonium bromide Sigma Aldrich (855820) Tannic acid Sigma Aldrich (403040) Trisodium citrate Sigma Aldrich (S4641) Hydroquinone Sigma Aldrich (H17902) Tween20 Sigma Aldrich (P1379) Sodium borohydride Sigma Aldrich (452882) Silver nitrate Sigma Aldrich (S6506) Ascorbic acid Sigma Aldrich (255564) Sodium dodecyl sulfate Sigma Aldrich (436143) Phosphate buffered saline tablets Sigma Aldrich (P4417) Magnesium chloride Sigma Aldrich (M4880) Poly(allylamine hydrochloride) Sigma Aldrich (283215) Poly(styrene sulfonate) Polymer Standards Service (PSSpss15k) Poly(L-arginine) Sigma Aldrich (P7762) Poly(L-lysine), MW15,000-30,000 Sigma Aldrich (P7890) Poly(L-lysine), MW100,000 Sigma Aldrich (P2658) Poly(L-lysine) -PLL5, MW 800 Bio Basic Inc (custom synthesis) Poly(L-lysine) -PLL10, MW1600 Bio Basic Inc (custom synthesis) Poly(L-lysine) -PLL30, MW4,900 ALAMANDA (custom synthesis) Poly(L-lysine) -PLL100, MW16,000 ALAMANDA (custom synthesis) Poly(L-lysine) -PLL250, MW41,000 ALAMANDA (custom synthesis) Poly(L-glutamic acid) Sigma Aldrich (P4761) 8-methoxy psoralen Sigma Aldrich (M3501) Dithiothreitol BioShop (DTT001.5) Trypsin Invitrogen ( ) DNase I Thermo Scientific (EN0521) Supporting Table S2. Synthesis recipes of 30 nm and 60 nm gold nanoparticles Nanoparticle size (nm) Water (ml) %w/v HAuCl 4 (ml) mg/ml trisodium citrate (ml) mg/ml Hydroquinone (ml) nm gold nanoparticle seeds (ml) S8
9 Supporting Table S3. List of oligonucleotide sequences used in this study Name Sequence (5-3 ) Core1 S-S C6/AAAAAAAAAACCTATCGACCATGCT Sat1 TAACAACGATCCCTCAAAAAAAAAA/C6 S-S Sat2 S-S C6/AAAAAAAAAAATGGCCGATGTATGT Link1 GAGGGATCGTTGTTATACAGTTCAGGCAGTGTCTCGTAGTGGTACAT AGCTAGCTTTACAAGATTTTCTCGCTGGAGCATGGTCGATAGG Link1_FAM FAM/GAGGGATCGTTGTTATACAGTTCAGGCAGTGTCTCGTAGTGGT ACATAGCTAGCTTTACAAGATTTTCTCGCTGGAGCATGGTCGATAGG Link2 AGCCTACTTTCCTCTTGATCGCTCACGGTACTACATACATCGGCCAT Spacer1 CACTGCCTGAACTGT Spacer2 CAGCGAGAAAATCTTGTAAAGCTAGCTATGTACCACTACGA Spacer2_Cy5 CAGCGAGAAAATCTTGTAAAGCTAGCTATGTACCACTACGA/Cy5 * All the oligonucleotides used in this study were purchased from Bio Basic Inc. Colors indicate sequence complementarity. S9
Self-assembly of PEGylated Gold Nanoparticles. with Satellite Structures as Seeds
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 216 Electronic Supplementary Information for Self-assembly of PEGylated Gold Nanoparticles with Satellite
More informationFast ph-assisted functionalization of silver nanoparticles with monothiolated DNA
Supporting Information for Fast ph-assisted functionalization of silver nanoparticles with monothiolated DNA Xu Zhang ab, Mark R. Servos b, and Juewen Liu* a a Department of Chemistry and Waterloo Institute
More informationBottom-up Optimization of SERS Hot Spots. Supplementary Information
Bottom-up Optimization of SERS Hot Spots Laura Fabris, * Department of Materials Science and Engineering, Institute for Advanced Materials Devices ad Nanotechnology, Rutgers, The State University of New
More informationKinetically Controlled Seeded Growth Synthesis of Citrate Stabilized Gold. Nanoparticles up to 200 nm: Size Focusing versus.
Kinetically Controlled Seeded Growth Synthesis of Citrate Stabilized Gold Nanoparticles up to 200 nm: Size Focusing versus. Ostwald Ripening Neus G. Bastús, Joan Comenge and Víctor Puntes Additional Results
More informationInstantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route
Supporting Information Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route Xu Zhang,, Mark R. Servos and Juewen Liu *
More informationBiodegradable Hollow Silica Nanospheres Containing Gold Nanoparticle Arrays
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Biodegradable Hollow Silica Nanospheres Containing Gold Nanoparticle Arrays Domenico Cassano a,b,
More informationPermeable Silica Shell through Surface-Protected Etching
Permeable Silica Shell through Surface-Protected Etching Qiao Zhang, Tierui Zhang, Jianping Ge, Yadong Yin* University of California, Department of Chemistry, Riverside, California 92521 Experimental Chemicals:
More information- Supporting Information - Controlled Assembly of Eccentrically Encapsulated Gold Nanoparticles
- Supporting Information - S1 Controlled Assembly of Eccentrically Encapsulated Gold Nanoparticles Tao Chen, Miaoxin Yang, Xinjiao Wang, Li Huey Tan, Hongyu Chen* Division of Chemistry and Biological Chemistry,
More informationHighly Sensitive and Selective Colorimetric Visualization of Streptomycin in Raw Milk Using Au Nanoparticles Supramolecular Assembly
SUPPORTING INFORMATION Highly Sensitive and Selective Colorimetric Visualization of Streptomycin in Raw Milk Using Au Nanoparticles Supramolecular Assembly Jiayu Sun, Jiechao Ge, Weimin Liu, Zhiyuan Fan,
More informationAn Unconventional Role of Ligand in Continuously. Tuning of Metal-Metal Interfacial Strain
-Supporting Information- An Unconventional Role of Ligand in Continuously Tuning of Metal-Metal Interfacial Strain Yuhua Feng, Jiating He, Hong Wang, Yee Yan Tay, Hang Sun, Liangfang Zhu, and Hongyu Chen*,
More informationThe photoluminescent graphene oxide serves as an acceptor rather. than a donor in the fluorescence resonance energy transfer pair of
Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 20XX The photoluminescent graphene oxide serves as an acceptor rather than a donor in the fluorescence
More informationSpherotech, Inc Irma Lee Circle, Unit 101, Lake Forest, Illinois PARTICLE COATING PROCEDURES
SPHERO TM Technical Note STN-1 Rev C. 041106 Introduction Currently, there are several methods of attaching biological ligands to polystyrene particles. These methods include adsorption to plain polystyrene
More informationSupplementary Information
Supplementary Information Self-assembly of Metal-Polymer Analogues of Amphiphilic Triblock Copolymers 1 Zhihong Nie, 1 Daniele Fava, 1, 2, 3 Eugenia Kumacheva 1 Department of Chemistry, University of Toronto,
More informationPhysisorption of Antibodies using BioReady Bare Nanoparticles
TECHNICAL RESOURCE Lateral Flow Immunoassays Physisorption of Antibodies using BioReady Bare Nanoparticles Introduction For more than 20 years, lateral flow immunoassay diagnostic tests have provided a
More informationHierarchical Host-Guest Assemblies Formed on Dodecaborate-Coated Gold Nanoparticles
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 17 Hierarchical Host-Guest Assemblies Formed on Dodecaborate-Coated Gold Nanoparticles
More informationThree Dimensional Nano-assemblies of Noble Metal. Nanoparticles-Infinite Coordination Polymers as a Specific
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Three Dimensional Nano-assemblies of Noble Metal Nanoparticles-Infinite
More informationSupporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2019 Supporting Information for Halide-assisted activation of atomic hydrogen for photoreduction on
More informationProbing the Kinetics of Ligand Exchange on Colloidal Gold. Nanoparticles by Surface-Enhanced Raman Scattering
-Supporting Information- Probing the Kinetics of Ligand Exchange on Colloidal Gold Nanoparticles by Surface-Enhanced Raman Scattering Yuhua Feng, Shuangxi Xing, Jun Xu, Hong Wang, Jun Wei Lim, and Hongyu
More informationMake or Buy? The Economics of Gold Nanoparticle Manufacturing for Lateral Flow Assays
TECHNICAL RESOURCE Lateral Flow Immunoassays Make or Buy? The Economics of Gold Nanoparticle Manufacturing for Lateral Flow Assays Introduction Price is an important factor in the commercial success of
More informationOne-step seeded growth of Au nanoparticles with widely tunable sizes
Electronic Supplementary Information (ESI) One-step seeded growth of Au nanoparticles with widely tunable sizes Chuanbo Gao, John Vuong, Qiao Zhang, Yiding Liu and Yadong Yin* Department of Chemistry,
More information3D Dendritic Gold Nanostructures: Seeded Growth of Multi-Generation Fractal Architecture
-Supporting Information- 3D Dendritic Gold Nanostructures: Seeded Growth of Multi-Generation Fractal Architecture Ming Pan, Shuangxi Xing, Ting Sun, Wenwen Zhou, Melinda Sindoro, Hui Hian Teo, Qingyu Yan,
More informationExploiting the Interaction of Pyranine-3 with Poly(L-Lysine) to Mediate Nanoparticle Assembly: Fabrication of Dynamic ph-responsive Nanocontainers
Exploiting the Interaction of Pyranine-3 with Poly(L-Lysine) to Mediate Nanoparticle Assembly: Fabrication of Dynamic ph-responsive Nanocontainers Arlin Jose Amali, a Shashi Singh, b Nandini Rangaraj,
More informationSupporting Online Material. On-Chip Dielectrophoretic Co-Assembly of Live Cells and. Particles into Responsive Biomaterials
Supporting Online Material On-Chip Dielectrophoretic Co-Assembly of Live Cells and Particles into esponsive Biomaterials Shalini Gupta, ossitza G. Alargova, Peter K. Kilpatrick and Orlin D. Velev* Description
More informationElectronic Supplementary Information
Electronic Supplementary Information Core solution: a strategy towards gold core/non-gold shell nanoparticles bearing strict DNA-valences for programmable nanoassembly Huiqiao Wang, a Yulin Li, a Ming
More informationHigh-Purity Separation of Gold Nanoparticle Dimers and Trimers
-Supporting Information- High-Purity Separation of Gold Nanoparticle Dimers and Trimers Gang Chen, Yong Wang, Li Huey Tan, Miaoxin Yang, Lee Siew Tan, Yuan Chen and Hongyu Chen* Division of Chemistry and
More informationInteraction of Gold Nanoparticle with Proteins
Chapter 7 Interaction of Gold Nanoparticle with Proteins 7.1. Introduction The interfacing of nanoparticle with biomolecules such as protein is useful for applications ranging from nano-biotechnology (molecular
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2007
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2007 DNA based control of interparticle interactions for regulated micro- and nano-particle assembly** Mathew M. Maye,
More informationNon-Interfering Protein Assay Kit Cat. No
Visit our interactive pathways at /pathways User Protocol 488250 Rev. 5 January 2006 RFH Page 1 of 1 Non-Interfering Protein Assay Kit Cat. No. 488250 Note that this user protocol is not lot-specific and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Table of Contents 1. General materials and methods S1 2. Synthesis of isonicotinamide derivatives S2 3. Details of the experimental set-up S3 4. Labview interface S4 5. LSPR observed
More informationSupplementary Information
This journal is The Royal Society of Chemistry Supplementary Information Chitosan-coated triangular silver nanoparticles as a novel class of biocompatible, highly sensitive plasmonic platforms for intracellular
More informationIn Situ Gelation-Induced Death of Cancer Cells Based on Proteinosomes
Supporting information for In Situ Gelation-Induced Death of Cancer Cells Based on Proteinosomes Yuting Zhou, Jianmin Song, Lei Wang*, Xuting Xue, Xiaoman Liu, Hui Xie*, and Xin Huang* MIIT Key Laboratory
More informationSupporting Information. Time-Resolved Botulinum Neurotoxin A Activity Monitored using. Peptide-Functionalized Au Nanoparticle Energy Transfer Sensors
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2014 Supporting Information Time-Resolved Botulinum Neurotoxin A Activity Monitored using Peptide-Functionalized
More informationProgrammed ph-driven Reversible Association and Dissociation of Inter-Connected. Circular DNA Dimer Nanostructures
Supporting information Programmed ph-driven Reversible Association and Dissociation of Inter-Connected Circular DNA Dimer Nanostructures Yuwei Hu, Jiangtao Ren, Chun-Hua Lu, and Itamar Willner* Institute
More informationSynthesis of Nanoparticles and Surface Modifications
Synthesis of Nanoparticles and Surface Modifications Self-Assembly Static assembly Dynamic assembly RT = 8.314 J/mol x 300 = 2.4 kj/mol Driving forces Chemisorption Surface effect Hydrophobic-hydrophilic
More informationSupporting Information for. Chad A. Mirkin* Department of Chemistry and Institute for Nanotechnology, Northwestern University,
S1 Supporting Information for Observation of a Quadrupole Plasmon Mode for a Colloidal Solution of Gold Nanoprisms Jill E. Millstone, Sungho Park, Kevin L. Shuford, Lidong Qin, George C. Schatz, and Chad
More informationSpecifically colorimetric recognition of calcium, strontium, barium. ions using 2-mercaptosuccinic acid-functionalized gold nanoparticles
Electronic Supporting Information (ESI) for Specifically colorimetric recognition of calcium, strontium, barium ions using 2-mercaptosuccinic acid-functionalized gold nanoparticles and its use in reliable
More informationSpherical Silver Nanoparticles in the Detection of Thermally Denatured Collagens
Analytical and Bioanalytical Chemistry Electronic Supplementary Material Spherical Silver Nanoparticles in the Detection of Thermally Denatured Collagens Manuel Ahumada, Sarah McLaughlin, Natalia L. Pacioni,
More informationSupporting Information
Supporting Information Precisely Controllable Core-Shell Ag@Carbon Dots Nanoparticles: Application to in Situ Super-Sensitive Monitoring of Catalytic Reactions Jing Jin, Shoujun Zhu, Yubin Song, Hongyue
More information1 Supporting Information. 2 Reconfigurable and resettable arithmetic logic units based. 4 Siqi Zhang a, Kun Wang a, Congcong Huang b and Ting Sun a*
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 1 Supporting Information 2 Reconfigurable and resettable arithmetic logic units based 3 on magnetic
More informationHeteroagglomeration of nanosilver with colloidal SiO2 and clay
, 14, 1 8 Supplementary material Heteroagglomeration of nanosilver with colloidal SiO2 and clay Sébastien Maillette, A Caroline Peyrot, A Tapas Purkait, B Muhammad Iqbal, B Jonathan G. C. Veinot B and
More informationNovel fluorescent matrix embedded carbon quantum dots enrouting stable gold and silver hydrosols
Novel fluorescent matrix embedded carbon quantum dots enrouting stable gold and silver hydrosols Shouvik Mitra a, Sourov Chandra b, Prasun Patra a, Panchanan Pramanik b *, Arunava Goswami a * a AERU, Biological
More informationPlasmonic Nanosnowmen with a Conductive. and Sensitive, Quantitative and Multiplexable. Surface-Enhanced Raman Scattering Probes
Supporting Information Plasmonic Nanosnowmen with a Conductive Junction as Highly Tunable Nanoantenna Structures and Sensitive, Quantitative and Multiplexable Surface-Enhanced Raman Scattering Probes Jung-Hoon
More informationUV-vis Analysis of the Effect of Sodium Citrate on the Size and the Surface Plasmon Resonance of Au NPs. Eman Mousa Alhajji
UV-vis Analysis of the Effect of Sodium Citrate on the Size and the Surface Plasmon Resonance of Au NPs Eman Mousa Alhajji North Carolina State University Department of Materials Science and Engineering
More informationFacile Phase Transfer of Gold Nanoparticles From Aqueous. Solution to Organic Solvents with Thiolated Poly(ethylene glycol)
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supporting Information for: Facile Phase Transfer of Gold Nanoparticles From Aqueous Solution
More informationA Systematic Study of the Synthesis of Silver Nanoplates: Is Citrate a. "Magic" Reagent?
SUPPORTING INFORMATION A Systematic Study of the Synthesis of Silver Nanoplates: Is Citrate a "Magic" Reagent? Qiao Zhang, Na Li,, James Goebl, Zhenda Lu, Yadong Yin*, Department of Chemistry, University
More informationSupporting Information
This journal is (c) The Royal Society of Chemistry 21 Zeta potential based Colorimetric Immunoassay for the direct detection of Diabetic marker HbA1c using Gold Nanoprobes Nishima Wangoo, a,b Jyotsna Kaushal,
More informationDeposition of Gold Nanoparticles on Polystyrene Spheres by Electroless Metal Plating Technique
Journal of Physics: Conference Series Deposition of Gold Nanoparticles on Polystyrene Spheres by Electroless Metal Plating Technique To cite this article: Y Kobayashi et al 2007 J. Phys.: Conf. Ser. 61
More informationRole of Surface Charge of Inhibitors on Amyloid Beta Fibrillation
Supporting Information Role of Surface Charge of Inhibitors on Amyloid Beta Fibrillation SWATHI SUDHAKAR, PANDURANGAN KALIPILLAI, POORNIMA BUDIME SANTHOSH, ETHAYARAJA MANI* POLYMER ENGINEERING AND COLLOID
More informationEncapsulation of enzyme in metal ion-surfactant nanocomposites for
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supporting information for Encapsulation of enzyme in metal ion-surfactant nanocomposites for catalysis
More informationSelf-Assembly of Coated Colloidal Particles for Optical Applications
Self-Assembly of Coated Colloidal Particles for Optical Applications Introduction Nearly two decades ago, theoretical predictions indicated the possibility of creating omnidirectional photonic-band-gap
More informationSupporting Information
Gold Nanoparticle-Modified ITO Electrode for Electrogenerated Chemiluminescence: Well-Preserved Transparency and Highly-Enhanced Activity Zuofeng Chen and Yanbing Zu * Department of Chemistry, The University
More informationSupplementary Information. Core-Shell Silver/Polymeric Nanoparticles-Based Combinatorial Therapy against Breast Cancer In-vitro
Supplementary Information Core-Shell Silver/Polymeric Nanoparticles-Based Combinatorial Therapy against Breast Cancer In-vitro Nancy M. El-Baz 1,2, Laila Ziko 1,3, Rania Siam 1,3, Wael Mamdouh 1,2 * 1
More informationSupporting Information. Self-assembled nanofibers from Leucine Derived Amphiphiles as Nanoreactors for Growth of ZnO Nanoparticles
Supporting Information Self-assembled nanofibers from Leucine Derived Amphiphiles as Nanoreactors for Growth of ZnO Nanoparticles Karen T. Johnson, Theodore E. Gribb, Evan M. Smoak, and Ipsita A. Banerjee*
More informationSupporting Information. Chiral Plasmonic Films Formed by Gold Nanorods and Cellulose Nanocrystals
1 Supporting Information Chiral Plasmonic Films Formed by Gold Nanorods and Cellulose Nanocrystals Ana Querejeta-Fernández, Grégory Chauve, Myriam Methot, Jean Bouchard, Eugenia Kumacheva # * Department
More informationSupplementary Information
Supplementary Information 1. Experimental 1.1.1 Synthesis of hollow silica nanoparticles NPs. The precursor of sol-gel silica is fresh made 1.0 M Si(OH) 4 solution which was made by adding tetramethyl
More informationApplication Note Antibody-SOMAmer Sandwich Assay
Application Note Antibody-SOMAmer Sandwich Assay Introduction SOMAmer reagents (Slow Off-rate Modified Aptamers) are DNA-based high affinity (average Kd < 1 nm) protein binding reagents with proprietary
More informationSupporting Information
Supporting Information A fishnet electrochemical Hg 2+ sensing strategy based on gold nanopartical-bioconjugate and thymine-hg 2+ -thymine coordination chemistry Xuemei Tang 1, Huixiang Liu 1, Binghua
More informationHigh-yield halide-free synthesis of biocompatible Au nanoplates
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2016 Supporting information High-yield halide-free synthesis of biocompatible Au nanoplates
More informationThe cytotoxicity of gold nanoparticles is dispersitydependent
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 2015 The cytotoxicity of gold nanoparticles is dispersitydependent Dengtong Huang, Hualu
More informationNAD + /NADH Assay [Colorimetric]
G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name NAD + /NADH Assay [Colorimetric] (Cat. #786 1539, 786 1540) think proteins! think G-Biosciences
More informationLateral Flow: Making Magnetic Particles A Viable And Easier To Use Replacement To Gold Nanoparticles.
AN2 LATERAL FLOW COUPLING KIT Lateral Flow: Making Magnetic Particles A Viable And Easier To Use Replacement To Gold Nanoparticles. Introduction While lateral flow immunoassays represent a quick, low cost,
More informationDual-Range TM BCA Protein Assay Kit
Manual DualRange TM BCA Protein Assay Kit BC31/BC325/BC35 V3.1 For Research Use Only Introduction DualRange TM BCA Protein Assay Kit is a perfect protein assay method. It based on bicinchoninic acid (BCA)
More informationElectronic Supplementary Information. Colorimetric assay for cyanide and cyanogenic glycoside. using polysorbate 40-stabilized gold nanoparticles
Electronic Supplementary Information Colorimetric assay for cyanide and cyanogenic glycoside using polysorbate 40-stabilized gold nanoparticles Cheng-Yu Liu a and Wei-Lung Tseng* a,b a. Department of Chemistry,
More informationSupporting Information
Supporting Information Surfactant-Free Preparation of Au@Resveratrol Hollow Nanoparticles with Photothermal Performance and Antioxidant Activity Wenjing Wang, Qi Tang, Tianrong Yu, Xing Li, Yang Gao, Jing
More informationConnecting metallic nanoparticles by optical
Supplementary Information for Connecting metallic nanoparticles by optical printing Julián Gargiulo 1, Santiago Cerrota 1, Emiliano Cortés 1, Ianina L. Violi 1, Fernando D. Stefani* 1,2 1 Centro de Investigaciones
More informationoften display a deep green color due to where the SPR occurs (i.e., the wavelength of light that interacts with this specific morphology).
Synthesis-Dependent Catalytic Properties of Gold Nanoparticles Nanoscience is the study of materials that have dimensions, intuitively, on the nanoscale, typically between 1 100 nm. This field has received
More informationTaKaRa BCA Protein Assay Kit
Cat. # T9300A For Research Use TaKaRa BCA Protein Assay Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Materials Required by not Provided... 3 V. Precautions
More informationSupporting Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Supporting Information Poly(ferrocenylsilane) Electrolytes as Gold Nanoparticle Foundry: Two-in-
More informationGraft of gold on spin-crossover nanoparticles: Supplementary material
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Graft of gold on spin-crossover nanoparticles: SCO@Au Lucie Moulet, a Nathalie Daro, a Stéphane
More informationSupporting Information
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2015 Supporting Information Experimental Methods Instrumentation Zeta potentials and sizes of colloidal
More informationHigh photostability and enhanced fluorescence of gold nanoclusters by silver doping-supporting information
High photostability and enhanced fluorescence of gold nanoclusters by silver doping-supporting information Size measurements Figure S1 P2 FTIR measurements Figure S2 P2 XPS measurements Figure S3 P3 Photo-physical
More informationTunable Nanoparticle Arrays at Charged Interfaces
Tunable Nanoparticle Arrays at Charged Interfaces Supporting Material Sunita Srivastava 1, Dmytro Nykypanchuk 1, Masafumi Fukuto 2 and Oleg Gang 1* 1 Center for Functional Nanomaterials, Brookhaven National
More informationElectronic Supplementary Information. Direct synthesis of H 2 O 2 catalyzed by Pd nanoparticles encapsulated in multi-layered
Electronic Supplementary Information Direct synthesis of H 2 O 2 catalyzed by Pd nanoparticles encapsulated in multi-layered polyelectrolyte nanoreactors on a charged sphere Young-Min Chung,* a Yong-Tak
More informationMultifunctional polyphosphazene-coated multi-walled carbon. nanotubes for the synergistic treatment of redox-responsive
Electronic Supplementary Material (ESI) for Polymer Chemistry. This journal is The Royal Society of Chemistry 2017 Supporting information for Multifunctional polyphosphazene-coated multi-walled carbon
More informationSupporting Information
Supporting Information Phenyl-Modified Carbon Nitride Quantum Dots with Distinct Photoluminescence Behavior Qianling Cui, Jingsan Xu,* Xiaoyu Wang, Lidong Li,* Markus Antonietti, and Menny Shalom anie_201511217_sm_miscellaneous_information.pdf
More informationHighly Controlled Synthesis and Super-Radiant. Photoluminescence of Plasmonic Cube-in-Cube. Nanoparticles
Supporting Information Highly Controlled Synthesis and Super-Radiant Photoluminescence of Plasmonic Cube-in-Cube Nanoparticles Jeong-Eun Park, Sungi Kim, Jiwoong Son, Yeonhee Lee and Jwa-Min Nam* Department
More informationHybrid Gold Superstructures: Synthesis and. Specific Cell Surface Protein Imaging Applications
Supporting Information Hybrid Gold Nanocube@Silica@Graphene-Quantum-Dot Superstructures: Synthesis and Specific Cell Surface Protein Imaging Applications Liu Deng, Ling Liu, Chengzhou Zhu, Dan Li and Shaojun
More informationMagnetically-driven selective synthesis of Au clusters on Fe 3 O 4 Nanoparticles
Electronic Supplementary Material (ESI) for Chemical Communications Magnetically-driven selective synthesis of Au clusters on Fe 3 O 4 Nanoparticles Víctor Sebastian, M. Pilar Calatayud, Gerardo F. Goya
More informationSUPPORTING INFORMATION
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2017 SUPPORTING INFORMATION Synthesis of Circular and Triangular Gold Nanorings with
More informationTetraethyl orthosilicate (TEOS, 99 %), resorcinol, formalin solution (37 wt. %),
Supporting Information A Versatile Cooperative Template-Directed Coating Method to Construct Uniform Microporous Carbon Shell for Multifunctional Core-shell Nanocomposites Buyuan Guan, Xue Wang, Yu Xiao,
More informationUsing an environmentally-relevant panel of Gramnegative bacteria to assess the toxicity of polyallylamine hydrochloride-wrapped gold nanoparticles
Electronic Supplementary Material (ESI) for Environmental Science: Nano. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Using an environmentally-relevant panel
More informationA General Synthesis of Discrete Mesoporous Carbon Microspheres through a Confined Self- Assembly Process in Inverse Opals
A General Synthesis of Discrete Mesoporous Carbon Microspheres through a Confined Self- Assembly Process in Inverse Opals Zhenkun Sun,, Yong Liu, Bin Li, Jing Wei, Minghong Wang, Qin Yue, Yonghui Deng,
More informationRayBio Nickel Magnetic Particles
RayBio Nickel Magnetic Particles Catalog #: 801-108 User Manual Last revised January 4 th, 2017 Caution: Extraordinarily useful information enclosed ISO 1348 Certified 3607 Parkway Lane, Suite 100 Norcross,
More informationStudying the Chemical, Optical and Catalytic Properties of Noble Metal (Pt, Pd, Ag, Au)/Cu 2 O Core-Shell Nanostructures Grown via General Approach
Studying the Chemical, Optical and Catalytic Properties of Noble Metal (Pt, Pd, Ag, Au)/Cu 2 O Core-Shell Nanostructures Grown via General Approach Noga Meir, Ilan Jen-La Plante, Kobi Flomin, Elina Chockler,
More informationElectrochemiluminescence detection of near single DNA molecule with quantum dots-dendrimer nanocomposite for signal amplification
Electronic Supplementary Information (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2011 Electrochemiluminescence detection of near single DNA molecule with quantum
More informationSupporting Information
Supporting Information Supplemental Figure 1: Demonstration of polyelectrolyte complex formation ability. After mixing solutions of PA and PSS separately dissolved in the respective alcohol, increasing
More informationInserting grids into capsule Removing capsules from grid box Immunolabeling using template guide Preparing for TEM insertion
Protocol Immunolabeling protocols are easily adapted to mprep/g processing. This document illustrates a typical protocol using a primary antibody and a secondary antibody conjugated to colloidal gold,
More informationProtocol for 2D-E. Protein Extraction
Protocol for 2D-E Protein Extraction Reagent 1 inside the ReadyPrep TM Sequential Extraction kit (in powder form) 50ml of deionized water is used to dissolve all the Reagent 1. The solution is known as
More informationElectronic supplementary information for:
Electronic supplementary information for: Charge-transfer-induced suppression of galvanic replacement and synthesis of (Au@Ag)@Au double shell nanoparticles for highly uniform, robust and sensitive bioprobes
More informationSupporting Information
Supporting Information Experimental Materials: For the gold nanocuboids, the chemicals gold (ш) chloride trihydrate, sodium borohydride, cetyltrimethylammonium bromide, copper sulfate, L-ascorbic acid
More informationSupporting Information
Supporting Information Multifunctional Albumin-MnO 2 Nanoparticles Modulate Solid Tumor Microenvironment by Attenuating Hypoxia, Acidosis, Vascular Endothelial Growth Factor and Enhance Radiation Response
More informationLabel-Free Fluorimetric Detection of Histone Using Quaternized Carbon Dot-DNA Nanobiohybrid. Electronic Supplementary Information (ESI)
Label-Free Fluorimetric Detection of Histone Using Quaternized Carbon Dot-DNA Nanobiohybrid Subhabrata Maiti, Krishnendu Das, and Prasanta Kumar Das* Department of Biological Chemistry, Indian Association
More informationDNA can be extracted from the following sample types using this procedure: Archived
Sample types Principle Safety Equipment and supplies DNA can be extracted from the following sample types using this procedure: concentrated DNA samples (e.g., blood, saliva, non-contact samples) hair
More informationSupplementary Information. Pluronic polymer capped biocompatible mesoporous silica nanocarriers
Supplementary Information Pluronic polymer capped biocompatible mesoporous silica nanocarriers Adem Yildirim,* ab Gokcen Birlik Demirel, bc Rengin Erdem, ab Berna Senturk, ab Turgay Tekinay, ab and Mehmet
More informationLayer-by-Layer (LBL) Self-Assembly
Layer-by-Layer (LBL) Self-Assembly 1 Layer-by-Layer (LBL) Self-Assembly No! Layers! Onions have layers! Ogres have Layers! Onions have Layers. You get it? We both have layers. Sherk 2001 Oh, you both have
More information3D Motion of DNA-Au Nanoconjugates in Graphene Liquid Cell EM
Supporting Information for 3D Motion of DNA-Au Nanoconjugates in Graphene Liquid Cell EM Qian Chen,,, Jessica Smith,, Jungwon Park,,1, Kwanpyo Kim,,2, Davy Ho, Haider I. Rasool,,!Alex Zettl,, A. Paul Alivisatos,,*!
More informationEnzymatic Assay of CHITINASE (EC )
PRINCIPLE: Chitin + H 2 O Chitinase > Chitobiose Chitobiose + H 2 O ß-N-Acetylglucosaminidase > N-Acetyl-D-Glucosamine CONDITIONS: T = 25 C, ph = 6.0, A 540nm, Light path = 1 cm METHOD: Colorimetric REAGENTS:
More informationAggregation and Interaction of Cationic Nanoparticles on Bacterial Surfaces.
Aggregation and Interaction of Cationic Nanoparticles on Bacterial Surfaces. Steven C. Hayden, a Gengxiang Zhao, e Krishnendu Saha, c Ronnie L. Phillips, a Xiaoning Li, c Oscar R. Miranda, c Vincent M.
More informationSynthesis of 2 ) Structures by Small Molecule-Assisted Nucleation for Plasmon-Enhanced Photocatalytic Activity
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Synthesis of Au@UiO-66(NH 2 ) Structures by Small Molecule-Assisted
More informationSupporting Information
Supporting Information Kamaly et al. 10.1073/pnas.1303377110 SI Materials and Methods Materials. Ac2-26 peptide (AMVSEFLKQAWFIENEEQEYV- QTVK) was purchased from Tocris Biosciences. Zymosan A was purchased
More information