The Genetic Basis for the Propensity to Migrate in a Sequestered Population of Rainbow and Steelhead Trout Ben Hecht Columbia River Inter-Tribal Fish Commission March 19, 2013
Migration Cultural, ecological, and economic benefits and services Migratory species declining globally Migratory species purported to have common syndrome (Dingle 2006)
Anadromy Oncorhynchus mykiss smoltification Freshwater Saltwater
Smoltification Parr Environmental cues Physiology Morphology Behavior Smolt Genetic component
Objectives Identify regions of the genome associated with migration in a wild population of O.mykiss which maintains connection to ocean in a wild population of O.mykiss sequestered for last 50 years behind barrier dam Are the same genetic regions associated with migration in both populations? Is migration a derived trait? Is migration locally adapted?
Genetics of Anadromy Genome-Wide Association Study (GWAS) Samples Wild populations of segregating individuals Genetic Markers Thousands distributed throughout the genome Statistics Marker/Trait associations
Samples Washington Idaho Columbia R. Oregon M. F. Teanaway R. N. F. Teanaway R. Brownlee Dam (est. 1958) Teanaway River WDFW Holecek et al. (2012) Barrier Dam
Samples Yakima River, WA Electrofishing by WDFW PIT tagged in Spring 2008 recovered in Summer/Fall Resident RBT = mature w/ gametes Smolt = PIT array detection at downstream dam Upper Mann Creek, ID Screw trap (March-June 2009) Parr = fish >1 yo with gametes and/or parr marks Smolts = silver fish >1 yo w/out parr marks
Samples Smolts Residents Total Yakima R. 29 98 127 Upper Mann Cr. 28 27 55 Total 57 125 182 Smolts Residents Total Female 45 28 73 Male 12 97 109 Total 57 125 182
Genetic Markers Restriction-site Associated DNA (RAD) tag sequencing Thousands of markers distributed throughout the genome OmyY1 molecular sex marker
Genetic Markers 12,073 Polymorphic RAD-tag SNPs 8,219 (68%) SNPs aligned perfectly to loci from Miller et al. (2012) and Hecht et al. (2012) 1,148 (14%) SNPs had been assigned to a linkage group.
Statistics Phenotype No Association A/A A/T T/T Genotype
Statistics Global GWAS Yakima River GWAS Upper Mann Creek GWAS GLM y = XX + Sα + QQ + e Life-History = SSS + sss + SSSSSSSSS + e MLM y = XX + Sα + QQ + ZZ + e Life-History = SSS + sss + SSSSSSSSS + kkkkkkk + e
Results - GWAS Population # Loci # Sig. Loci GLM # Sig. Loci MLM Global 5,019 58 219 Yakima River 4,338 107 50 Upper Mann Creek 6,039 22 138 504 loci detected overall 267 loci detected in Global analyses 123 loci detected in Yakima River analyses 157 loci detected in Upper Mann Creek analyses
Results - Marker Overlap Significant Loci
Omy02 Omy10 0.0 R04930 0.0 R12608 OMM1257 13.3 19.2 25.1 32.2 47.0 52.5 56.9 57.4 57.8 R39115 Omy1INRA R08156 R14304 R38491 R01652 R02962 R15531 R21685 R23663 R21702 R29254 OMM1131 R09588 26.6 39.5 43.5 50.2 59.5 59.8 62.7 R29399 R30558 R35027 R15247 R02310 R35562 OMM1438 R24084 Nichols et al. (2008) Martínez et al. (2011) Global GLM Global MLM Yakima GLM Yakima MLM UMC GLM UMC MLM Linkage map adapted from Miller et al. (2012)
Omy11 Omy12 0.0 8.3 14.2 30.3 38.8 44.3 46.6 47.0 47.5 47.9 56.9 72.3 82.4 88.1 R28660 R07406 R02275 R28384 R29969 R36274 R29914 OMM3099 R07285 R21488 R23618 R27894 R29567 R30555 R14519 R32458 R36340 R18827 OMM1333 OMM5018 R30426 R01365 R03000 R25085 0.0 0.9 1.4 4.8 18.2 23.2 R38774 R17449 R00232 R12248 OMM1656 R37119 R05093 R29412 Martínez et al. (2011) 38.1 OMM5219 Le Bras et al. (2011) Hecht et al. (2012) 53.0 59.7 R12078 R28590 Nichols et al. (2008) Wringe et al. (2010) Le Bras et al. (2011) Martínez et al. (2011) Hecht et al. (2012) 108.1 R05448 Global GLM Global MLM Yakima GLM Yakima MLM UMC GLM UMC MLM Linkage map adapted from Miller et al. (2012)
Omy18 Omy25 0.0 7.2 13.3 29.8 41.6 R08648 R17025 R30518 R31824 OMM5297 R08096 R22726 R05140 R03733 0.0 8.6 12.9 17.2 20.5 R34214 R24327 OMM5138 R12113 R12951 R30168 Nichols et al. (2008) R27950 R01191 21.1 Martínez et al. R17895 (2011) R28704 Hecht et al. (2012) R24445 27.0 R19422 Le Bras et al. (2011) 52.0 57.0 R02446 BX873238 Global GLM Global MLM Yakima GLM Yakima MLM UMC GLM UMC MLM Linkage map adapted from Miller et al. (2012)
Global GLM Global MLM Yakima GLM Yakima MLM UMC GLM Linkage map adapted from Miller et al. (2012) UMC MLM
Conclusions Identified 504 loci associated with the propensity to migrate in two wild populations of O.mykiss Several mapped loci localize to QTL regions previously detected suggesting some conserved mechanisms between populations Some loci are unique to each population, suggesting locally adapted mechanisms
Conclusions UMC continues to exhibit genetic variation for propensity to migrate despite 50 years sequestration above a barrier dam Does this mean if passage to the ocean is restored anadromy in Upper Mann Creek would be reestablished???
Thank You Contact: Ben Hecht Email: hecb@critfc.org Scott M. Blankenship Cherril Bowman Dennis Scarnecchia Rob Lyon IBEST CRC Alex Lipka Garrett McKinney Mike Miller Doug Turnbull GCF Megan Moore Travis Jacobson Andrew Matala
Results - Structure K = 4 MFT NFT TAN UMC-R UMC-S Yakima River Upper Mann Creek Estimated using programs STRUCTURE and CLUMPP using a subset of 1,000 SNPs with 100% genotype frequency and MAF 0.10. Figure generated by program DISTRUCT.
RADseq DNA CCTGCAGG CCTGCAGG CCTGCAGG CCTGCAGG sbfi digestion P1 Ligation Sonication Size Select P2 Ligation PCR
Genotyping by sequencing L1 L2 L3 L4 L5 L6 L7 ID001 LL A/A, LL C/G AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGCTGAGCCATGCTAGACGATGGC AATTCCTGCAGGAATCGTCGTAGCTGATCGATCG AATTCCTGCAGGAATCGTCGTAGCTGATCGATCG AATTCCTGCAGGAATCGTCGTAGCTGATCGATCG AATTCCTGCAGGAATCGTGGTAGCTGATCGATCG AATTCCTGCAGGAATCGTGGTAGCTGATCGATCG AATTCCTGCAGGAATCGTGGTAGCTGATCGATCG AATTCCTGCAGGAATCGTCGTAGCTGATCGATCG ID002 LL T/T, LL C/G GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGCTGAGCCATGCTAGTCGATGGC GGCCAATGCAGGAATCGTCGTAGCTGATCGATCG GGCCAATGCAGGAATCGTGGTAGCTGATCGATCG GGCCAATGCAGGAATCGTCGTAGCTGATCGATCG GGCCAATGCAGGAATCGTCGTAGCTGATCGATCG GGCCAATGCAGGAATCGTGGTAGCTGATCGATCG GGCCAATGCAGGAATCGTGGTAGCTGATCGATCG GGCCAATGCAGGAATCGTCGTAGCTGATCGATCG GGCCAATGCAGGAATCGTGGTAGCTGATCGATCG 26
Results - RAD 5 RAD libraries 38-39 barcoded samples per library Avg. 185M raw & 123M QF reads per library 189 total individuals sequenced Avg. 2.8M QF reads per individual 12,073 polymorphic loci detected RAD Seq Reads Individual QF Reads
Linkage group assignment of significant loci Linkage group Global Yakima Upper Mann Creek GLM MLM GLM MLM GLM MLM Total OmySex 2 2 Omy1 1 1 1 2 1 6 Omy2 2 4 2 1 9 Omy3 4 1 1 6 Omy4 2 1 3 Omy5 0 Omy6 1 2 3 Omy7 1 1 2 Omy8 5 2 7 Omy9 1 1 Omy10 1 2 1 4 Omy11 1 8 3 2 14 Omy12 2 3 2 1 1 9 Omy13 2 1 1 4 Omy14 1 1 Omy15 2 1 1 4 Omy16 1 3 2 6 Omy17 1 1 2 Omy18 1 4 1 6 Omy19 1 1 2 Omy20 1 1 1 1 4 Omy21 1 1 2 Omy22 1 1 2 4 Omy23 2 2 4 Omy24 1 1 Omy25 1 6 7 Omy26 0 Omy27 1 1 1 2 5 Omy28 1 1 Total 12 49 22 11 7 18 119 Linkage group assignment based on alignment of RAD markers to Miller et al. (2012) and Hecht et al. (2012)