Vitis 37 (3), (1998) R. E. DAVIS'), RASA JOMANTIENE I I, ELLEN L. DALLY'), and T. K. WOLF')

Transcription

1 Vitis 37 (3), (1998) Phytoplasas associated with grapevine yellows in Virginia belong to group 16SrI, subgroup A (toato big bud phytoplasa subgroup), and group 16SrIII, new subgroup I by '~ R E DAVIS'), RASA JOMATIEE I I, ELLE L DALLY'), and T K WOLF') Molecular Plant Pathology Laboratory, Agricultural Research Service-USDA, Beltsville, MD, USA z) Virginia Agricultural Experient Station, Winchester, Virginia, USA Suary : Grapevine yellows disease in Virginia closely resebles flavescence doree and other grapevine yellows diseases, but the phytoplasas infecting grapevines in Virginia are distinct fro other grapevine yellows pathogens RFLP analysis ofpcr-aplified 16S rda indicated that a Virginia grapevine yellows phytoplasa, designated VGYIII, was distinct fro all other phytoplasas studied, but was ost closely related to spirea stunt (SP1), walnut witches' broo (WWB), and poinsettia branch-inducing (PoiBl) phytoplasas in subgroups E, G, and H, respectively, of 16S rra group l6sriii RFLP analysis also indicated the existence of sequence heterogeneity between the two rra operons in the genoes ofsp 1 and WWB Based on the results fro RFLP and sequence coparisons with other group l6sriii phytoplasas, the VGYIII phytoplasa was classified in a new subgroup, designated 16SrIIl-l A second phytoplasa (VGYI) was detected in cultivated grapevines (Htis vinifera L ) and in wild grapevines (V riparia Michx ) and identified as a eber of subgroup 16Srl-A There was no evidence of flavescence doree, bois noir, or Australian grapevine yellows phytoplasas in Virginia K e y w o r d s : Vitis sp, grapevine yellows, phytoplasa, 16S rra gene Introduction Grapevine yellows diseases occur in widespread viticultural areas of the world (UYEMOTO 1976 ; CAUDWELL 1983,1990,1993 ; PEARSO etal 1985 ; MAGAREY and WACHTEL 1986 ; PRICE etal 1993 ; WOLF etal 1994 ; DAMS et al 1998) Syptos characteristic of grapevine yellows include yellowing of leaves, fruit abortion, and lack of lignification of canes (CAUDWELL 1983, 1990 ; MAGAREY and WACHTEL 1986 ; WOLF et al 1994) The syptos of grapevine yellows are very siilar in Europe, Israel, Australia, and orth Aerica (UYEMOTO 1976 ; CAUDWELL 1983 ; PEARSO et al 1985 ; MAGAREY and WACHTEL 1986 ; WOLF etal 1994 ; DAMS etal 1997 a, b), but the phytoplasas associated with the diseases can be very different In Europe, the grapevine yellows disease known as flavescence doree is attributed to a phytoplasa belonging to 16S rra group 16SrV (el yellows and related phytoplasas) (DAiRE et al 1993 ; DAMS and PRICE 1993 ; PRICE et al 1993 ; BIACO et al 1996) that is transitted by Scaphoideus titanus (CAUDWELL 1983) Bois noir disease and the evidently equivalent grapevine yellows in southern Italy, Greece, Israel, and elsewhere in the Mediterranean region, are attributed to group 16SrXII, subgroup A (stolbur phytoplasa) (CAUDWELL 1993 ; DAIRE et al 1993 ; SEEMULLER et al 1994; DAMS et al 1997 b, 1998) transitted by Hyalesthes obsoletus (MAIXER et al 1995) Australian grapevine yellows is attributed to,candidatus Phytoplasa australiense", the type eber of subgroup Bin group 16SrXII (DAvis et al 1997 a) In orth Aerica, grapevine yellows was first reported in ew York in 1977 (UYEMOTO et al 1976) CAUDWELL (1983) proposed that both flavescence doree phytoplasa and its only known insect vector (S titanus) had been introduced into Europe fro orth Aerica Work by PEARSO et al (1985) drew further attention to the siilarity between grapevine yellows disease in ew York and flavescence doree in France In a separate study of grapevine yellows in ew York, MAIXER et al (1993) concluded that their data "support the hypothesis ofa coon orth Aerican origin of flavescence doree and its vector, S titanus" While these studies reiterated the hypothesis that the flavescence doree pathogen was introduced into Europe fro orth Aerica, they did not report the identification and classification of the phytoplasa associated with grapevine yellows in ew York In Virginia, grapevine yellows disease has beenobserved since 1987 in cvs Chardonnay and Riesling growing in the Virginia Piedont area (WOLF et al 1994 ; this paper) Al though the spread of the disease within vineyards appears to be relatively slow, diseased vines do not recover and often die within several years ofsypto onset (WOLF et al 1994) PRICE et al (1993) detected the association of two different phytoplasas with grapevine yellows in Virginia and identified the phytoplasas as ebers of 16S rra groups 16SrI (aster yellows and related phytoplasas, including stolbur, sensu LEE et al 1993 and VIM et al 1996) and 16SrIII (peach X-disease and related phytoplasas), respectively However, the identification of the phytoplasas to a 16S rra subgroup level was not reported The present study was initiated to deterine the subgroup affiliations ofvirginia grapevine yellows-associated phytoplasas Knowledge ofsubgroup affiliation is signifi- Correspondence to :R E DAvis, Molecular Plant Pathology Laboratory, Agricultural Research Service-USDA, Roo 252, Bldg 011A, BARC West, Beltsville, MD 20705, USA Fax : E-ail : rdavis@asrrarsusda go v

2 132 R E DAVIS, RASA JOMATIEE, ELLE L DALLY, and T KWOLF cant in order to facilitate the future identification of their insect vectors and alternate plant hosts With this intention, we collected saples fro diseased grapevine (Vitis vinifera L ) plants in 5 coercial vineyards in Virginia during a 3-year study, fro 1994 through 1996 As in the previous study (PRICE et al 1993), the data did not indicate the presence of any European grapevine yellows phytoplasa in Virginia The results indicated infection ofcultivated grapevine and of wild grapevine (V riparia Michx ) by a phytoplasa belonging to group 16SrI, subgroup A (toato big bud and related phytoplasas) The group 16SrlII Virginia grapevine yellows phytoplasa was deterined to represent a new subgroup, designated subgroup 1, in group 16SrIIL A preliinary report ofthese findings has been published (DAvis et al 1998) Materials and ethods Plant saples and reference phytop 1 a s a s t r a i n s : During 1994, 1995, and 1996, saples of leaves were collected fro naturally diseased cvs Chardonnay, Cabernet franc, and Riesling grapevine (V vinifera L ) plants exhibiting syptos ofgrapevine yellows in 5 coercial vineyards located in the Virginia Piedont area Leafsaples were also collected fro plants of wild grapevine (V riparia Michx ) growing in the vicinity of vineyards containing diseased V vinifera and fro healthy seedlings of V vinifera grown in an insect proof greenhouse The reference phytoplasas used as controls in this study were aintained by graft transission in plants ofperiwinkle (Catharanthus roseus [L ] GDon) aintained in a greenhouse ; they are listed in the Table Prier pairs and conditions for polyerase chain react ion (PCR) : ucleicacidfor use as teplate in PCR was extracted fro fresh tissue by a previously described ethod (PRICE et al 1993) After extraction, DA was purified using GeneCleanIII kit as specified by the anufacturer (Bio 101, Vista, CA) Seven pairs of oligonucleotide priers were used in PCRsRI6F2/RI6RI and RI6F2n/R16R2arephytoplasa universal prier pairs (GUDERSE and LEE 1996) Prier pairs R16(I)F1/R16(1)R1, R16(II1)F2/R16(II1)R1, and R16(V)F1/R16(V)RI prie specific aplification of16s rda fro phytoplasas belonging to groups (sensu LEE et al 1993)16SrI,16SrIII, and 16SrV, respectively (LEE etal 1994 a) Prier pair rpf 1 /R 1 pries aplificaton ofphytoplasa ribosoal protein (rp) gene operon sequences (LIM and SEARS 1992 ; GUDERSE et al 1994) Prier pair rp(iii)f 1/rp(III)R 1 pries aplification ofrp gene operon sequences fro group 16SrIII phytoplasa strains (this paper) Both, a single (direct, non-nested) PCR and nested PCR were used In one nested PCR protocol, DA aplified in PCR pried by R16F2/RI6R1 was diluted 1 :50 with sterile distilled water and used as teplate in PCR pried by R16F2n/Rl6R2 In a separate nested PCR protocol, DA aplified in PCR pried by R16F2n/R16R2 was diluted 1 :50 with sterile distilled water and used asteplate in PCR pried by R16(I)FI/Rl6(I)RI, R16(III)F2/R16(III)R1, or Reference phytoplasas used in this study and their 16S rra group and subgroup classifications') Phytoplasa strain Maryland aster yellows (AY1) Peanut witches'-broo Table Western X-disease (WX) Canada peach X-disease (CX) Cloveryellow edge (CYE) Vacciniu witches'-broo Pecan bunch (PB) Goldenrod yellows (GR 1) Spirea stunt (SP 1) Milkweed yellows (MW 1) Walnut witches'-broo(wwb) Poinsettia branch-inducing (PoiBI) Coconut lethal yellows (LY3) El yellows (EY 1) Cloverproliferation (CP) Ash yellows (AshY) Pigeon pea witches'-broo (PPWB) Apple proliferation (AP) Rice yellow dwarf(ryd) Stolbur (STOL) Australian grapevine yellows (AUSGY) (Candidatus Phytoplasa australiense) Mexican periwinkle virescence (MPV) 'I Classifications according to LEE et al S rra group-subgroup 1-B 11-A 111-A 111-A III-B III-B Ill-C III-D III-E III-F III-G III-H IV-A V-A VI-A VII-A IX-A X-A XI-A XII-A XII-B XIII-A R16(V)F1/R16(V)R1 Prier pairs rpfl/r1 and rp(iii)f 1 /rp(iii)ri were used indirect, non-nested PCR only All PCR was carried out as previously described (JOMATIEE etal 1998) Restriction fragent length polyorphis (RFLP) analyses of PCR-aplif i e d DA : Products fro nested PCR pried by R16F2n/R 16R2 were analyzed by single enzye digestion, according to anufacturers' instructions, with Aci I, Ba HI, Bfa I, Dde I, Dra I, Eco R2, Hae 111, Hha I, HinfI, Hpa 1, Hpa II, Kpn 1, Mse 1, Msp I, Rsa I, Sau 3AI, Taq I, and Tha I (ew England Biolabs, Beverly, Mass ) and Alu I (Life Technologies Inc, Gaithersburg, MD) The digested DAs were analyzed by electrophoresis of the digestion products in a 5 % polyacrylaide gel, followed by staining with ethidiu broide and visualization ofda bands with a UV transilluinator The RFLP patterns ofvirginia grapevine yellows phytoplasa DAs were copared with the RFLP patterns obtained using reference phytoplasas in this study and the RFLP patterns previously published (LEE et al 1993 ; PRICE et al 1993 ;VIMetal 1996 ; DAvis etal 1997 a, b ; LEE

3 Phytoplasas associated with grapevine yellows et al 1998) Phytoplasas detected in this work were assigned to 16S rra gene groups and subgroups as previously described by LEE et al (1993, 1998) ucleotide sequencing, sequence alignent, and putative restriction site a n a l y s i s : PCR-aplified 16S rra gene and rp gene operon products were coercially sequenced using standard procedures The nucleotide sequence deterined for phytoplasa VGYIII rda was deposited in the GenBank database (GenBank, ational Center for Biotechnology Inforation, ational Library ofmedicine, ational Institutes of Health, Bethesda, Maryland) Other sequences used in this study were obtained fro GenBank A partial sequence ofclover yellow edge (CYE) phytoplasa 16S rda (Accession no L33766) was obtained fro GenBank In the present work, we aplified and sequenced 16S rda fro clover yellow edge phytoplasa in order to verify the GenBank 16S rda sequence fro clover yellow edge phytoplasa and to coplete nucleotide sequencing of 42 bases issing fro GenBank Accession no L S rra gene sequences fro Virginia grapevine yellows phytoplasa VGYIII and fro other group l6sriii phytoplasas were analyzed to identify recognition sequences for selected restriction enzyes Putative restriction site aps were generated by using the DASTAR progra MapDraw option (DASTAR Inc, Madison, Wisc ) Alignents ofsequences were generated and sequence siilarities evaluated by using the DASTAR progra Megalign option 4~~~oxxs ==v`~h STBTBTBTBTBTBTBTBS STBTBTBTBS Fig 1 : Restriction fragent length polyorphis (RFLP) analysis of 16S rda aplified in nested PCRs pried by oligonucleotide pair RI 6F2n/Rl6R2 (F2n/R2) fro Virginia grapevine yellows phytoplasa strain VGYI (B) and toato big bud (T) phytoplasa DA products fro nested PCR were digested with restriction endonucleases Mse 1, Alu I, Kpn I, Rsa 1, Bfa 1, Hpa 1, Hpa 11, Hae 111, Hha 1, HinfI, Sau 3A1, and Taq 1 S, contained PhiX 174 Hae Ill digest size standard Hpal Ddel SXWSPVXWSPVS a 133 Results Detection and classification of phytoplasas in diseased cultivated grapevines and in wild grapevine (Vriparia) : Phytoplasas belonging to two groups, 16SrI and 16SrIII, were detected in grapevine yellows-diseased V vinifera in Virginia on the basis ofphytoplasa-specific DA aplification in PCR (data not shown) These results confired earlier findings by PRICE et al (1993) Preliinary RFLP analysis ofaplified 16S rda indicated that the group 16SrI phytoplasa was siilar to both subgroup I-A and subgroup I-B phytoplasas ; further analysis by digestion ofaplified DA using Hha Irevealed that this phytoplasa was ost closely related to subgroup A (type strain, toato big bud [BB] phytoplasa) RFLP analysis using 12 different restriction enzyes did not distinguish the group 16SrI phytoplasa, designated VGYI, fro BB phytoplasa (Fig 1) Parallel investigation ofwild grapevine (V riparia) plants growing close to infected coercial vineyards indicated that wild grapevine was also infected by a group 16Srl phytoplasa RFLP analysis distinguished the phytoplasa strains in wild grapevine as ebers of subgroup I-A (data not shown) Classification ofthe group 16SrIII phytoplasa strains in diseased, cultivated grapevines was accoplished using 19 restriction enzyes for RFLP analysis ofpcr-aplified 16S rda All strains yielded the sae RFLP patterns (data Fig 2 : Dde I and Hpa I RFLP profiles ofphytoplasa 16S rda aplified in nested PCRs pried by oligonucleotide pair F2n/R2 fro Canada peach X-disease (X), walnut witches'-broo (W), spirea stunt (S), poinsettia branch-inducing strain PoinB 1 (P), and Virginia grapevine yellows strain VGYIII (V) phytoplasas S, PhiX174 Hae III digest size standard not shown) Of the 8 subgroups previously described in group 16SrIII (LEE et al 1998), the group l6sriii Virginia grapevine yellows phytoplasa was ost closely related to Canada peach X-disease (subgroup III-A), walnut witches'- broo (subgroup III-G), spirea stunt (subgroup III-E), and poinsettia branch-inducing (subgroup III-H) phytoplasas The VGYIII phytoplasa could be distinguished fro poinsettia branch-inducing phytoplasa by digestion of PCR products with Hpa I or with Dde I (Fig 2) VGYIII phytoplasa could be distinguished fro Canada peach X-disease phytoplasa by digestion of PCR products with Mse I (Fig 3), fro walnut witches'-broo phytoplasa by Rsa I and fro spirea stunt phytoplasa by Dde I (Fig 2) and Hha I (Fig 3) RFLP patterns ofwalnut witches'-broo and spirea stunt phytoplasa DAs were unusual in the presence of extra" DA bands ; that is, the total of fragent sizes was considerably larger than that expected for the approx 1 2 kbp PCR product We explain these results as

4 134 R E DAVIS, RASA JOMATIEE, ELLE L DALLY, and T K WOLF sxwsvxwsvxwsvxwsv Fig 3 : Mse I, Hpa II, Rsa I, and Hha I RFLP profiles of phytoplasa 16S rda aplified in nested PCRs pried by oligonucleotide pair F2n/R2 fro Canada peach X-disease, walnut witches'-broo, spirea stunt, and Virginia grapevine yellows VGYIII phytoplasas Abbreviations see Fig 2 coposite patterns of 16S rda aplified fro two rra operons, exhibiting interoperon sequence heterogeneity, in both walnut witches'-broo and spirea stunt phytoplasas We did not obtain RFLP evidence of two rra operons of different sequence in VGYIII, Canada peach X-disease, or poinsettia branch-inducing phytoplasas Since the collective RFLP patterns of 16S rda fro Virginia grapevine yellows phytoplasa VGYIII were unique, this phytoplasa was assigned to a new 16S rra subgroup, designated I, in group 16SrIII In order to confir the presence of group 16SrIII phytoplasas in soe grapevine plants, an oligonucleotide pair was designed to prie PCR-ediated aplification of ribosoal protein gene operon sequences fro group l6sriii phytoplasas The priers have the following designations and sequences : rp(iii)f1, 5"-CTATTGCAAATCAG ATGTCTG-3" and rp(iii)r1, 5"-AATAAACGAGTTAAA CGAAGACC-3" Conditions of PCR using these priers were the sae as those described previously (JOMATIEE et al 1998 ) A group 16SrIII-specific DA fragent of 244 by was aplified in direct (non-nested) PCR fro teplate DAs derived fro all group 16SrIII phytoplasas in this study, including the VGYIII Virginia grapevine yellows phytoplasa o group III-specific DA aplification was observed when teplate DAs were derived fro the reaining phytoplasas listed in the Table RFLP analysis of aplified rp gene operon sequences using Alu I and Mse I did not distinguish VGYIII fro those of Canada peach X- disease, walnut witches'-broo, or spirea stunt phytoplasas (data not shown) The aplified 244 by fragents ofthe ribosoal protein gene operons fro VGYIII and SP 1 phytoplasas were sequenced, and the sequences were aligned with those fro group l 6SrIII phytoplasas associated with Canada peach X-disease, western X-disease, and clover yellow edge (Fig 4) The VGYIII rp gene operon sequence was identical to that of Canada peach X-disease phytoplasa and was differentiated fro those of spirea stunt, western X-disease, and clover yellow edge phytoplasas by base substititions in fro one to three positions ucleotide sequence and putative restriction sites in a 16S rra gene sequence fro Virginia grapevine yellows p h y t o p l a s a VGYIII : The nucleotide sequence deterined for the 16S rda aplified fro VGYIII phytoplasa in PCR pried by F2n/R2 was deposited in the GenBank database as Accession nuber AF The nucleotide sequence of 16S rda fro VGYIII phytoplasa was copared with the corresponding sequences fro western X-disease phytoplasa (Accession no L04682), clover VGYIII AAGCAATPPTGATGTI'TACTCCAAAAGCAGCATCTCCAATCGTPICAAAGCTrITSP1 rp(iii)f1 VGYIII ATTGCAAATCAGATGTC TCCTAGAAAAACACGTTTAGTAGCGGATTTSP' AATCCGTGGCAAACATGTCAGAGAAGCAC 84 TTGCAAATCAGATGTC TCCTACGAAAACACGTTTAGTAGCCGATrrCX- AATCCGTGGCAAACATGTCAGAGAAGCGC 84 L CTATPGCAAATCAGATGTC TCCTAGAAAAACACGTI'TAGTAGCGGATrrWX-L27047 AATCCGTGGCAAACATGTCAGAGAAGCAC 84 CTATTGCAAATCAGATGTC TCCTAGAAAAACACGTTTAGTAGCGGATTTCYE-L27019 AATCCGTGGCAAACACGTCAGAGAAGCAC 84 CTATTGCAAATCAGAGTC GCTCCTAGAAAAACACGTTTAGTAGCGGATV GATCCGTGGCAAACACGTTAGAGAAGCGC 84 AAGCAATTPTGATGTTTACTCCAAAAGCAGCATCTCCAATCGTTrCAAAGCTrTrCX-L27016 AAGCAATPTiGATGTT'I'ACTCCAAAAGCAGCATCTCCAATCGTPICAAAGCTTPrW X- L AAGCAA'I'71TGATG=ACTCCAAAAGCAGCATCACCAATCGT 7CAAAGCTTTrCYE-L27019 AAGCAATITrGAM='ACTCCAAAAGCAGCATCTCCAATCGTTTCAAAGCTTT VGYIII AT=AGCCTTAAAGAAGAAGAATTATACGTGAAAGAAATP=TTAA' SP1 ATTI'TAGCCTrAAAGAAGAAGAATTATACGTGAAAGAAATITPMTTAA' CX-L27016 ATPP`TAGCCTrAAAGAAGAAGAATTATACGTGAAAGAAATPPPIrTTAA' WX-L27047 ATPPTAGCCTTAAAGAAGAAGAATrATACGIGAAAGAAATTTPTGTTAA' CYE-L27019 ATTTTAGCCTTAAAGAAGAAGAATTATACGTTAAAGAAATTTTIGTTAA' AAAAAGTGCTGTTGCCAACGCTGTTCATA 168 AAAAAGTGCTGTTGCCAACGCTGTTCATA 168 AAAAAGTGCTGTTGCCAACGCTGTTCATA 168 AAAAAGTGCTGTTGCCAA000TGTTCATA 168 AAAAAGTGCTGTTGCCAACGCTGTI'CATA 168 TCTTCGTTTAACTCGTTTA 244 TCTTCGTTTAACTCGT 244 TCTTCGTTTAACTCGTTTATT 244 TCTTCGTTTAACTCG=ATr 244 TCTTCGTTTAACTCGTTTATr 244 yellow edge phytoplasa (Accession no L33766), and Vacciniu witches'-broo phytoplasa (Accession no X76430) Results fro coparative analyses ofputative restriction sites in the sequenced DA are shown in Fig 5 Expected fragent sizes based on analysis of putative rerp(iii)r1 Fig 4 : Alignent of ribosoal protein (rp) gene operon sequences aplified in direct (non-nested) polyerase chain reactions (PCRs) pried by group 16SrI1I-specific oligonucleotide pair rp(iii)fl/rp(11l)r1 in PCRs containing teplate DA derived fro Virginia grapevine yellows phytoplasa VGYIII (VGY111), or fro spirea stunt (SP I), Canada peach X-disease (CX) (GenBank Accession no L27016), western X-disease (WX) (GenBank Accession no L27047), or clover yellow edge (CYE) (GenBank Accession no L27019) phytoplasas Boxes indicate positions of rp(iii)f 1 and rp(iii)r 1

5 Phytoplasas associated with grapevine yellows 135 C 2 ' 2 ~ ~ 7 2 a Virginia grapevine yellows VGYIII 200 by 400 by 600 by 800 by 1000 by 1200 by Clover yellow edge 1 _7 p p p p, = by 400 by 600 by 800 by 1000 by 1200 by Vaccinlu witches'-broo 7 p D = by 400 by 600 by 800 by 1000 by 1200 by Fig 5 : Analysis of putative restriction sites of phytoplasa 16S rra gene sequences Maps were generated by using the MapDraw option ofthe DASTAR progra (DASTAR Inc, Madison, Wis ) and wereanually aligned for coparison ofrecognition sites for restriction endonucleases Alu I, Dde I, Hha 1, Hpa I, Hpa 11, Mse I, and Rsa 1 Virginia grapevine yellows phytoplasa VGYIII (GenBank Accession no AF060875), Western X-disease phytoplasa (GenBank Accession no L04682), Clover yellow edge phytoplasa (GenBank Accession no L33766), Vacciniu witches'-broo phytoplasa (GenBank Accession no X76430) striction sites were in excellent agreeent with fragent sizes obtained by enzyic RFLP analysis ofaplified 16S rda Sequences fro Western X-disease and clover yellow edge phytoplasas, representatives of subgroups 16SrIII-A and 16SrI11-B, respectively, and of Vacciniu witches'-broo phytoplasa, a eber ofsubgroup 16SrIII-B, were distinguished fro Virginiagrapevine yellows phytoplasa VGYIII by the restriction site analysis Discussion The use of olecular criteria, particularly the analysis of conserved gene sequences, has peritted the developent of a coprehensive phytoplasa classification sys te (LEE et al 1993, 1998 ; GUDERSE etal 1994; SEEMOLLER et al 1994) and an eerging phytoplasa taxonoy The recognition of 16S rra gene groups and soe subgroups as distinct species is giving rise to the designation of Candidatus Phytoplasa species" Thus far, two have beennaed, Candidatus Phytoplasa aurantifolia" (ZREIK et al 1995) and Candidatus Phytoplasa australiense" (DAvis et al 1997 a) Most phytoplasas have not yet been naed as Candidatus species", and group and subgroup designations continue to be highly useful in the current olecular systeatics In particular, subgroup classification ofthe phytoplasa strains infecting Vitis species ay have significance for understanding the epideiology of grapevine yellows This counication reports detection, identification, and classification of subgroup 16Srl-A and 16Sr1l1- I phytoplasas infecting diseased grapevine plants in Virginia Subgroup 16Srl-A has been previously described (Lee et al 1993) Subgroup 16SrlI1-I (111-I) is a newly described subgroup either of these subgroups has been previously deterined to infect Vitis species Our classification ofthe group 16Srl Virginia grapevine yellows phytoplasa in subgroup I-A expands the known plant host range of ebers of this subgroup and sheds new light on grapevine yellows in orth Aerica While soe phytoplasa strains infecting cultivated grapevine (V vinifera) and wild grapevine (Vitis sp ) plants in Virginia were previously identified as ebers ofgroup 16SrI, their

6 136 R E DAMS, RASA IOMATIEE, ELLE L DALLY, and T K WOLF subgroup affiliation was not reported (PRICE et al 1993, 1994) Subgroup 16Srl-A (toato big bud [BB] and related phytoplasas) is known only in orth Aerica and is distinct fro subgroup 16SrI-B (aster yellows and related phytoplasas) (LEE etal 1993) While subgroup l6sri-b is known in orth Aerica, it has not been reported in Fitis spp in orth Aerica, although it has been reported in V vinifera in Europe (ALMA et al 1996) The present counication reports the first work to docuent that both cultivated and wild grapevine plants are infected by subgroup 16Srl-A strains Distinction of the group 16SrI Virginia grapevine yellows phytoplasa at 16S rra subgroup level distinguishes this phytoplasa fro others known to infect Vitis species and provides new data that should aid the search for insect vectors and alternate plant hosts that play a role in its spread in Virginia Subgroup l6sri-a has a wide plant host range, including wild species native to Virginia and the surrounding region Subgroup 16Srl-A (I-A) phytoplasal infections of wild grapevine, gray dogwood (Cornus raceosa La ), fleabane (Erigeron canadensis L ), goldenrod (Solidago spp ), and other plants (LEE et al 1993, 1994 a, b ; GRIFFITHS et al 1994 ; this paper) point to several possible sources of subgroup I-A phytoplasa strains that ay be transitted to cultivated grapevines While group 16SrIII phytoplasa strains have been reported in V vinifera and V riparia in Virginia (PRICE et al 1993, 1994), subgroup affiliation of such strains has not pre viously been reported Although other natural plant hosts of group 16SrIII phytoplasas are known in the region of eastern orth Aerica including Virginia (LEE et al 1993 ; GUDERSE et al 1996), no plant host other than V vinifera (this paper) has been shown to harbor phytoplasa strains belonging to subgroup III-I Other work has also indicated V riparia as an alternate plant host of phytoplasas that ay infect cultivated V vinifera CHE et al (1993) detected a phytoplasa in V riparia growing near yellows-diseased cultivated grapevines in ew York On the basis ofserological reactions and dot blot hybridizations, they found that this phytoplasa was related to an unidentified grapevine yellows phytoplasa fro northern Italy Based on available data, it is not known whether the phytoplasa reported by CHE et al (1993) in V riparia in ew York is related to either of the phytoplasas in Vitis species in Virginia (this paper) MAIXER et al (1993) reported that S titanus collected fro V riparia and V vinifera in ew York contained an antigen that was serologically related to flavescence dor6e phytoplasa on the basis of results fro enzye-linked iunosorbent assay (ELISA) and iunosorbent electron icroscopy using polyclonal antiseru Plants of Viciafaba L, but not plants of V vinifera, that had been fed upon by such insects developed syptos typical of infection by a phytoplasa Although MAIXER et al (1993) did not identify the phytoplasa antigen presuably acquired by S titanus fro V riparia and V vinifera, their work also points to wild V riparia as a possible source of phytoplasa(s) that ay infect cultivated grapevine In addressing the question of possible relationships between grapevine yellows in orth Aerica and grapevine yellows diseases in other parts of the world, it is iportant to note that neither ofthe grapevine-infecting phytoplasas in Virginia has been reported outside oforth Aerica Conversely, no phytoplasa associated with flavescence dor6e disease or bois noir disease in Europe, or with Australian grapevine yellows disease, has been reported in orth Aerica Although S titanus in ew York was reported to carry a phytoplasa serologically related to the flavescence dor6e phytoplasa in France, the published data (MAIXER et al 1993) do not ake it possible to identify the phytoplasa or to classify it in any 16S rra group While the available data do not refute the hypothesis of a orth Aerican origin offlavescence dor6e phytoplasa as originally proposed by CAUDWELL (1983), there is no evi dence that this phytoplasa, which is a eber of group 16SrV (el yellows and related phytoplasas, sensu LEE et al 1993 ; PRICE et al 1993), occurs anywhere in orth Aerica To date, subgroup 16SrV-A (V-A) is the only subgroup of group 16SrV thus far reported in orth Aerica, although differences in ribosoal and nonribosoal DA have been noted aong group V strains (GRIFFITHS et al 1993) By contrast, subgroups V-A (el yellows), V-C (Rubus stunt), and V-D (flavescence doree) phytoplasas have been reported in Europe (PRICE et al 1993 ; BIACO et al 1996 ; GUDERSE and LEE 1996), and subgroup V-B (cherry lethal yellows and related phytoplasas) has been reported in China (LEE et al 1995) We suggest that the known lethality of el yellows phytoplasa for Aerican el (Ulus aericana L ; SICLAIR 1981) favors the hypothesis that, although variants of the phytoplasa ay have arisen on this continent, el yellows phytoplasa and its Aerican el host did not co-evolve and that an el yellows phytoplasa was introduced into the orth Aerican el ecosyste It is feasible that other group 16SrV phytoplasas also originated in geographical regions outside the range ofthe native orth Aerican el, U aericana In view ofthe apparent diversity ofgroup 16SrV phytoplasas on the European and Asian continents, it is possible that the epicenter of group 16SrV phytoplasa evolution is in Europe or Asia These hypotheses and the available data ake it reasonable to seek the origin of group 16SrV phytoplasas, including flavescence dor6e phytoplasa, outside oforth Aerica Acknowledgeents This work was supported by grant no US fro BARD, the United States-Israel Binational Research and Developent Fund References ALMA, A ; DAVIs, R E ; VIBIO, M ; DAIELLI, A ; Bosco, D ; BERTACCII, A ; 1996 : Mixed infection of grapevines in northern Italy by phytoplasas including 16S rra RFLP subgroup 16Srl-B strains previously unreported in this host Plant Dis 80, BIACO, P A ; DAvis, R E ; CASATI, P ; FORTUSII, A ; 1996 : Prevalence of aster yellows (AY) and el yellows (EY) group phytoplasas in syptoatic grapevines in three areas of northern Italy Vitis 35,

7 Phytoplasas associated with grapevine yellows 137 CAUDWELL, A ; 1983 : L'origine des jaunisses a ycoplases (MLO) des plantes et I'exeple des jaunisses de la vigne Agronoie 3, ; 1990 : Epideiology and characterization of Flavescence doree (FD) and other grapevine yellows Agronoie 10, ; 1993 : Advances in grapevine research since lth Meet Council Study of Viruses and Virus Dis Grapevine, 79-83, 6-9 Septeber 1993 Montreux, Switzerland CHE, K H ; Guo, J R ; Wu, X Y ; Loi, ; CARRARO, L ; Guo, Y H ; CHE, Y D ; OSLER, R, PEARSO, R ; CHE, T A ; 1993 : Coparison of onoclonal antibodies, DA probes, and PCR for detec tion of the grapevine yellows disease agent Phytopathology 83, DAIRE, X ; CLARR, D ; LARRUE, J ; BOUDO-PADIEU, E ; CAUDWELL, A ; 1993 : Diversity aong ycoplasa-like organiss inducing grapevine yellows in France Vitis 32, DAMS, R E ; DALLY, E L ; GUDERSE, D E ; LEE, 1 M ; HABILI, ; 1997 a : Candidatus Phytoplasa australiense", a new phytoplasa taxon associated with Australian grapevine yellows Intern J Syste Bacteriol 47, , - - ; TAE, E ; RuMBOS, I C ; 1997 b : Phytoplasas associated with grapevine yellows in Israel and Greece belong to the stolbur phytoplasa subgroup, 16SrXII-A J Plant Pathol 79, ; JOMATIEE, R ; DALLY, E L ; WOLF, T K ; 1998 : Grapevine yellows in Virginia : Phytoplasa subgroups III-I and I-A in cultivated grapevines and subgroup I-A in wild grapevines Phytopathology (in press) - - ; PRICE, J P ; 1993 : Grapevine yellows diseases : Diverse etiologies indicated by new DA-based ethods for pathogen detection and identification-iplications for epideiology 11th ICVG Meeting, Ort?? GRIFFITHS, H M ; SICLAIR, WA ; DAMS, R E ; LEE, l M ; DALLY, E L ; Guo, Y H ; CHE, T A ; HIBBE, C R ; 1994: Characterization of ycoplasalike organiss fro Fraxinus, Syringa, and associ ated plants fro geographically diverse sites Phytopathology 84, , - - ; LEE, I M ; BOUDO-PADIEU, E ; DAIRE, X ; SMART, C ; 1993 : Iplications of differences between el-inhabiting phytoplasas and others in 16S RA group V Europ J Forest Pathol 28, , - -, - - ; DAvis, R E ; 1994 : Characterization of ycoplasalike organiss detected in plants in the vicinity of natural outbreaks of ash yellows and el yellows in orth Aerica IOM Letters 3, GUDERSE, D E ; LEE, I M ; 1996 : Ultrasensitive detection of phytoplasas by nested-pcr assays using two universal prier pairs Phytopathol Medit 35, , - - ; REFIER, S A ; DAvis, R E ; KIGSBURY, D T ; 1994 : Phylogeny of ycoplasalike organiss (phytoplasas) : A basis for their classification J Bacteriol 176, , - - ; SCHAFF, D A ; HARRISO, A ; CHAG, C J ; DAMS, R E ; KIGSBURY, D T ; 1996 : Genoic diversity and differentiation aong phytoplasa strains in 16S rra groups I (aster yellows and related phytoplasas) and III (X-disease and related phytoplasas) Intern J Syste Bacteriol 46, JOMATIEE, R ; DAMS, R E ; MAAS, J ; DALLY, E L ; 1998 : Classification of new phytoplasas associated with diseases of strawberry in Florida, based on analysis of 16S rra and ribosoal protein gene operon sequences Intern J Syst Bacteriol 48, LEE, I M ; GUDERSE-RIDAL, D E ; DAMS, R E ; BARTOSZYK, I M ; 1998 : Revised classification schee of phytoplasas based on RFLP analyses of 16S rra and ribosoal protein gene sequences Intern J Syste Bacteriol (in press) - - ; GUDERSE, D E ; HAMMOD, R W ; DAvis, R E ; 1994 a : Use of ycoplasalike organis (MLO) group-specific oligonucleotide priers for nested-pcr assays to detect ixed-mlo infections in a single host plant Phytopathology 84, , - - ; HAMMOD, R W ; DAMS, R E ; BERTACCII, A ; VIBIO, M ; 1994 b : ested-pcr assays detect ixed-mlo infections in a single host plant IOM Letters 3, ; HAMMOD, R W ; DAMS, R E ; GUDERSE, D E ; 1993 : Universal aplification and analysis of pathogen 16S rda for classification and identification of ycoplasalike organiss Phytopathology 83, ; ZHU, S ; GUDERSE, D E ; ZHAG, C ; HADIDI, A ; 1995 : Detection and identification of a new phytoplasa associated with cherry lethal yellows in China Phytopathology 85, 1179 LIM, P O ; SEARS, B B ; 1992 : Evolutionary relationships of a plant pathogenic ycoplasalike organis and Acholeplasa laidlawii deduced fro two ribosoal protein gene sequences J Bacteriol 174, MAGAREY, P A ; WACHTEL, M F ; 1986 : Australian grapevine yellows Intern J Trop Plan t Dis 4, 1-14 MAIXER, M ; AHRES, U ; SEEMULLER, E ; 1995 : Detection of the Geran grapevine yellows (Vergilbungskrankheit) MLO in grapevine, alternative hosts and a vector by a specific PCR procedure Europ J Plant Pathol 101, ; PEARSO, R C ; BOUDO-PADIEU, E ; CAUDWELL, A ; 1993 : SCaphoideus titanus, a possible vector of grapevine yellows in ew York Plant Dis 77, ; RUDEL, M ; DAIRE, X ; BOUDO-PADIEU, E ; 1995 : Diversity of grapevine yellows in Gerany Vitis 34, PEARSO, R C ; POOL, R M ; GOSALVES, D ; GOFFIET, M C ; 1985 : Occurrence of flavescence doree-like syptos on `White Riesling' grapevines in ew York, U S A Phytopathol Medit 24, PRICE, J P ; DAMS, R E ; WOLF, T K ; LEE, 1 M ; DALLY, E L ; 1994 : Genoic diversity and possible wild plant sources of ycoplasalike organiss (MLOs) infecting grapevines : Iplications for epideiology IOM Letters 3, , , - - ; MOGE, B D ; DALLY, E L ; BERTACCII, A ; CREDI, R ; BARBA, M ; 1993 : Molecular detection of diverse ycoplasalike organiss (MLOs) associated with grapevine yellows and their classification with aster yellows, X-disease, and el yellows MLOs Phytopathology 83, SEEMULLER, E ; SCHEIDER, B ; MAURER, R ; AHRES, U ; DAIRE, X ; KISO, H ; LOREZ, KH ; FIRRAO, G ; AVIET, L ; SEARS, B B ; STACKEBRADT, E ; 1994 : Phylogenetic classification of phytopathogenic ollicutes by sequence analysis of 16S ribosoal DA Intern J Syste Bacteriol 44, SICLAIR, W A ; 1981 : El yellows In : STIPES, R J ; CAMPAA, R J (Eds ) : Copendiu of El Diseases, Aerican Phytopathological Society, St Paul, M, USA TAE, E ; ORESTEI, S ; 1997 : Identification and typing of grapevine phytoplasa aplified by graft transission to periwinkle Vitis 36, UYEMO'IO, J K ; 1976 : A new disease affecting the grapevine variety de Chaunac Proc Aer Phytopathol Soc 1, 146 VIBIO, M ; BERTACCII, A ; LEE, 1 M ; DAvis, R E ; CLARK, M F ; 1996 : Differentiation and classification of aster yellows and related European phytoplasas Phytopathol Medit 35, WOLF, T K ; PRICE, J P ; DAvis, R E ; 1994 : Occurrence of grapevine yellows in Virginia vineyards Plant Dis 78, 208 ZREIK, L ; CARLE, P ; BovE, J M ; GARIER, M ; 1995 : Characterization of the ycoplasalike organis associated with witches'-broo disease of lie and proposition of a Candidatus taxon for the organis, Candidatus Phytoplasa aurantifolia " Intern J Syste Bacteriol 45, Received May 29, 1998