on July 19, 2018 by guest

Transcription

1 IAI Accepts, published online ahead of print on December 00 Infect. Immun. doi:0./iai.00-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. QseC mediates Salmonella enterica serovar Typhimurium virulence in vitro and in vivo. 0 0 Cristiano G. Moreira, David Weinshenker, and Vanessa Sperandio * Departments of Microbiology and Biochemistry, The University of Texas Southwestern Medical Center, Dallas, Texas 0, USA. Department of Pharmacology, Emory University School of Medicine, Atlanta, Georgia. Classification: Biological Sciences, Microbiology * Correspondence should be sent to: Vanessa Sperandio, Ph.D. University of Texas Southwestern Medical Center, Dept. of Microbiology Harry Hines Blvd. Dallas, TX 0-0, USA Telephone: --0; Fax: vanessa.sperandio@utsouthwestern.edu For Express Mail: 000 Harry Hines Blvd. NA.0, Dallas, TX, USA Downloaded from on July, 0 by guest

2 0 0 The autoinducer- (AI-)/epinephrine (Epi)/norepinephrine (NE) inter-kingdom signaling system mediates chemical communication between bacteria and their mammalian hosts. These three signals are sensed by the QseC histidine sensor kinase (HK). Salmonella enterica serovar Typhimurium is a pathogen that uses HKs to sense its environment and regulate virulence. S. Typhimurium invades epithelial cells, and survives within macrophages. Invasion of epithelial cells is mediated by the type three secretion system (TSS) encoded within Salmonella pathogenicity island (SPI-), while macrophage survival and systemic disease are mediated by the TSS encoded in SPI-. Here we show that QseC plays an important role in S. Typhimurium pathogenicity. The qsec mutant was impaired in flagella motility, in invasion of epithelial cells, survival within macrophages, and is attenuated for systemic infection in x/svj mice. QseC acts globally, regulating expression of genes within SPI- and SPI- in vitro and in vivo (during infection of mice). Additionally, dopamine -hydroxylase knockout (Dbh -/-) mice that do not produce Epi or NE, showed different susceptibility to S. Typhimurium infection than WT mice. These data suggest that the AI-/Epi/NE signaling system is a key factor during S. Typhimurium pathogenesis in vitro and in vivo. Elucidation of the role of this inter-kingdom signaling in S. Typhimurium will contribute to a better understanding of the complex interplay between the pathogen and the host during infection. Downloaded from on July, 0 by guest

3 0 0 Prokaryotes and eukaryotes achieve cell-to-cell signaling utilizing chemical signals. These signaling systems allow intra and inter-species and intra and inter-kingdom communication (). The AI-/ Epi/ NE inter-kingdom signaling system bridges communication between bacteria and their mammalian hosts. AI- is produced by many bacterial species (0), and Epi and NE are host stress hormones (, ). This system was first described as activating virulence traits in enterohemorrhagic E. coli (EHEC) (, ). These signals are sensed by HKs, two of which have been identified: QseC, which senses AI-, Epi and NE (), and QseE, which senses Epi, sulfate and phosphate (). QseC is found in several bacteria, including S. Typhimurium, which causes human gastroenteritis. However, it causes systemic infection in murine models (, ). QseC s homolog in S. Typhimurium shares % sequence identity to EHEC s QseC (), and a S. Typhimurium qsec mutant can be complemented with the EHEC qsec gene, demonstrating that these HKs are functionally interchangeable (). QseC of S. Typhimurium is important for efficient swine colonization (). There are contradictory reports concerning the role of Epi/NE in QseC-mediated motility in S. Typhimurium (, 0), these variations can be accounted for by the labile nature of the Epi/NE signals in vitro () ( Transcriptome studies of S. Typhimurium also revealed a role for Epi and QseC in the antimicrobial peptide and oxidative stress resistance responses (0). QseC s response to its signals can be inhibited by the adrenergic antagonist phentolamine (), and the small molecule LED0. LED0 inhibits QseC in three different pathogens: EHEC, S. Typhimurium, and Francisella tularensis, preventing their pathogenesis in vitro and in vivo (). The second bacterial adrenergic HK, QseE, senses Epi, sulfate and phosphate to activate expression of virulence genes in EHEC. QseE together with QseG and QseF are implicated in Downloaded from on July, 0 by guest

4 0 0 pedestal formation directly related to EHEC pathogenesis (, ). A QseE homolog is also found in S. Typhimurium, and shares % sequence identity to EHEC s QseE. However, the role of QseE in S. Typhimurium pathogenesis remains unknown. The pathogenesis of S. Typhimurium is a complex process. The role of flagella motility in S. Typhimurium pathogenesis is controversial. It was reported to not play a role in Salmonella virulence in vivo (). However, flagella induces inflammation via Toll-like receptor during Salmonella infection of the intestinal mucosa (,, ). During its evolution, S. Typhimurium has acquired many pathogenicity islands (). The main islands involved in S. Typhimurium infection are Salmonella pathogenicity island (SPI)- and SPI-, both of which encode TSSs essential for S. Typhimurium virulence (-0,, ). The SPI- encoded TSS is required for efficient invasion of the intestinal epithelium (), while the SPI- encoded TSS is essential for S. Typhimurium replication and survival within macrophages, and systemic infection in mice (,, ). In Salmonella enterica serovar Typhi, the flagella sigma factor FliA regulates SPI- expression, and affects bacterial invasion of epithelial cells. However, this phenotype has not been observed in S. Typhimurium (). The SPI- locus encodes for effectors and regulators, such as HilA, HilD, HilC and InvF. SPI- contains operons: prg/org, inv/spa, and sic/sip. The prg/org and inv/spa operons encode for the needle complex, and the sic/sip operon encode the translocon that embeds itself into the host cell membrane. Additional effectors are encoded in other SPIs in the S.Typhimurium chromosome (0). HilD mediates transcriptional cross-talk between SPI- and SPI-, providing sequential activation of these loci. This mechanism allows S.Typhimurium to invade through the SPI- encoded TSS, and survive within the cellular vacuole using the SPI- encoded TSS (). InvF, encoded by the first gene of the inv/spa operon, is an AraC-type transcriptional activator required for SPI- expression. Downloaded from on July, 0 by guest

5 0 0 The SPI- effectors, SopE, SopE and SopB, in the pathogen side, as well as the Rho GTPases Cdc, Rac and RhoG, in the host side, are required for an orchestrated and efficient invasion. Together they lead to actin cytoskeletal reorganization, membrane ruffling and bacterial internalization by macropinocytosis. SopB, together with the above quoted effectors, leads to chloride secretion through lipid dephosphorylation (), and indirectly stimulates Cdc and RhoG through its phosphoinositide phosphatase activity (,,, ). SopB also promotes intestinal disease by increasing the intracellular concentration of D-myo-inositol,,,-tetrakisphosphate, which stimulates cellular chloride secretion and fluid flux (). Although SipA is not exclusively required for cell invasion, it helps to initiate actin polymerization at the site of S. Typhimurium entry by decreasing the critical concentration, and increasing the stability of actin filaments (,, ). The effector SifA (encoded outside SPI-), is secreted through the SPI- TSS and is essential for inducing tubulation of the S.Typhimurium phagosome. SifA binds to the mammalian kinesin-binding protein SKIP. SifA co-expressed with SseJ induces tubulation of mammalian cell endosomes, indicating that SifA likely mimics or activates a RhoA family of GTPases (). SPI- (containing the mgtbc genes), together with SPI-, is required for intra-macrophage survival, virulence in mice, and growth in magnesium-depleted medium. The mgtc gene is transcriptionally controlled by the PhoP-PhoQ regulatory system (), which is responsive to Mg +, anti-microbial peptides and ph, and is the major regulator of virulence in Salmonella (, ). The BasRS two-component system, also known as PmrAB, is an important regulator of the S.Typhimurium virulence genes. PmrAB regulates genes that modify lipopolysaccharide, conferring resistance to cationic microbial peptides, such as polymixin B, subsequently aiding survival within the host (). Expression of pmrab, is also indirectly regulated by the PhoPQ system, and QseC has been linked to regulation of pmrab (, 0). Downloaded from on July, 0 by guest

6 0 0 Here we show that QseC plays an important role in S. Typhimurium pathogenicity in vitro and in vivo. The qsec mutant shows diminished flagella motility, invasion of epithelial HeLa cells, survival within J macrophages, and virulence in systemic murine infection. Additionally, Dbh -/- mice (unable to produce Epi and NE) infected with S. Typhimurium WT and the qsec mutant have different infection kinetics than WT mice. These data suggest that the AI-/Epi/NE signaling system plays an important role in inter-kingdom signaling during S. Typhimurium infection in vivo. QseC globally regulates transcription expression of SPI-, the SPI- effector sifa, SPI- and flagella genes in vitro and in vivo. MATERIAL AND METHODS Strains and plasmids. All strains and plasmids used in this study are listed on Table. Strains were grown aerobically in LB, or N-minimal media (,,, ) at o C. Recombinant DNA and molecular biology techniques were performed as previously described (). All oligonucleotides used in the study are listed on Table. Construction of the qsec mutant. Construction of an isogenic non-polar S. Typhimurium SL qsec mutant was achieved using red mutagenesis (). The qsec mutant (CGM0) was complemented with the qsec gene cloned into (XhoI and HindIII) pbadmychisa (Invitrogen) vector generating strain CGM. Quantitative real-time RT-PCR. Overnight cultures were grown aerobically in LB or N- minimal media at 0 rpm to late-exponential growth phase (OD00.0) for the in vitro assays in the absence or presence of 0 M NE. The in vivo expression levels were measured by directly extracting the S. Typhimurium RNA from the spleens and livers of infected animals. Negative Downloaded from on July, 0 by guest

7 0 0 control PCR reactions were performed with RNA extracted from liver and spleens from uninfected animals to ensure that there was no cross-reactivity of our primers to mammalian mrna message. RNA from three biological samples was extracted using the RiboPure Bacteria RNA isolation kit (Ambion) following manufacturer s guidelines. The primers used in the Real-Time assays were designed using Primer Express v. (Applied Biosystems) (Table ). Real-Time RT-PCR was performed in a one-step reaction using an ABI 00 sequence detection system (Applied Biosystems). For each 0 l reaction, 0 l X SYBR master mix, 0. l Multi-scribe reverse transcriptase (Applied Biosystems), and 0. l RNase inhibitor (Applied Biosystems) were added. Amplification efficiency of each primer pair was verified using standard curves of known RNA concentrations. The rpoa (RNA polymerase subunit A) gene was used as the endogenous control. Data collection was performed using the ABI Sequence Detection. software (Applied Biosystems). Data were normalized to levels of rpoa and analyzed using the comparative critical threshold (CT) method previously described (). The expression level of the target genes at the different growth phases was compared using the relative quantification method (). Real-time data is presented as fold change compared to WT levels. Error bars represent the standard deviation of the CT value (). Statistical significance was determined by Students t test. A P value of <0.0 was considered significant. HeLa invasion assays. Epithelial HeLa cells were infected with S. Typhimurium at a MOI (multiplicity of infection) of 00: for 0 minutes bacteria/cell interaction at o C %CO, as previously described (,, ). These cells were treated with 0 g/ml of gentamycin for hour to kill extracellular bacteria, and lysed with % Triton-X. Bacteria were diluted and plated in LB plates for CFU (colony forming units) determination (,, ). Downloaded from on July, 0 by guest

8 0 0 Macrophage infection. J murine macrophages were infected with opsonized S. Typhimurium with normal mouse serum at oc for min and washed. These macrophages were infected using a MOI of 00: for 0 minutes bacteria/cell interaction at o C at % CO. These cells were treated with 0 g/ml of gentamycin for hour to kill extracellular bacteria, and lysed with % Triton-X. Bacteria were diluted and plated in LB plates for CFU determination (,, ). Motility assays. The motility assays were performed at o C on LB broth containing 0.% agar (). The transcription expression of the flagella genes, flhdc, flia and mota, were measured by qrt-pcr using the RNA extracted directly from cut out halos of the LB motility agar. Mice survival experiments with Salmonella Typhimurium. Mice (x/svj, weeks old, female) were infected IP (intra-peritoneal) with X 0 CFU of E. coli K- strain DH (K- was used as a negative infectivity control to ensure that there were no issues with organ perforations during IP injection, and that mice death was not due to endotoxic effects), S. Typhimurium WT strain SL or the qsec mutant (CGM0). 0 mice were infected per strain using the same IP infection with X 0 CFU, and these experiments were repeated at least twice to ensure reproducibility. Mice were returned to their cages and monitored daily for signs of morbidity (anorexia, rapid shallow breathing, scruffy fur, decreased muscle tone, and lethargy) and death. After days post infection the remaining animals were euthanized by CO asphyxiation. The systemic organ colonization was performed as previously described (), after 0 hours of the IP infection the mice were sacrificed to remove the spleens and livers. Those organs were harvested, homogenized and plated on LB agar plates for bacterial cell counts to determine tissue colonization (CFU) (, ). Downloaded from on July, 0 by guest

9 0 0 The mixed infection between S. Typhimurium WT versus qsec mutant was performed using IP infections with half of the usually used inoculum composed by WT and qsec mutant strains, then each strain had X 0 CFU, or a total of X 0 CFU. These mice were sacrificed after 0hpi, organs collected and plated to count the bacterial loads. The ratio between qsec/wt counts was used to determine the Competitive Index (,, 0). Dbh knockout mice. Dopamine -hydroxylase knockout (Dbh -/-) mice, maintained on a mixed CBL/J and SvEv background mice were generated at Emory University as previously described (), shipped to UT Southwestern, and infected IP with WT and the qsec mutant as described above. Littermate Dbh +/- heterozygous mice were used as controls because they have normal NE and Epi levels (). RESULTS QseC affects flagella motility. The QseC system directly activates flagella expression in EHEC by regulating transcription of the flhdc genes that encode the flagella master regulators (, ). Moreover, Bearson & Bearson () have shown that NE via QseC enhances motility and flagella gene expression in S. Typhimurium (). Contradictory data concerning NE/Epi enhancement of motility was reported by Merighi et al. (0), suggesting that Epi did not play a role in enhancement of motility in WT S. Typhimurium. However, it is worth noting that NE and Epi are photosensitive and labile compounds in vitro that quickly decompose in solution (). The labile nature of these compounds could be responsible for the variation presented in these motility studies. Given that both the Bearson and Merighi studies (, 0) reported decreased motility in qsec mutants, we first investigated the motility phenotype in our qsec mutant, and Downloaded from on July, 0 by guest

10 0 0 0 congruent with both previous reports we observed decreased motility compared to WT, and this phenotype was rescued upon complementation (Fig.A and Fig.B). Although NE has been shown to increase expression of flagella genes in WT S. Typhimurium (), there are no reports of QseC regulation of the flagella regulon in this species. In agreement with the Bearson & Bearson () report, we observed that NE significantly increased motility in the WT strain (Figs. C, D and E), but that in the presence of NE the motility of the qsec mutant remained decreased (Figs. C, D and E). Surprisingly, in S. Typhimurium cultures grown in LB, transcription of flhdc was increased two-fold in the qsec mutant when compared to WT (Fig.F). We then hypothesized that QseC-dependent flagella gene expression may be differentially regulated in LB and in motility agar. To test this hypothesis, we assessed expression of the flagellar genes: flhdc, flia and mota in WT, the qsec mutant and complemented strains by qrt-pcr from RNA extracted from cultures grown in motility agar. Under this latter condition, we observed diminished transcription of all of the flagellar genes in the qsec mutant (transcription of flhdc was significantly decreased four-fold, flia four-fold and mota three-fold), and this phenotype was rescued upon complementation (Fig.G), explaining the decreased motility observed with the qsec mutant (Fig.A and B). Consistent with previous reports (, ), NE increased expression of flhdc during growth in the WT and in the qsec mutant (in both strains two-fold) in LB (Fig. F). There are two potential explanations for the differential regulation of flhdc by QseC in different environmental conditions (LB versus motility plates): ) Transcriptional regulation of flhdc is complex, and can also vary within the same species due to the presence of insertion sequences (ISs) in the regulatory region of flhdc (). To add to this complexity, QseB will bind to different sites according to its phosphorylated state, and can act as a repressor and activator within the same Downloaded from on July, 0 by guest

11 0 0 promoter (). The flhdc regulatory region in S. Typhimurium lacks one of the QseB binding sites present in the EHEC flhdc regulatory region (), which may account for the differential and environmental dependent regulation of these genes in S. typhimurium compared to EHEC. ) The S. Typhimurium NE-dependent flhdc expression in LB broth may also occur through a second receptor. S. Typhimurium harbors a QseE homolog, and QseE senses Epi/NE (). Crosssignaling between the QseBC and QseEF systems has also been observed (). Different receptors may play a role in NE modulation of flhdc expression under different environmental conditions, given that transcription of flhdc in LB is increased in the qsec mutant (Fig. F), while it is decreased in motility agar (Fig. G). Furthermore it is also worth noting that FlhDC is the master flagella regulator and transcriptional regulation of flhdc is sensitive to several environmental conditions and cell state sensors (0). The promoter of flhdc defines the flagellar class promoter and is a crucial point at which the decision to initiate or prevent flagellar biosynthesis occurs. This promoter is controlled by a number of global regulators such as CRP (, ), heat shock proteins DnaK, DnaJ, and GrpE () and H-NS (, ), as well as by several environmental signals such as temperature control, high concentrations of inorganic salts, carbohydrates, or alcohols, growth phase, DNA supercoiling, phosphatidylethanolamine and phosphatidylglycerol synthesis, cell cycle control (). QseC plays a role in invasion of epithelial cells and intra-macrophage survival. Next we investigated whether QseC affected S. Typhimurium invasion of HeLa cells and survival within J macrophages. There was a significant one order of magnitude decrease in HeLa cell invasion by the qsec mutant compared to WT (Fig. A), and a five order of magnitude decrease in survival by the qsec mutant compared to WT within J macrophages (Fig.B). Both Downloaded from on July, 0 by guest

12 0 0 phenotypes were rescued upon complementation (Figs A and B). These data suggest that expression of both SPI- and SPI- encoded TSSs and /or effectors are under QseC regulation. HeLa cell invasion is a SPI- dependent phenotype, while SPI- is involved in intramacrophage survival (-). Expression of the SPI- genes: invf, sipa and sopb was assessed by qrt-pcr in conditions conducive to SPI- expression (LB) (). Transcription of these genes was significantly decreased in the qsec mutant: expression of invf was decreased twofold, sipa five-fold, and sopb.-fold. Expression of all of these genes was rescued upon complementation (Fig. A). Transcription of the gene encoding the SPI- TSS effector SifA, conducted under SPI- optimal expression conditions (N-minimal media that is a low phosphate and low magnesium media ()) was strikingly reduced in the qsec mutant (decreased 00-fold compared to WT), and again rescued upon complementation (Fig. B). These results are congruent with the decreased ability of the qsec mutant to invade epithelial cells and survive within macrophages (Fig. ). Because QseC is one of the sensors for Epi/NE (), we investigated whether NE could activate expression of these genes in a QseC-dependent manner. NE increased expression of invf (-fold), sopb (-old) and sifa (-fold) in WT S. Typhimurium (Fig.C). However, only NEinduced sifa expression was completely dependent on QseC (Fig.C). NE-induced expression of invf was significantly decreased, but not abrogated in the qsec mutant, a significant two-fold decrease in the qsec mutant+ne compared to WT+NE (Fig.C) was observed. Meanwhile NEinduced expression of sopb was similar between WT and the qsec mutant (Fig. C). These data suggest that in vitro induction of sifa transcription by NE is completely QseC-dependent, congruent with our previous studies (). However, NE-induced transcription of invf is only partially dependent on QseC, with a significant two-fold decrease in the qsec mutant+ne Downloaded from on July, 0 by guest

13 0 0 compared to WT+NE; while transcription of sopb in vitro can be induced by NE even in the absence of QseC, suggesting that another NE receptor, maybe QseE, could play a role in this regulation. QseC in S.Typhimurium systemic murine infection. Inasmuch as QseC regulates expression of SPI- and the sifa genes (Fig. ), and plays an important role in epithelial cell invasion and intra-macrophage survival (Fig. ), one would expect that a qsec mutant would be attenuated for murine infection. Indeed we have previously published that a qsec mutant was attenuated for systemic infection of mice performing survival studies (). Here we conducted further murine infection experiments to assess in more detail this attenuation for infectivity. We used the systemic (intra-peritoneal (IP) infection) typhoid-like model in x/svj mice, which are Nramp(+/+) (), and more resistant to S. Typhimurium infection (). This murine strain was chosen because we have obtained knockout mice that do not produce either epinephrine or norepinephrine in this background (Figs and ), and we needed consistency in the genetic background of these animals to compare and contrast our data. As a negative control we also performed IP infections using K- E. coli (Fig. A and B, Fig.) to ensure that endotoxic effects were not responsible for the morbidity and mortality observed in these animals. Upon infection with WT S. Typhimurium 0% of the mice remained alive at day post-infection while 00% of the qsec infected mice were still alive (Fig.A). By day only 0% of WT infected mice were alive, while 0% of qsec infected mice were alive. All WT infected mice were dead by day post infection, while qsec infected mice were only dead by day (Fig. A). Colonization of the spleens and livers of mice (0 hours post infection) was significantly decreased two orders of magnitude in the qsec mutant as compared to WT (Fig B). We also performed a challenging competitive index between WT and the qsec mutant in mice. Competition studies were Downloaded from on July, 0 by guest

14 0 0 performed to avoid issues concerning individual variation between different mice in scoring the ability of these strains to establish themselves in the spleens and livers of these animals. As an initial control, an in vitro competition experiment between the WT and the qsec mutant was performed to ensure that there were no growth defects in the qsec mutant (data not shown). Fig. C shows that the WT strain out-competed the qsec mutant, further indicating that the qsec mutant is attenuated for systemic murine infection. QseC-dependent gene regulation in vivo. The attenuation of the qsec mutant during systemic infection could be a result of the QseC-regulation of SPI- and sifa genes (Fig. ). However, in vitro conditions do not exactly reflect the complexity of the in vivo environment. Hence, we investigated the role of QseC in the regulation of these virulence genes during infection. We harvested the spleens and livers of x/svj mice infected with either WT or the qsec mutant ( mice each) 0 hours post infection, extracted RNA, and performed qrt-pcr using rpoa as an internal control. Transcription of the SPI- genes sipa (four-fold) and sopb (three-fold) in both spleens and livers, and sifa gene (four-fold in spleen and.-fold in liver) were significantly decreased in the qsec mutant of infected animals (Fig. ). We also addressed transcription of the SPI- mgtb gene, known to be important for intra-macrophage survival (, ). Transcription of mgtb gene was also decreased (four-fold) in the qsec mutant in both spleens and livers (Fig. B). These data suggest that QseC activates expression of SPI-, sifa and SPI- genes in vitro (Fig.) and in vivo (Fig.). We also compared expression of these genes in S. Typhimurium WT in vitro and in vivo (Fig. ), and observed that transcription of the SPI- genes sipa and sopb were significantly decreased in vivo compared to in vitro. Given that our in vivo assessment occurred in livers and spleens and SPI- s major role seems to be in the invasion of the intestinal epithelia, these results Downloaded from on July, 0 by guest

15 0 0 were not unexpected. One exception is the expression of invf, which is a SPI- encoded gene, and is highly up-regulated in vivo. InvF is a transcriptional factor, and given the cross regulation of SPI- and SPI- by the SPI- encoded HilD regulator (), it is possible that in vivo invf is needed to control other genes in Salmonella involved in systemic disease. Expression of sifa, mgtb and qseb was significantly up-regulated in vivo, reflective of their role in S. Typhimurium s systemic infection. NE/Epi s role in S.Typhimurium infection in vivo. Given that QseC is important for murine systemic infection by S. Typhimurium (Fig.), and QseC senses AI-, Epi and NE (), we assessed the role of QseC-sensing Epi and NE during murine infection by Salmonella using Dbh -/- mice that lack NE and Epi (). It is worth noting that although NE and Epi are not required for normal development of the immune system of these mice, they play an important role in the modulation of T cell-mediated immunity to infection. Specifically, these mice have impaired Th T cell responses to infection (). Th T cells are important in controlling intracellular pathogens (,, ). Consequently, Dbh -/- mice are more susceptible to intracellular pathogens (Listeria monocytogenes and Mycobacterium tuberculosis) (). To assess whether the Dbh -/- knockout mice were more susceptible to S. Typhimurium infection, we infected Dbh -/- and Dbh +/- control mice with the WT strain. Congruent with previous reports, the Dbh -/- mice were more susceptible to S. Typhimurium infection than the Dbh +/- mice (Fig. A). By day post-infection 0% of the Dbh -/- mice were deceased, while only % of the Dbh +/- died. All of the Dbh -/- mice were deceased by day, while all Dbh +/- mice were deceased by day (Fig. A). We next infected Dbh -/- and Dbh +/- mice with the qsec mutant, and observed that during the first three days, mortality caused by the qsec mutant was similar in both mouse strains (Fig. B). These results highlight an important contrast with Downloaded from on July, 0 by guest

16 0 0 infection by WT S. Typhimurum, where one can observe that the defect in the Th immune response to infection by intracellular pathogens in the Dbh -/- mice impairs them to control S. Typhimurium infection (Fig. A). By day 0% of the Dbh -/- WT infected mice were alive, while 0% of the Dbh +/- WT-infected mice were alive (Fig. A). Meanwhile, 0% of both Dbh -/- and Dbh +/- mice infected with the qsec mutant were alive by day post infection, and by day 0% Dbh +/- and 0% of the Dbh -/- mice were alive (Fig. B). However, from day to, Dbh -/- mice were more susceptible to infection by the qsec mutant than Dbh +/- mice, in a similar scenario observed with mice infected with WT S. Typhimurium (Figs. A and B). These data are congruent with infection of x/svj mice (Nramp+/+) (Fig. ), where attenuation due to a qsec mutation is only observed until day post-infection, suggesting that QseCindependent regulation is involved in S. Typhimurium pathogenesis at later time points. These results suggest that QseC, Epi and NE play a significant role in the murine infection by S. Typhimuirum. In vivo QseC-Epi/NE-dependent gene regulation. Although Dbh -/- mice are more susceptible to intracellular pathogens due to an immune deficiency, these mice could yield valuable information on QseC-dependent Epi/NE signaling during S. Typhimurium infection. To assess QseC-Epi/NE dependent regulation in vivo, we performed qrt-pcr from RNA extracted from the livers and spleens of control and Dbh -/- mice infected with WT and qsec S. Typhimurium. Liver and spleen expression of the SPI- genes sipa and sopb, and the SPI- gene mgtb was significantly diminished in the absence of Epi/NE or QseC, and even further reduced in Dbh -/- mice infected with qsec S. Typhimurium (Fig. ). These results suggest that NE and Epi facilitate the expression of these genes in vivo, and that QseC is involved in this regulation (Fig. Downloaded from on July, 0 by guest

17 ). These data show that during murine infection Epi/NE modulate virulence gene expression in Salmonella, and that this modulation is QseC-dependent. Discussion 0 0 The complex interaction between a bacterial pathogen and its mammalian host relies on signaling through proteins, bacterial effectors or toxins delivered to host cells, and chemicals (). Here we show the inter-section of these two-signaling systems in vitro and in vivo in the important pathogen Salmonella Typhimurium. S. Typhimurium is a food-borne pathogen that upon ingestion invades the gastrointestinal epithelia, reaching the mesenteric lymph nodes. It then can establish a systemic infection replicating in the spleen and liver of the host (,,,, ). During the pathogenesis process, bacteria encounter several different microenvironments in the host (0), and several bacteria like S. Typhimurium effectively adapts utilizing HKs (). QseC is an HK that senses the bacterial signal AI- and the host hormones Epi and NE (). NE is found at much greater concentrations in lymphoid organs than in the blood, suggesting that NE plays a physiological role in immune modulation (, ). NE and Epi are known to have profound systemic effects, playing important roles in energy balance, behavior, cardiovascular tone, thermoregulation, and the stress response (). Hence a pathogen s ability to sense these two signals may allow for the precise modulation of virulence gene expression, while gauging the physiological state of the host. Here we show that QseC is a global regulator of virulence genes of S. Typhimurium in vitro and in vivo (Figs. to ). A qsec mutant presents decreased expression of SPI-, sifa and SPI- genes, decreased ability to invade epithelial cells and replicate within macrophages, and is Downloaded from on July, 0 by guest

18 0 0 attenuated for systemic infection of mice (Figs. to ). In contrast with our results, Merighi et al. (0) reported that a qsec mutant did not present attenuation for the invasion of epithelial cells. These conflicted data could be due to differences in methodology, Merighi et al. performed a pre-incubation of S. Typhimurium with epithelial cells at o C for 0 minutes and then at o C for hour before adding gentamycin (0), while we incubated at o C 0 minutes before adding gentamycin as previously described (,, ), without performing the o C pre-incubation from the Merighi studies. However, the cell invasion defect we observed is congruent with down-regulation of SPI- gene expression that we observed in the qsec mutant (Fig. ). The qsec mutant was attenuated for systemic murine infection (Fig. ) (), congruent with the reduced expression of the sifa gene in the qsec mutant (Fig. B) (), and the five orders of magnitude decrease in intra-macrophage survival by the qsec mutant (Fig. B). The SifA effector is secreted by the SPI- TTSS, and has been shown to be important for systemic murine infection, and intra-macrophage survival (). Our results also show that expression of sifa and mgtb (a SPI- gene also important for intra-macrophage survival (, )) are downregulated in the qsec mutant compared to WT in the spleens and livers of infected mice (Figure ). To further address the interplay between Epi/NE and S. Typhimurium pathogenesis we utilized Dbh -/- mice that do not produce these signals. These mice were more susceptible to S. Typhimurium infection than control mice (Fig.A). Although this may seem as a conundrum, given that Epi and NE enhance S. Typhimurium pathogenesis in vitro, and a qsec sensor mutant is attenuated for murine infection (Fig ), one has to take into consideration that Epi and NE are important for Th T cell activation, which mediate defense against intracellular pathogens (). Hence, the higher susceptibility of the Dbh -/- mice to S. Typhimurium infection is likely due to Downloaded from on July, 0 by guest

19 0 0 a defective Th immune response. However, one can still utilize these animals to gain important insights on the role of Epi/NE during S. Typhimurium systemic infection. Of note, the qsec mutant did not shown any differences in infectivity in Dbh -/- or Dbh +/- mice until three days post infection (Fig. B), suggesting that during early infection, QseC sensing of Epi/NE may play an important role in the kinetics of S. typhimurium murine infection. These data are further corroborated by the observation that transcription of Salmonella s SPI- and SPI- genes in vivo is decreased in the absence of Epi/NE and that QseC is involved in this regulation (Fig.). Transcription of the sipa, sopb and mgtb genes is significantly decreased in WT S. Typhimurium (has QseC and produces AI-) in the spleens and livers of Dbh-/- mice (do not produce Epi/NE) compared to expression of these genes in S. Typhimurium (has QseC and produces AI-) in the spleen and livers of WT mice (produce Epi/NE) (Fig. ). These data suggest that during murine infection, the presence of Epi/NE in the livers and spleens of mice activates expression of S. Typhimurium virulence genes. QseC senses AI-, Epi and NE (). To address QseC s involvement in sensing Epi/NE in vivo, we then infected WT (produces Epi/NE) and Dbh-/- (do not produce Epi/NE) mice with the qsec mutant, and compared expression of the sipa, sopb and mgtb genes to the expression of these genes in WT S. Typhimurium (has QseC and makes AI-) infecting WT mice. During infection of WT mice the host signals Epi and NE are present, as is the bacterial AI- signal produced by the qsec mutant. We observed that under these conditions transcription of all of these three genes was decreased in the qsec mutant compared to WT S. Typhimurium (Fig. ), suggesting that the ability to sense these three signals is involved in the transcriptional activation of these virulence genes during murine infection. Transcription of sipa (liver and spleens), sopb (spleens) and mgtb (liver and spleens) is decreased even further in the qsec mutant infecting Dbh-/- mice, suggesting that both Downloaded from on July, 0 by guest

20 0 0 0 QseC and Epi/NE are necessary for full activation of these genes in vivo. Although we show that QseC is an important sensor of these cues, it is clear that other bacterial adrenergic sensors exist. NE-induced transcription of the SPI- genes (Fig.C) is not completely dependent on QseC. We have identified a second adrenergic receptor in EHEC, QseE (), and S. Typhimurium harbors a homolog of this protein. The QseC-independent NE gene regulation could occur through this second sensor, and would impart further kinetics and refinement to this signaling cascade. Further support for a role of a secondary adrenergic sensor in this regulation can be observed when one compares transcription of sipa and mgtb in the qsec mutant in the livers and spleens of WT versus Dbh-/- mice (Fig. ). Transcription of these genes in the qsec mutant is further decreased during infection of the Dbh-/- mice, suggesting that a second adrenergic receptor (maybe QseE) may be responsible for the residual QseC-independent Epi/NE activation of these genes in WT mice. In this study we assess the contribution of inter-kingdom chemical signaling to S. Typhimurium pathogenesis combining the powerful genetics of murine models and a genetically tractable pathogen. Further understanding of the molecular mechanisms underlying these signaling events in the bacteria and the host will allow us to pursue inter-kingdom signaling in more depth. Acknowledgements This work was supported by NIH grant UO-AI00 and the Burroughs Wellcome Fund. Downloaded from on July, 0 by guest

21 Table. Strains and plasmids used in this study Strain or plasmid Relevant genotype Source or reference SL Salmonella enterica serovar Typhimurium prototype () CGM0 qsec mutant Red generate () qsec complemented strain (in XhoI/HindIII CGM This study pbadmychisa) F- mcra D(mrr-hsdRMS-mcrBC) f0laczdm DlacX deor reca arad TOP0 Invitrogen D(ara-leu) galu galk rpsl (StrR) enda nupg DH supe lacu ( 0 lacz M) hsdr Stratagene pbadmychisa Cloning vector Invitrogen pbluescript KSII Cloning vector Stratagene TOPO PCR Blunt PCR blunt cloning vector with topoisomerase Invitrogen pkd pants derivative containing FRT-flanked () chloramphenicol resistance pkd red recombinase expression plasmid () pkd0 TS replication and thermal induction of FLP () synthesis Downloaded from on July, 0 by guest

22 Table. Oligonucleotides used in this study Primer name Forward Reverse sipa TTTAGTAGCCGCCTGCGATAA GCCGTGGTACCGTCTACCA sopb CGGGTACCGCGTCAATTTC TGGCGGCGAACCCTATAAA Downloaded from on July, 0 by guest invf CAGGACTCAGCAAAACCCATTT TTATCGATGGCGCAGGATTAG sifa GTTGTCTAATGGAACCGATAATATCG CTACCCCCTCCCTTCGACAT mgtb ACTTCATTGCGCCCATACACT CGTCAGGGCCTCACGATAGA flia TTGGTGCGTAATCGTTTGATG CTGGAAGTCGGCGAATCG flhdc GTCAAACCGGAAATGACAAACTAA ACCCTGCCGCAGATGGT mota TTACCGCCGCGACGATA CCAACAGTCTGGCGATGGT bass CGGTAAAAAGGCGTTCATTGTC CGTCTCGGCGATCAATCAA qseb CCACTGGCCCTAAAACCAAAA GGCAGCACGCGACCTTT rpoa GCGCTCATCTTCTTCCGAAT CGCGGTCGTGGTTATGTG qsec- Lambda Red TGACGCAACGTCTCAGCCTGCGCGTCAGG CTGACGCTTATTTTCCTGATTGTGTAGGCT GGGAGCTGCTTC CCAACTTACTACGGCCTCAAATC CACCTTCCGCGGCGTTGCCAAAC GACACATATGAATATCCTCCTTA qsec- CTCGAGATAAATTGACGCAACGTCTCAGC AAGCTTCGCCAACTTACTACGGC pbadmychisa CTCAAA

23 References. Ader, R., N. Cohen, and D. Felten.. Psychoneuroimmunology: interactions between the nervous system and the immune system. Lancet :-0.. Ahmer, B. M., M. G. Thomas, R. A. Larsen, and K. Postle.. Characterization of the exbbd operon of Escherichia coli and the role of ExbB and ExbD in TonB function and stability. J Bacteriol :-.. Alaniz, R. C., S. A. Thomas, M. Perez-Melgosa, K. Mueller, A. G. Farr, R. D. Palmiter, and C. B. Wilson.. Dopamine beta-hydroxylase deficiency impairs cellular immunity. Proc Natl Acad Sci U S A :-.. Arnett, C. D., J. Wright, and N. Zenker.. Synthesis and adrenergic activity of benzimidazole bioisosteres of norepinephrine and isoproterenol. J Med Chem :-.. Ashby, M. K. 00. Survey of the number of two-component response regulator genes in the complete and annotated genome sequences of prokaryotes. FEMS Microbiol Lett :-.. Bader, M. W., S. Sanowar, M. E. Daley, A. R. Schneider, U. Cho, W. Xu, R. E. Klevit, H. Le Moual, and S. I. Miller. 00. Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell :-.. Barker, C. S., B. M. Pruss, and P. Matsumura. 00. Increased motility of Escherichia coli by insertion sequence element integration into the regulatory region of the flhd operon. J Bacteriol :-.. Baumler, A. J., R. M. Tsolis, P. J. Valentine, T. A. Ficht, and F. Heffron.. Synergistic effect of mutations in inva and lpfc on the ability of Salmonella typhimurium to cause murine typhoid. Infect Immun :-.. Bearson, B. L., and S. M. Bearson. 00. The role of the QseC quorum-sensing sensor kinase in colonization and norepinephrine-enhanced motility of Salmonella enterica serovar Typhimurium. Microb Pathog :-. 0. Beier, D., and R. Gross. 00. Regulation of bacterial virulence by two-component systems. Curr Opin Microbiol :-.. Bertin, P., E. Terao, E. H. Lee, P. Lejeune, C. Colson, A. Danchin, and E. Collatz.. The H-NS protein is involved in the biogenesis of flagella in Escherichia coli. J Bacteriol :-0.. Beuzon, C. R., and D. W. Holden. 00. Use of mixed infections with Salmonella strains to study virulence genes and their interactions in vivo. Microbes Infect :-.. Beuzon, C. R., S. Meresse, K. E. Unsworth, J. Ruiz-Albert, S. Garvis, S. R. Waterman, T. A. Ryder, E. Boucrot, and D. W. Holden Salmonella maintains the integrity of its intracellular vacuole through the action of SifA. Embo J :-.. Blanc-Potard, A. B., and E. A. Groisman.. The Salmonella selc locus contains a pathogenicity island mediating intramacrophage survival. Embo J :-.. Blanc-Potard, A. B., F. Solomon, J. Kayser, and E. A. Groisman.. The SPI- pathogenicity island of Salmonella enterica. J Bacteriol :-00.. Buchwald, G., A. Friebel, J. E. Galan, W. D. Hardt, A. Wittinghofer, and K. Scheffzek. 00. Structural basis for the reversible activation of a Rho protein by the bacterial toxin SopE. Embo J :-. Downloaded from on July, 0 by guest

24 Bustamante, V. H., L. C. Martinez, F. J. Santana, L. A. Knodler, O. Steele- Mortimer, and J. L. Puente. 00. HilD-mediated transcriptional cross-talk between SPI- and SPI-. Proc Natl Acad Sci U S A 0:-.. Canonne-Hergaux, F., S. Gruenheid, G. Govoni, and P. Gros.. The Nramp protein and its role in resistance to infection and macrophage function. Proc Assoc Am Physicians :-.. Cherepanov, P. P., and W. Wackernagel.. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibioticresistance determinant. Gene :-. 0. Chilcott, G. S., and K. T. Hughes Coupling of flagellar gene expression to flagellar assembly in Salmonella enterica serovar typhimurium and Escherichia coli. Microbiol Mol Biol Rev :-0.. Chilcott, G. S., and K. T. Hughes.. The type III secretion determinants of the flagellar anti-transcription factor, FlgM, extend from the amino-terminus into the antisigma domain. Mol Microbiol 0: Cho, U. S., M. W. Bader, M. F. Amaya, M. E. Daley, R. E. Klevit, S. I. Miller, and W. Xu. 00. Metal bridges between the PhoQ sensor domain and the membrane regulate transmembrane signaling. J Mol Biol :-0.. Cirillo, D. M., R. H. Valdivia, D. M. Monack, and S. Falkow.. Macrophagedependent induction of the Salmonella pathogenicity island type III secretion system and its role in intracellular survival. Mol Microbiol 0:-.. Clarke, M. B., D. T. Hughes, C. Zhu, E. C. Boedeker, and V. Sperandio. 00. The QseC sensor kinase: A bacterial adrenergic receptor. Proc Natl Acad Sci U S A: Clarke, M. B., and V. Sperandio. 00. Transcriptional regulation of flhdc by QseBC and sigma (FliA) in enterohaemorrhagic Escherichia coli. Mol Microbiol :-.. Datsenko, K. A., and B. L. Wanner One-step inactivation of chromosomal genes in Escherichia coli K- using PCR products. Proc Natl Acad Sci U S A :0-.. Deiwick, J., T. Nikolaus, S. Erdogan, and M. Hensel.. Environmental regulation of Salmonella pathogenicity island gene expression. Mol Microbiol :-.. Detweiler, C. S., D. M. Monack, I. E. Brodsky, H. Mathew, and S. Falkow. 00. virk, soma and rcsc are important for systemic Salmonella enterica serovar Typhimurium infection and cationic peptide resistance. Mol Microbiol :-00.. Eichelberg, K., and J. E. Galan The flagellar sigma factor FliA (sigma()) regulates the expression of Salmonella genes associated with the centisome type III secretion system. Infect Immun :-. 0. Ellermeier, J. R., and J. M. Slauch. 00. Adaptation to the host environment: regulation of the SPI type III secretion system in Salmonella enterica serovar Typhimurium. Curr Opin Microbiol 0:-.. Felten, D. L., S. Y. Felten, D. L. Bellinger, S. L. Carlson, K. D. Ackerman, K. S. Madden, J. A. Olschowki, and S. Livnat.. Noradrenergic sympathetic neural interactions with the immune system: structure and function. Immunol Rev 00:-0.. Feuillet, V., S. Medjane, I. Mondor, O. Demaria, P. P. Pagni, J. E. Galan, R. A. Flavell, and L. Alexopoulou. 00. Involvement of Toll-like receptor in the recognition of flagellated bacteria. Proc Natl Acad Sci U S A 0:-. Downloaded from on July, 0 by guest

25 Fierer, J., L. Eckmann, F. Fang, C. Pfeifer, B. B. Finlay, and D. Guiney.. Expression of the Salmonella virulence plasmid gene spvb in cultured macrophages and nonphagocytic cells. Infect Immun :-.. Finlay, B. B., S. Ruschkowski, and S. Dedhar.. Cytoskeletal rearrangements accompanying salmonella entry into epithelial cells. J Cell Sci ( Pt ):-.. Freed, N. E., O. K. Silander, B. Stecher, A. Bohm, W. D. Hardt, and M. Ackermann. 00. A simple screen to identify promoters conferring high levels of phenotypic noise. PLoS Genet :e Furness, J. B Types of neurons in the enteric nervous system. Journal of the autonomic nervous system :-.. Galan, J. E.. Molecular and cellular bases of Salmonella entry into host cells. Curr Top Microbiol Immunol 0:-0.. Galan, J. E.. Molecular genetic bases of Salmonella entry into host cells. Mol Microbiol 0:-.. Galan, J. E., and R. Curtiss, rd.. Cloning and molecular characterization of genes whose products allow Salmonella typhimurium to penetrate tissue culture cells. Proc Natl Acad Sci U S A :-. 0. Groisman, E. A., and H. Ochman.. Cognate gene clusters govern invasion of host epithelial cells by Salmonella typhimurium and Shigella flexneri. EMBO J :-.. Gunn, J. S., S. S. Ryan, J. C. Van Velkinburgh, R. K. Ernst, and S. I. Miller Genetic and functional analysis of a PmrA-PmrB-regulated locus necessary for lipopolysaccharide modification, antimicrobial peptide resistance, and oral virulence of Salmonella enterica serovar typhimurium. Infect Immun :-.. Hardt, W. D., L. M. Chen, K. E. Schuebel, X. R. Bustelo, and J. E. Galan.. S. typhimurium encodes an activator of Rho GTPases that induces membrane ruffling and nuclear responses in host cells. Cell :-.. Hensel, M., J. E. Shea, S. R. Waterman, R. Mundy, T. Nikolaus, G. Banks, A. Vazquez-Torres, C. Gleeson, F. C. Fang, and D. W. Holden.. Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island are required for bacterial virulence and proliferation in macrophages. Mol Microbiol 0:-.. Higashide, W., S. Dai, V. P. Hombs, and D. Zhou. 00. Involvement of SipA in modulating actin dynamics during Salmonella invasion into cultured epithelial cells. Cell Microbiol :-.. Hobbie, S., L. M. Chen, R. J. Davis, and J. E. Galan.. Involvement of mitogenactivated protein kinase pathways in the nuclear responses and cytokine production induced by Salmonella typhimurium in cultured intestinal epithelial cells. J Immunol :0-.. Hoiseth, S. K., and B. A. Stocker.. Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature :-.. Hughes, D. T., M. B. Clarke, K. Yamamoto, D. A. Rasko, and V. Sperandio. 00. The QseC adrenergic signaling cascade in enterohemorrhagic E. coli (EHEC). PLoS Pathog :e000.. Hughes, D. T., and V. Sperandio. 00. Inter-kingdom signaling: communication between bacteria and host. Nature Reviews Microbiology :-0. Downloaded from on July, 0 by guest

26 Humphries, A. D., M. Raffatellu, S. Winter, E. H. Weening, R. A. Kingsley, R. Droleskey, S. Zhang, J. Figueiredo, S. Khare, J. Nunes, L. G. Adams, R. M. Tsolis, and A. J. Baumler. 00. The use of flow cytometry to detect expression of subunits encoded by Salmonella enterica serotype Typhimurium fimbrial operons. Mol Microbiol :-. 0. Karavolos, M. H., H. Spencer, D. M. Bulmer, A. Thompson, K. Winzer, P. Williams, J. C. Hinton, and C. M. Khan. 00. Adrenaline modulates the global transcriptional profile of Salmonella revealing a role in the antimicrobial peptide and oxidative stress resistance responses. BMC Genomics :.. Lapaque, N., T. Walzer, S. Meresse, E. Vivier, and J. Trowsdale. 00. Interactions between human NK cells and macrophages in response to Salmonella infection. J Immunol :-.. Levi-Montalcini, R., and P. U. Angeletti.. Second symposium on catecholamines. Modification of sympathetic function. Immunosympathectomy. Pharmacol Rev :-.. Lockman, H. A., and R. Curtiss, rd. 0. Salmonella typhimurium mutants lacking flagella or motility remain virulent in BALB/c mice. Infect Immun :-.. Lundberg, U., U. Vinatzer, D. Berdnik, A. von Gabain, and M. Baccarini.. Growth phase-regulated induction of Salmonella-induced macrophage apoptosis correlates with transient expression of SPI- genes. J Bacteriol :-.. Lyte, M., B. P. Arulanandam, and C. D. Frank.. Production of Shiga-like toxins by Escherichia coli O:H can be influenced by the neuroendocrine hormone norepinephrine. J Lab Clin Med :-.. Lyte, M., and S. Ernst.. Catecholamine induced growth of gram negative bacteria. Life Sci 0:0-.. Marcus, S. L., J. H. Brumell, C. G. Pfeifer, and B. B. Finlay Salmonella pathogenicity islands: big virulence in small packages. Microbes Infect :-.. McGhie, E. J., R. D. Hayward, and V. Koronakis. 00. Cooperation between actinbinding proteins of invasive Salmonella: SipA potentiates SipC nucleation and bundling of actin. EMBO J 0:-.. Merighi, M., A. Carroll-Portillo, A. N. Septer, A. Bhatiya, and J. S. Gunn. 00. Role of Salmonella enterica serovar Typhimurium two-component system PreA/PreB in modulating PmrA-regulated gene transcription. J Bacteriol :-. 0. Merighi, M., A. N. Septer, A. Carroll-Portillo, A. Bhatiya, S. Porwollik, M. McClelland, and J. S. Gunn. 00. Genome-wide analysis of the PreA/PreB (QseB/QseC) regulon of Salmonella enterica serovar Typhimurium. BMC Microbiol :.. Meurens, F., M. Berri, G. Auray, S. Melo, B. Levast, I. Virlogeux-Payant, C. Chevaleyre, V. Gerdts, and H. Salmon. 00. Early immune response following Salmonella enterica subspecies enterica serovar Typhimurium infection in porcine jejunal gut loops. Vet Res 0:.. Ochman, H., F. C. Soncini, F. Solomon, and E. A. Groisman.. Identification of a pathogenicity island required for Salmonella survival in host cells. Proc Natl Acad Sci U S A : Ohlson, M. B., Z. Huang, N. M. Alto, M. P. Blanc, J. E. Dixon, J. Chai, and S. I. Miller. 00. Structure and function of Salmonella SifA indicate that its interactions with Downloaded from on July, 0 by guest

27 SKIP, SseJ, and RhoA family GTPases induce endosomal tubulation. Cell Host Microbe :-.. Patel, J. C., and J. E. Galan. 00. Differential activation and function of Rho GTPases during Salmonella-host cell interactions. J Cell Biol :-.. Pfeifer, C. G., S. L. Marcus, O. Steele-Mortimer, L. A. Knodler, and B. B. Finlay.. Salmonella typhimurium virulence genes are induced upon bacterial invasion into phagocytic and nonphagocytic cells. Infect Immun :0-.. Rasko, D. A., C. G. Moreira, R. Li de, N. C. Reading, J. M. Ritchie, M. K. Waldor, N. Williams, R. Taussig, S. Wei, M. Roth, D. T. Hughes, J. F. Huntley, M. W. Fina, J. R. Falck, and V. Sperandio. 00. Targeting QseC signaling and virulence for antibiotic development. Science : Reading, N. C., D. A. Rasko, A. G. Torres, and V. Sperandio. 00. The twocomponent system QseEF and the membrane protein QseG link adrenergic and stress sensing to bacterial pathogenesis. Proc Natl Acad Sci U S A 0:-.. Reading, N. C., A. G. Torres, M. M. Kendall, D. T. Hughes, K. Yamamoto, and V. Sperandio. 00. A novel two-component signaling system that activates transcription of an enterohemorrhagic Escherichia coli effector involved in remodeling of host actin. J Bacteriol :-.. Sambrook, J., E. F. Fritsch, and T. Maniatis.. Molecular cloning: a laboratory manual, second ed. Cold Spring Harbor Laboratory Press. 0. Shea, J. E., C. R. Beuzon, C. Gleeson, R. Mundy, and D. W. Holden.. Influence of the Salmonella typhimurium pathogenicity island type III secretion system on bacterial growth in the mouse. Infect Immun :-.. Shea, J. E., M. Hensel, C. Gleeson, and D. W. Holden.. Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimurium. Proc Natl Acad Sci U S A :-.. Shi, W., Y. Zhou, J. Wild, J. Adler, and C. A. Gross.. DnaK, DnaJ, and GrpE are required for flagellum synthesis in Escherichia coli. J Bacteriol :-.. Siegemund, S., N. Schutze, S. Schulz, K. Wolk, K. Nasilowska, R. K. Straubinger, R. Sabat, and G. Alber. 00. Differential IL- requirement for IL- and IL-A production during innate immunity against Salmonella enterica serovar Enteritidis. Int Immunol :-.. Silverman, M., and M. Simon.. Characterization of Escherichia coli flagellar mutants that are insensitive to catabolite repression. J Bacteriol 0:-0.. Sperandio, V., A. G. Torres, B. Jarvis, J. P. Nataro, and J. B. Kaper. 00. Bacteriahost communication: the language of hormones. Proc. Natl. Acad. Sci. USA 00:-.. Sperandio, V., A. G. Torres, and J. B. Kaper. 00. Quorum sensing Escherichia coli regulators B and C (QseBC): a novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli. Mol Microbiol :0-.. Stecher, B., M. Barthel, M. C. Schlumberger, L. Haberli, W. Rabsch, M. Kremer, and W. D. Hardt. 00. Motility allows S. Typhimurium to benefit from the mucosal defence. Cell Microbiol 0:-0. Downloaded from on July, 0 by guest

28 0 0. Thomas, S. A., and R. D. Palmiter.. Examining adrenergic roles in development, physiology, and behavior through targeted disruption of the mouse dopamine betahydroxylase gene. Adv Pharmacol :-0.. Threadgill, D. W., D. Yee, A. Matin, J. H. Nadeau, and T. Magnuson.. Genealogy of the inbred strains: /SvJ is a contaminated inbred strain. Mamm Genome : Walters, M., M. P. Sircili, and V. Sperandio. 00. AI- synthesis is not dependent on luxs in Escherichia coli. J Bacteriol :-.. Walters, M., and V. Sperandio. 00. Autoinducer and epinephrine signaling in the kinetics of locus of enterocyte effacement gene expression in enterohemorrhagic Escherichia coli. Infect Immun :-.. Yanagihara, S., S. Iyoda, K. Ohnishi, T. Iino, and K. Kutsukake.. Structure and transcriptional control of the flagellar master operon of Salmonella typhimurium. Genes Genet Syst :0-.. Yokota, T., and J. S. Gots. 0. Requirement of adenosine ', '-cyclic phosphate for flagella formation in Escherichia coli and Salmonella typhimurium. J Bacteriol 0:-.. Zhang, S., R. L. Santos, R. M. Tsolis, S. Stender, W. D. Hardt, A. J. Baumler, and L. G. Adams. 00. The Salmonella enterica serotype typhimurium effector proteins SipA, SopA, SopB, SopD, and SopE act in concert to induce diarrhea in calves. Infect Immun 0:-.. Zhou, D., L. M. Chen, L. Hernandez, S. B. Shears, and J. E. Galan. 00. A Salmonella inositol polyphosphatase acts in conjunction with other bacterial effectors to promote host cell actin cytoskeleton rearrangements and bacterial internalization. Mol Microbiol :-.. Zhou, D., M. S. Mooseker, and J. E. Galan.. Role of the S. typhimurium actinbinding protein SipA in bacterial internalization. Science :0-0. Downloaded from on July, 0 by guest

29 Figure legends 0 0 Fig.. QseC regulation of S. Typhimurium s flagella in vitro. (A) Motility assay in LB 0.% agar plates after h. (B) Motility assay halo measurement after h. (C) Motility assay WT and qsec in LB without NE after h. (D) Motility assay WT and qsec in LB with 0µM NE after h. (E) Motility assay halo measurement after NE (norepinephrine) addition, h. F) Transcription of flhdc in WT and qsec in LB with and without 0µM NE. (G) Transcription of flagellar genes (flhdc, flia and mota) in WT, qsec, and complemented strains in motility agar. Statistical significance was determined by Students t test in comparison with expression in the WT, the * indicates p<0.00. Fig.. QseC involvement in S. Typhimurium invasion of HeLa cells and intra-macrophage survival. (A) Invasion of HeLa epithelial cells by WT, qsec, and complemented strains. (B) Intra-macrophage survival (J macrophages) by WT, qsec, and complemented strains. Statistical significance was determined by Students t test in comparison with WT, the * indicates p<0.00. Fig.. QseC regulates transcriptional expression of SPI- and sifa in vitro. (A) Transcription of SPI- genes in WT, qsec, and complemented strains in LB. (B) Transcription of sifa in N- minimal media in WT, qsec, and complemented strains. (C) Transcription of invf (SPI-), sopb (SPI-), and sifa in LB in WT and qsec in the absence and presence of 0 M NE. All conditions were compared to WT expression levels without NE. In addition a second analysis in the expression of invf was performed comparing expression of WT+NE and qsec+ne as Downloaded from on July, 0 by guest

30 0 indicated by the bars. Statistical significance was determined by Students t test, the * indicates p< Fig.. QseC s role in murine systemic infection. (A) Survival curves of x/svj mice infected intraperitonealy (IP) with WT S.Typhimurium, the qsec isogenic mutant, and K- E. coli as control (p<0.000 using Students t test, comparing qsec mutant to WT in every time point of the survival curve until dpi ). (B) Organs loads of WT S.Typhimurium and qsec isogenic mutant during systemic dissemination in x/svj mice after 0 hours post-infection, p< (C) Competitive index (CI) between the qsec mutant and WT SL in x/svj mice 0 hours post-infection, ratio of qsec/wt systemic dissemination, p<0.0. Statistical analysis were all determined by Students t test. Fig.. QseC regulates transcriptional expression in vivo of SPI-, sifa and SPI-. (A) Transcription of sipa and sopb in the spleens and livers harvested from x/svj mice 0 postinfection (IP) with WT or the qsec. (B) Transcription of sifa and mgtb in the spleens and livers harvested from x/svj mice 0 post-infection (IP) with WT or the qsec. Statistical significance was determined by Students t test, the * indicates p<0.00. Fig.. Compared transcriptional expression of SL WT in vitro (LB broth) versus in vivo (both spleen and liver). All statistical and expression analyses were compared to LB broth expression levels. Statistical significances were determined by Students t test, the * indicates p<0.00. Downloaded from on July, 0 by guest

31 Fig.. S. Typhimurium infection in Dbh -/- knockout mice. (A) Survival plots of Dbh+/- and Dbh-/- mice infected (IP) with WT S.Typhimurium SL strain. (B) Survival plots of Dbh+/- and Dbh-/- mice infected (IP) with qsec. Statistical analyses were determined by Students t test. 0 Fig.. Differential transcriptional expression of SPI- and SPI- in Dbh-/- mutant mice. (A) Transcription of sipa, sopb, and mgtb in the spleens and livers harvested from WT and Dbh-/- mice 0 hours post-infection (IP) with WT and the qsec. Statistical analyses were compared to expression levels in WT S. Typhimurium in Dbh +/+ mice. Statistical significances were determined by Students t test, the * indicates p<0.00. Downloaded from on July, 0 by guest

32 Downloaded from on July, 0 by guest