Enhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures

Nature Methods Enhanced zinc-finger-nuclease activity with improved obligate heterodimeric architectures Yannick Doyon, Thuy D Vo, Matthew C Mendel, Shon G Greenberg, Jianbin Wang, Danny F Xia, Jeffrey C Miller, Fyodor D Urnov, Philip D Gregory & Michael C Holmes Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7 Supplementary Figure 8 Supplementary Figure 9 Supplementary Figure 10 Supplementary Figure 11 Supplementary Figure 12 Supplementary Figure 13 Supplementary Figure 14 Supplementary Figure 15 Supplementary Table 1 Supplementary Table 2 Supplementary Note 1 Supplementary Note 2 Genetic screening scheme. Improved activity and specificity of the ELD:KKK and ELD:KKR ZFN variants. ZFN variants ELD:KKK and ELD:KKR are more active than the original obligate heterodimeric EL:KK. Preservation of the obligate heterodimer specificity. Characterization of ZFN variants activity at heterodimer off-target sites. Activity of obligate heterodimeric Fok I variants at the CCR5 locus. Anti-homodimerization is further improved by the introduced mutations. The N496D:H537R mutant pair enhance the activity of the DA:RV architecture. The N496D:H537R mutant pair enhance the activity of the D:R architecture. Orthogonal behavior of the ELD:KKR and DAD:RVR architectures. Elimination of transheterodimer off-target activity using combinations of the ELD:KKR and DAD:RVR architectures. Additive effect of the ELD:KKR and Sharkey FokI domains on ZFN activity. Additive effect of the DAD:RVR and Sharkey FokI domains on ZFN activity. Preservation of the obligate heterodimer specificity in the ELD:KKR and DAD:RVR architectures combined with the Sharkey FokI domains. Unprocessed scans of full-length gels and blots for the primary figures. Isolated cold-sensitive mutants. Primers used for the Cel-1 assays. ZFN coding sequences. RFLP donor vector sequence.

Supplementary Figure 1 Genetic screening scheme. PHO CCR5-L CCR5-L natmx HO5 MEL CCR5-L CCR5-L URA3 kanmx EL1 Nat r Kan r 5-FOA s pho5 (a) Gap repair and ZFN induction at 22 o C CCR5-L FokI* CCR5-L FokI* PHO5 MEL1 PHO CCR5-L CCR5-L natmx HO5 MEL CCR5-L CCR5-L URA3 kanmx EL1 Nat s Kan s Ura - o (Active FokI at non-permissive t ) Nat r Kan r Ura + (Potential cs + inactive FokI) o (b) Recovery and selection in Kan, Nat, Ura- media at 22 C CCR5-L FokI* PHO CCR5-L CCR5-L natmx HO5 MEL CCR5-L CCR5-L URA3 kanmx EL1 (c) Selection and detection on 5-FOA, X-Phos at 37 o C Nat r Kan r 5-FOA s (Potential cs + inactive FokI) CCR5-L FokI* CCR5-L FokI* PHO CCR5-L CCR5-L natmx HO5 MEL CCR5-L CCR5-L URA3 kanmx EL1 PHO5 MEL1 5-FOA s pho5 (Inactive FokI) 5-FOA r PHO5 (cs FokI) (d) Rescue plasmid, confirm cs phenotype, sequence FokI FokI cs mutants

(a) Following gap repair, ZFN expression was induced at the non-permissive temperature of 22 C. (b) After recovery, the cells were incubated in KAN (G418), NAT and Ura - media to eliminate all cells containing active ZFNs. This step selected for potential coldsensitive as well as for inactive mutants. (c) Next, the cells were shifted to 37 C (permissive temperature) and plated on media containing 5-FOA and X-Phos (colorimetric Pho5 substrate). Only cells containing a cold-sensitive ZFN should form blue colonies. (d) The plasmids from these cells were then isolated and the reporter strain retransformed to confirm the cold-sensitive phenotype. The mutations were identified by direct sequencing of the FokI domain.

Supplementary Figure 2 Improved activity and specificity of the ELD:KKK and ELD:KKR ZFN variants. a EL ELD ELD ELE ELE GFP KK KKK KKR KKK KKR 1 2 3 4 5 6 7 8 9 10 11 12 13 14 TP53BP1 (Day 3) * * 5 6 6 5 9 8 10 10 6 8 6 7 TP53BP1 (Day 10) * * b <1 <1 2 2 6 5 4 5 3 5 3 3 1 2 3 4 5 6 7 8 9 10 11 12 13 14 α-nfκb p65 (a) Expression plasmids encoding the indicated ZFN variants targeting TP53BP1 were transfected (400 ng) in duplicate into K562 and the cells were harvested 3 days posttransfection. Non-radioactive Cel-1 assay was used to determine the frequency of ZFNinduced insertions and deletions (indels). An aliquot of the cells was also cultivated for an additional week to determine the stability of the modified cells in extended cultures. (b) ZFN expression was monitored by western blot using the FLAG antibody and α- NFκB p65 was used as a loading control. * Indicates non-specific cutting by the Cel-1 nuclease. Arrows indicate the cleavage products of the predicted size.

Supplementary Figure 3 ZFN variants ELD:KKK and ELD:KKR are more active than the original obligate heterodimeric EL:KK. a RIPK1 RIPK1 A RIPK1 B GFP EL:KK ELD:KKR ELD:KKK GFP EL:KK ELD:KKR ELD:KKK 7 13 12 20 38 56* b RSK4 37 30 GFP A B C D E GFP A B C D E ZFN EL/KK 34 3 <1 <1 25 37 GFP A B C D E GFP 57* 14 7 3 53* 30 A B C D E ZFN ELD/KKR 58* 9 4 3 51* 70* 17 8 10 62* (a) Expression plasmids encoding the indicated ZFN variants targeting two different sites in the RIPK1 gene were transfected (400 ng) into K562 and the cells were harvested 3 days post-transfection. Non-radioactive Cel-1 assay was used to determine the frequency of ZFN-induced insertions and deletions (indels). (b) Expression plasmids encoding ZFN pairs (A-B-C-D-E) targeting five different sites in the RSK4 gene were transfected (400 ng) into K562 and the cells were incubated for 3 days at 37 C (left panel) or 30 C (right panel) for 3 days before harvest. Cel-1 assay was used to determine the frequency of ZFN-induced insertions and deletions (indels). * Indicates an underestimated value due to the saturation of the assay.

Supplementary Figure 4 Preservation of the obligate heterodimer specificity. a EL ELD KK KKK KKR GFP EL ELD KK KKK KKR 1 2 3 4 5 6 7 8 9 10 11 12 13 14 ZFN-R ZFN-L b 41 42 α-nfκb p65 (a) Forced homodimerization of the indicated FokI domains using the targeting ZFNs was assayed by transfection of the expression plasmids encoding the indicated ZFN variants (400 ng) in duplicate into K562 cells. The Cel-1 assay was used to determine the frequency of ZFN-induced indels at the heterodimer site. (b) ZFN expression was monitored by western blot using the FLAG antibody and α-nfκb p65 was used as a loading control.

Supplementary Figure 5 Characterization of ZFN variants activity at heterodimer off-target sites. a EL ELD ELD GFP KK KKK KKR 1 2 3 4 5 6 7 8 9 (80 ng) b 19 19 7 6 9 11 14 15 (400 ng) c 39 42 27 27 28 27 30 34 TRIM26 [Intron 1] (400 ng) * d 10 13 4 5 7 7 9 10 Chr.1 [Intergenic] (400 ng) 8 10 3 3 3 3 3 5 (a) and (b) are the same gels shown in Figure 3c. (c) and (d) Cleavage at TRIM26 and Chr.1 in the cells transfected with 400 ng of the indicated ZFN expression plasmids was assayed by the Cel-1 assay to determine the frequency of ZFN-induced indels at these heterodimer off-target sites for the -targeting ZFNs. * Indicates non-specific cutting by the Cel-1 nuclease. Arrows indicate the cleavage products of the predicted size.

Supplementary Figure 6 Activity of obligate heterodimeric FokI variants at the CCR5 locus. a EL ELD ELD DA EA GFP KK KKK KKR RV KV 1 2 3 4 5 6 7 8 9 10 11 12 13 14 ZFN-L ZFN-R CCR5 b 22 25 17 17 22 24 22 24 3 4 22 23 1 2 3 4 5 6 7 8 9 10 11 12 13 14 α-nfκb p65 (a) Expression plasmids encoding the indicated ZFN variants targeting CCR5 were transfected (80 ng) into K562 and the cells were harvested 3 days post-transfection. The Cel-1 assay was used to determine the frequency of ZFN-induced insertions and deletions (indels). (b) ZFN expression was monitored by western blot using the FLAG antibody and α-nfκb p65 was used as a loading control.

Supplementary Figure 7 Anti-homodimerization is further improved by the introduced mutations. a EL ELD KK KKK KKR GFP EL ELD KK KKK KKR 1 2 3 4 5 6 7 8 9 10 11 12 13 14 ZFN-L KIK KIR ZFN-R KIK KIR 15 16 17 18 CCR5 57^ 53^ 9 9 6 5 % 39Indels 42 32 35 ABLIM2 (ZFN-L) * * 9 11 PGC (ZFN-R) b 10 15 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 α-nfκb p65 c 400 200 ng EL ELD ED EL ELD ZFN-L ED GFP EL ELD ED EL ELD ZFN-R ED 1 2 3 4 5 6 77 88 9 10 11 12 CCR5 d 10 9 5 5 403 413 1 1 % 22Indels 23 1 2 3 4 5 6 77 88 9 10 11 12 α-nfκb p65

(a) Forced homodimerization of CCR5 targeting ZFNs was assayed by transfection of expression plasmids encoding the indicated ZFN variants (400 ng) in duplicate into K562 cells and the Cel-1 assay was used to determine the frequency of ZFN-induced indels at the CCR5 heterodimer target, a CCR5-L ZFN homodimer (ABLIM2), and a CCR5-R homodimer (PGC) off-target sites. * Indicates the presence of a SNP that results in nonspecific cleavage by the Cel-1 nuclease. Arrows indicate the cleavage products of the predicted size. ^ Indicates an underestimated value due to the saturation of the assay (b) ZFN expression was monitored by western blot using the FLAG antibody and α-nfκb p65 was used as a loading control. (c) High (400 ng) and low (200 ng) amounts of expression plasmids encoding the CCR5-targeting ZFN variants were transfected in duplicate into K562s, the cells were harvested 3 days post-transfection, and the Cel-1 assay was used to determine the frequency of ZFN-induced indels at the CCR5 heterodimer site. (d) ZFN expression was monitored as in (b).

Supplementary Figure 8 The N496D:H537R mutant pair enhances the activity of the DA:RV architecture. a ELD ELD DA DAD DAD GFP KKK KKR RV RVK RVR 1 2 3 4 5 6 7 8 9 10 11 12 13 14 ZFN-L ZFN-R 42 41 35 33 38 33 4 3 6 7 13 12 α-nfκb p65 b ELD DA DAD GFP KKR RV RVR 1 2 3 4 5 6 7 8 ZFN-L ZFN-R CCR5 16 15 4 5 9 10 c ELD DA DAD GFP KKR RV RVR 1 2 3 4 5 6 7 8 α-nfκb p65 ZFN-L ZFN-R CXCR4 18 20 4 4 11 11 α-nfκb p65

(a) Expression plasmids encoding the indicated ZFN variants (400 ng) were transfected in duplicate into K562 and the cells were harvested 3 days post-transfection. The Cel-1 assay was used to determine the frequency of ZFN-induced insertions and deletions. ZFN expression level was monitored by western blot using the FLAG antibody and α-nfκβ p65 was used as a loading control. (b) and (c) Expression plasmids encoding the indicated CCR5 and CXCR4 ZFN variants (80 ng) were transfected in duplicate into K562 and processed as in (a).

Supplementary Figure 9 The N496D:H537R mutant pair enhances the activity of the D:R architecture. a ELD D DD GFP KKR R RR 1 2 3 4 5 6 7 ZFN-L ZFN-R (80 ng) 15 14 3 2 6 6 α-nfκb p65 b ELD D DD GFP KKR R RR 1 2 3 4 5 6 7 ZFN-L ZFN-R (400 ng) 36 36 19 20 23 23 α-nfκb p65 (a) and (b) Expression plasmids encoding the indicated ZFN variants (80 and 400 ng) were transfected in duplicate into K562 and the cells were harvested 3 days posttransfection. The Cel-1 assay was used to determine the frequency of ZFN-induced insertions and deletions. ZFN expression level was monitored by western blot using the FLAG antibody and α-nfκβ p65 was used as a loading control.

Supplementary Figure 10 Orthogonal behavior of the ELD:KKR and DAD:RVR architectures. a Heterodimers Homodimers Trans-Heterodimers ELD DAD ELD KKR DAD RVR ELD ELD DAD RVR GFP KKR RVR ELD KKR DAD RVR RVR DAD KKR KKR 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 ZFN-L ZFN-R CXCR4 b 40 40 40 38 4 4 1 1 α-nfκb p65 (a) Forced homodimerization and transheterodimerization of CXCR4 targeting ZFNs was assayed by transfection of expression plasmids encoding the indicated FokI variants (400 ng) in duplicate into K562 cells and the Cel-1 assay was used to determine the frequency of ZFN-induced indels 3 days post transfection. (b) ZFN expression was monitored by western blot using the FLAG antibody and α-nfκb p65 was used as a loading control.

Supplementary Figure 11 Elimination of transheterodimer off-target activity using combinations of the ELD:KKR and DAD:RVR architectures. ( ( CCR5 CCR5-L ) + CCR5-R CXCR4 CXCR4-L ) + CXCR4-R 37 C 30 C ELD ELD ELD ELD ELD ELD KKR KKR KKR KKR KKR KKR ELD REL DAD ELD REL DAD GFP KKR DKK RVR GFP KKR DKK RVR 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 CCR5 ZFN-L CCR5 ZFN-R CXCR4 ZFN-L CXCR4 ZFN-R 25 24 29 33 30 32 30 35 40 37 51* 53* 50* 52* 52* 54* 28 27 35 39 33 37 32 25 31 33 55* 55* 53* 59* 52 * 57* C1ORF210 CCR5-L ) + CXCR4-R ( TBC1D5 ( CCR5-L ) + CXCR4-R CD274 ( CCR5-R ) + CXCR4-L FRYL ( CCR5-R + CXCR4-L ) 3 2 2 3 1 1 6 6 14 15 7 10 13 10 10 14 5 7 25 24 39 41 32 34 4 3 14 12 15 14 13 12

K562 cells were transfected in duplicate with various combinations of expression plasmids encoding the the CCR5 and CXCR4 targeting ZFNs (400 ng) and incubated at either 37 C or 30 C for 3 days. The Cel-1 assay was used to determine the frequency of ZFN-induced indels at both targets and four transheterodimer off-targets. The monomers that can potentially combine to form transheterodimers are indicated in parenthesis below the cleavage site. Note that in lanes 6 and 7 we attempted to block transheterodimerization by adding the N496D mutation on the KK domain (DKK) and the H537R mutation on the EL domain (REL) on the CXCR4-targeting ZFN. This created a situation where unwanted transheterodimer formation would be decreased by the presence either two N496D or H537R mutations in the heterodimer. As such, the following potential heterodimers ELD:DKK and KKR:REL could form with a decrease efficiency. This strategy resulted in a modest but detectable reduction of transheterodimerization, especially at weak off-target sites (e.g. FRYL at 30 C and C1ORF210). Note that the transfection of the two wild-type ZFN pairs resulted in decreased cell growth/survival and a resulting drop in on target activity. This was more pronounced under cold shock conditions. * Indicates an underestimated value due to the saturation of the assay.

Supplementary Figure 12 Additive effect of the ELD:KKR and Sharkey FokI domains on ZFN activity. a -S EL EL-S ELD ELD-S GFP -S KK KK-S KKR KKR-S 1 2 3 4 5 6 7 8 9 10 11 12 13 ZFN-L ZFN-R KDR (Day 3) 26 28 34 38 8 8 39 36 26 28 50 48 KDR (Day 10) b 9 11 15 19 3 4 27 24 16 17 38 36 1 2 3 4 5 6 7 8 9 10 11 12 13 α-nfκb p65 c -S EL EL-S GFP -S KK KK-S 1 2 3 4 5 6 7 8 9 ELD ELD-S KKR KKR-S 10 11 12 13 ZFN-L ZFN-R (Day 3) 18 19 22 24 6 7 13 15 11 12 20 20 (Day 10) d 9 10 16 17 4 5 13 13 10 10 17 18 1 2 3 4 5 6 7 8 9 10 11 12 13 α-nfκb p65

(a) Expression plasmids encoding the indicated KDR ZFN variants (400 ng) were transfected in duplicate into K562 and the cells were harvested 3 days post-transfection. The Cel-1 assay was used to determine the frequency of ZFN-induced insertions and deletions. An aliquot of the cells was also cultivated for an additional week to determine the stability of the modified cells in extended cultures. (b) ZFN expression level was monitored by western blot using the FLAG antibody and α-nfκβ p65 was used as a loading control. (c) and (d) Same as (a) and (b) but using the expression plasmids encoding the -targeting ZFNs at a 80 ng dose. S indicates the Sharkey mutations (S418P, K441E).

Supplementary Figure 13 Additive effect of the DAD:RVR and Sharkey FokI domains on ZFN activity. a ELD DA DA-S DAD GFP KKR RV RV-S RVR 1 2 3 4 5 6 7 8 9 DAD-S RVR-S 10 11 ZFN-L ZFN-R b 48 46 4 3 7 10 8 12 15 14 1 2 3 4 5 6 7 8 9 10 11 α-nfκb p65 (a) Expression plasmids encoding the indicated ZFN variants (400 ng) were transfected in duplicate into K562 and the cells were harvested 3 days post-transfection. The Cel-1 assay was used to determine the frequency of ZFN-induced insertions and deletions. (b) ZFN expression level was monitored by western blot using the FLAG antibody and α-nfκβ p65 was used as a loading control. S indicates the Sharkey mutations (S418P, K441E).

a Supplementary Figure 14 Preservation of the obligate heterodimer specificity in the ELD:KKR and DAD:RVR architectures combined with the Sharkey FokI domains. GFP -S -S EL EL EL-S EL-S ELD ELD ELD-S ELD-S KK KK KK-S KK-S KKR KKR KKR-S KKR-S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 ZFN-L ZFN-R b 41 43 51 47 α-nfκb p65 c -S DA-S RV-S DAD-S GFP -S DA-S RV-S DAD-S 1 2 3 4 5 6 7 8 9 RVR-S RVR-S 10 11 ZFN-L ZFN-R 49 50 d 1 2 3 4 5 6 7 8 9 10 11 α-nfκb p65 (a) and (c) Forced homodimerization of the indicated FokI domains using the targeting ZFNs was assayed by transfection of expression plasmids encoding the indicated ZFN variants (400 ng) in duplicate into K562 cells. The Cel-1 assay was used to determine the frequency of ZFN-induced indels at the heterodimer site 3 days post transfection. (b) and (d) ZFN expression was monitored by western blot using the FLAG antibody and α-nfκb p65 was used as a loading control. S indicates the Sharkey mutations (S418P, K441E).

Supplementary Figure 15 Unprocessed scans of full-length gels and blots for the primary figures. Figure 1d - I499T I538F I538T Q486L Q486L K448M N496D E484V H537L A482T K559T L563M Q531R Q531R V512M N500S K402R K427M N578S N500S K469M N476D N476K G474S G474A D467E Figure 3a GFP EL ELD ELD KK KKK KKR GFP EL ELD ELD KK KKK KKR Anti-FLAG KDR (Day 3) KDR (Day 20) Anti-H3 Figure 3b GFP EL ELD ELD KK KKK KKR Figure 4a Anti-FLAG 400 200 100 ng Mock GFP EL:KK ELD:KKR ELD:KKK EL:KK ELD:KKR ELD:KKK EL:KK ELD:KKR ELD:KKK Anti-NFκB p65 (Residual FLAG signal) Day 3 Membrane was first probed with anti-flag, and then incubated with anti-nfkb p65. Figure 3c,d ZFN Donor and ZFN GFP EL ELD ELD KK KKK KKR Donor EL KK KKR ELD EL KK ELD KKR Day 10 (80 ng) ZFN Donor and ZFN GFP EL ELD ELD KK KKK KKR Donor EL KK KKR ELD EL KK ELD KKR (400 ng)

Supplementary Figure 15 Unprocessed scans of full-length gels and blots for the primary figures. Figure 5b Figure 5d GFP EL ELD ELD DA KK KKK KKR RV EA KV ZFN-L ZFN-R GFP ELD DA EA KKK ELD DA EA GFP KKK KKR KKR RV RV KV KV ZFN L ZFN R NRC31 Figure 5e RCSD1 (ZFN-R) GFP ELD DA EA KKK ELD DA EA KKK KKR KKR RV RV KV KV ZFN L ZFN R Anti-NFκB p65 Anti-FLAG SREBF2 (ZFN-L) Membrane was coincubated with anti-flag and anti-nfκb p65. Figure 5c GFP EL ELD ELD DA KK KKK KKR RV EA KV ZFN-L ZFN-R Anti-NFκB p65 Anti-FLAG Anti-NFκB p65 Anti-FLAG Membrane was coincubated with anti-flag and anti-nfκb p65. Two different exposures of the same membrane are shown. Top gels were scanned for the FLAG and bottom gels scanned for NFκB p65

Supplementary Table 1 Isolated cold-sensitive mutants. Mutations Isolates Secondary structure I499T 7 1 loop P2 I538F 11 1 5 I538T 11 3 5 Q486L 5 2 4 Q486L 5 K448M 4 4, loop P1 N496D 6 E484V 4 3 loop P2, 4 H537L 10 A482T 3 K559T L563M 1 5, 4 Q531R 9 2 5 Q531R 9 V512M 1 5 N500S 8 K402R K427M N578S 1 loop P2 N500S 8 K469M* 1 loop P2 N476D 2 1 unannotated N476K 2 1 unannotated G474S 1 4 unannotated G474A 1 5 unannotated D467E* 1 catalytic triad The numbers in the Isolates column refer to the number of independent isolates of each mutation. The position of the mutations (indicated by a superscript number and shown in Figure 2a,b) relative to the secondary structure is based on the FokI crystal structure 19. * Denotes a residue in the catalytic triad. The G474A/S and N476D/K mutations are predicted to occur in a region of the protein that is in close proximity to the DNA, but are also near residue Ile479 which makes a van der Waals contact with Arg447 of the opposite monomer 19.

Supplementary Table 2 Primers used for the Cel-1 assays. KDR RCSD1 SrebF2 53BP1 RIPK1-A RIPK1-B CCR5 ABLIM2 PGC RSK4 TRIM26 Chr. 1 CXCR4 C1orf210 TBC1D5 CD274 FRYL F AGTATGGGGCCCTGTTGAAT R TCCCACTGACCTTCTATTATGAAA F TCATAACACTGTTCTTCCCCTTCTTTAGCC R TCAAAACACACACTACCTTCCACTGCTC F TCCTTGCCCTCAAGATTCAT R CTGCTCCCACAGCTTAGGTC F AGCGACTGCAGAAGCAAGTT R TCTAACCAGCTGGGTGACCT F GGGGACAGATAGCTTTAAACACC R TTGGTGAGTGATACCTTGTTTGA F TTCTAACGCTTCTGGCCTGT R ATGCTAACGAGCTGCAAACA F TGTGGGAAGAGGACCATCTC R GGTAGTTGGCTTCGTCTTGG F AAGATGGATTATCAAGTGTCAAGTCC R CAAAGTCCCACTGGGCG F CGATGACTCTGAGGTCTACTCG R CAAGTGAACACATGGTTTGCAG F AAGGCAGGAGACCCAGCATTTC R CTACACAGGACTTTCCCTTGGAGC F GGACAAAAGACAGAAAATGTGAAA R TGCAAAAATTCATGAAATACACTG F GGAGTGGTACTGGGCGTGTC R TTCAGGAGGTTTAGAGACCATCAAA F GCAGCAACCTGCCAGCTCTA R CCCATTTGCCAACCAAGAGA F CAGTCAACCTCTACAGCAGTGTCC R GGAGTGTGACAGCTTGGAGATG F CCTCTGTCCCTGAGGTTCAA R TGCTGGTAGGATTTGTGCTG F TTCCCTTCTTGAAGGCTCAC R TTGTCAGCATGGCATTCAGT F TGGAGAGGCACTAAGAGGGA R CTCACAGCCACTCTTCCAGA F CCAACCCAACTGCAGGTATATTA R GGATTAGCTTTGAAAAGGGAGG

Supplementary Note 1 ZFN coding sequences TP53BP1-L (ELD FokI domain) Target sequence (5 to 3 ) GTTCAGGATTGG atggactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgac M D Y K D H D G D Y K D H D I D Y K D D gatgacaagatggcccccaagaagaagaggaaggtcggcatccacggggtacccgccgct D D K M A P K K K R K V G I H G V P A A atggctgagaggcccttccagtgtcgaatctgcatgcgtaacttcagtcgctccgaccac M A E R P F Q C R I C M R N F S R S D H ctgtccacccacatccgcacccacaccggcgagaagccttttgcctgtgacatttgtggg L S T H I R T H T G E K P F A C D I C G aggaaatttgccacctccgccaacctgtcccgccataccaagatacacacgggatctcag R K F A T S A N L S R H T K I H T G S Q aagcccttccagtgtcgaatctgcatgcgtaacttcagtcgctccgacaacctgtccgag K P F Q C R I C M R N F S R S D N L S E cacatccgcacccacaccggcgagaagccttttgcctgtgacatttgtgggaggaaattt H I R T H T G E K P F A C D I C G R K F gccacctccggctccctgacccgccataccaagatacacctgcggggatcccagctggtg A T S G S L T R H T K I H L R G S Q L V aagagcgagctggaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccac K S E L E E K K S E L R H K L K Y V P H gagtacatcgagctgatcgagatcgccaggaacagcacccaggaccgcatcctggagatg E Y I E L I E I A R N S T Q D R I L E M aaggtgatggagttcttcatgaaggtgtacggctacaggggaaagcacctgggcggaagc K V M E F F M K V Y G Y R G K H L G G S agaaagcctgacggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtg R K P D G A I Y T V G S P I D Y G V I V gacacaaaggcctacagcggcggctacaatctgcctatcggccaggccgacgagatggag D T K A Y S G G Y N L P I G Q A D E M E agatacgtggaggagaaccagacccgggataagcacctcaaccccaacgagtggtggaag R Y V E E N Q T R D K H L N P N E W W K gtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggc V Y P S S V T E F K F L F V S G H F K G aactacaaggcccagctgaccaggctgaaccacatcaccaactgcaatggcgccgtgctg N Y K A Q L T R L N H I T N C N G A V L agcgtggaggagctgctgatcggcggcgagatgatcaaagccggcaccctgacactggag S V E E L L I G G E M I K A G T L T L E gaggtgcggcgcaagttcaacaacggcgagatcaacttcagatct E V R R K F N N G E I N F R S TP53BP1-R (KKR FokI domain) Target sequence (5 to 3 ) GCTGGAGAAGAAcGAGGAG atggactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgac M D Y K D H D G D Y K D H D I D Y K D D gatgacaagatggcccccaagaagaagaggaaggtcggcattcatggggtacccgccgct D D K M A P K K K R K V G I H G V P A A

atggctgagaggcccttccagtgtcgaatctgcatgcgtaacttcagtcagtccggcgcc M A E R P F Q C R I C M R N F S Q S G A ctggcccgccacatccgcacccacaccggcgagaagccttttgcctgtgacatttgtggg L A R H I R T H T G E K P F A C D I C G aggaaatttgcccgctccgacaacctgacccgccataccaagatacacacgggcggaggc R K F A R S D N L T R H T K I H T G G G ggaagccaacggcccttccagtgtcgaatctgcatgcgtaacttcagtcagtccggcaac G S Q R P F Q C R I C M R N F S Q S G N ctggcccgccacatccgcacccacaccggcgagaagccttttgcctgtgacatttgtggg L A R H I R T H T G E K P F A C D I C G aggaaatttgcccagtccggcaacctggcccgccataccaagatacacacgggatctcag R K F A Q S G N L A R H T K I H T G S Q aagcccttccagtgtcgaatctgcatgcgtaacttcagtcagtccggccacctgcagcgc K P F Q C R I C M R N F S Q S G H L Q R cacatccgcacccacaccggcgagaagccttttgcctgtgacatttgtgggaggaaattt H I R T H T G E K P F A C D I C G R K F gcccagtcctccgacctgcgccgccataccaagatacacctgcggggatcccagctggtg A Q S S D L R R H T K I H L R G S Q L V aagagcgagctggaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccac K S E L E E K K S E L R H K L K Y V P H gagtacatcgagctgatcgagatcgccaggaacagcacccaggaccgcatcctggagatg E Y I E L I E I A R N S T Q D R I L E M aaggtgatggagttcttcatgaaggtgtacggctacaggggaaagcacctgggcggaagc K V M E F F M K V Y G Y R G K H L G G S agaaagcctgacggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtg R K P D G A I Y T V G S P I D Y G V I V gacacaaaggcctacagcggcggctacaatctgcctatcggccaggccgacgagatgcag D T K A Y S G G Y N L P I G Q A D E M Q agatacgtgaaggagaaccagacccggaataagcacatcaaccccaacgagtggtggaag R Y V K E N Q T R N K H I N P N E W W K gtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggc V Y P S S V T E F K F L F V S G H F K G aactacaaggcccagctgaccaggctgaaccgcaaaaccaactgcaatggcgccgtgctg N Y K A Q L T R L N R K T N C N G A V L agcgtggaggagctgctgatcggcggcgagatgatcaaagccggcaccctgacactggag S V E E L L I G G E M I K A G T L T L E gaggtgcggcgcaagttcaacaacggcgagatcaacttc E V R R K F N N G E I N F -L (ELD FokI domain) Target sequence (5 to 3 ) GTTGAGGAGCTG atggactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgac M D Y K D H D G D Y K D H D I D Y K D D gatgacaagatggcccccaagaagaagaggaaggtgggcatccacggggtacccgagagg D D K M A P K K K R K V G I H G V P E R cccttccagtgtcgaatctgcatgcgtaacttcagtgacagctggaacctggtccagcac P F Q C R I C M R N F S D S W N L V Q H atccgcacccacacaggcgagaagccttttgcttgcgacatttgtgggaggaagtttgcc I R T H T G E K P F A C D I C G R K F A cgctccgccaacctgacccgccataccaagatacacacgggatctcagaagcccttccag R S A N L T R H T K I H T G S Q K P F Q tgtcgaatctgcatgcgtaacttcagtacctccggcaacctgacccgccacatccgcacc

C R I C M R N F S T S G N L T R H I R T cacacaggcgagaagccttttgcctgtgacatttgtgggaggaagtttgccacctccggc H T G E K P F A C D I C G R K F A T S G tccctgacccgccataccaagatacacctgcggggatcccagctggtgaagagcgagctg S L T R H T K I H L R G S Q L V K S E L gaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccacgagtacatcgag E E K K S E L R H K L K Y V P H E Y I E ctgatcgagatcgccaggaacagcacccaggaccgcatcctggagatgaaggtgatggag L I E I A R N S T Q D R I L E M K V M E ttcttcatgaaggtgtacggctacaggggaaagcacctgggcggaagcagaaagcctgac F F M K V Y G Y R G K H L G G S R K P D ggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtggacacaaaggcc G A I Y T V G S P I D Y G V I V D T K A tacagcggcggctacaatctgcctatcggccaggccgacgagatggagagatacgtggag Y S G G Y N L P I G Q A D E M E R Y V E gagaaccagacccgggataagcacctcaaccccaacgagtggtggaaggtgtaccctagc E N Q T R D K H L N P N E W W K V Y P S agcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggcaactacaaggcc S V T E F K F L F V S G H F K G N Y K A cagctgaccaggctgaaccacatcaccaactgcaatggcgccgtgctgagcgtggaggag Q L T R L N H I T N C N G A V L S V E E ctgctgatcggcggcgagatgatcaaagccggcaccctgacactggaggaggtgcggcgc L L I G G E M I K A G T L T L E E V R R aagttcaacaacggcgagatcaacttcagatct K F N N G E I N F R S -R (KKR FokI domain) Target sequence (5 to 3 ) CAACAGGACCAC atgagatctgactacaaagaccatgacggtgattataaagatcatgacatcgattacaag M R S D Y K D H D G D Y K D H D I D Y K gatgacgatgacaagatggcccccaagaagaagaggaaggtgggcattcatggggtaccc D D D D K M A P K K K R K V G I H G V P gccgccatggcggagaggccctacgcatgccctgtcgagtcctgcgatcgccgcttttct A A M A E R P Y A C P V E S C D R R F S acctcgagggcccttaccgcacatatccgcatccacaccggtgagaagcccttccagtgt T S R A L T A H I R I H T G E K P F Q C cgaatctgcatgcgtaacttcagtgacagggccaacctgagccgccacatccgcacccac R I C M R N F S D R A N L S R H I R T H acaggatctcagaagcccttccagtgtcgaatctgcatgcgtaacttcagtcgctccgac T G S Q K P F Q C R I C M R N F S R S D aacctgtccgagcacatccgcacccacacaggcgagaagccttttgcttgcgacatttgt N L S E H I R T H T G E K P F A C D I C gggaggaagtttgccgagcgcgccaaccggaactcgcataccaagatacacctgcgggga G R K F A E R A N R N S H T K I H L R G tcccagctggtgaagagcgagctggaggagaagaagtccgagctgcggcacaagctgaag S Q L V K S E L E E K K S E L R H K L K tacgtgccccacgagtacatcgagctgatcgagatcgccaggaacagcacccaggaccgc Y V P H E Y I E L I E I A R N S T Q D R atcctggagatgaaggtgatggagttcttcatgaaggtgtacggctacaggggaaagcac I L E M K V M E F F M K V Y G Y R G K H ctgggcggaagcagaaagcctgacggcgccatctatacagtgggcagccccatcgattac L G G S R K P D G A I Y T V G S P I D Y ggcgtgatcgtggacacaaaggcctacagcggcggctacaatctgcctatcggccaggcc

G V I V D T K A Y S G G Y N L P I G Q A gacgagatgcagagatacgtgaaggagaaccagacccggaataagcacatcaaccccaac D E M Q R Y V K E N Q T R N K H I N P N gagtggtggaaggtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggc E W W K V Y P S S V T E F K F L F V S G cacttcaagggcaactacaaggcccagctgaccaggctgaaccgcaaaaccaactgcaat H F K G N Y K A Q L T R L N R K T N C N ggcgccgtgctgagcgtggaggagctgctgatcggcggcgagatgatcaaagccggcacc G A V L S V E E L L I G G E M I K A G T ctgacactggaggaggtgcggcgcaagttcaacaacggcgagatcaacttc L T L E E V R R K F N N G E I N F CXCR4-L (ELD FokI domain) Target sequence (5 to 3 ) GTAGAAGCGGTC atggactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgac M D Y K D H D G D Y K D H D I D Y K D D gatgacaagatggcccccaagaagaagaggaaggtcggcatccacggggtacccgccgct D D K M A P K K K R K V G I H G V P A A atggctgagaggcccttccagtgtcgaatctgcatgcgtaacttcagtgaccgctccgcc M A E R P F Q C R I C M R N F S D R S A ctgtcccgccacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtggg L S R H I R T H T G E K P F A C D I C G aggaagtttgcccgctccgacgacctgacccgccataccaagatacacacgggatctcag R K F A R S D D L T R H T K I H T G S Q aagcccttccagtgtcgaatctgcatgcgtaacttcagtcagtccggcaacctggcccgc K P F Q C R I C M R N F S Q S G N L A R cacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtgggaggaagttt H I R T H T G E K P F A C D I C G R K F gcccagtccggctccctgacccgccataccaagatacacctgcggggatcccagctggtg A Q S G S L T R H T K I H L R G S Q L V aagagcgagctggaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccac K S E L E E K K S E L R H K L K Y V P H gagtacatcgagctgatcgagatcgccaggaacagcacccaggaccgcatcctggagatg E Y I E L I E I A R N S T Q D R I L E M aaggtgatggagttcttcatgaaggtgtacggctacaggggaaagcacctgggcggaagc K V M E F F M K V Y G Y R G K H L G G S agaaagcctgacggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtg R K P D G A I Y T V G S P I D Y G V I V gacacaaaggcctacagcggcggctacaatctgcctatcggccaggccgacgagatggag D T K A Y S G G Y N L P I G Q A D E M E agatacgtggaggagaaccagacccgggataagcacctcaaccccaacgagtggtggaag R Y V E E N Q T R D K H L N P N E W W K gtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggc V Y P S S V T E F K F L F V S G H F K G aactacaaggcccagctgaccaggctgaaccacatcaccaactgcaatggcgccgtgctg N Y K A Q L T R L N H I T N C N G A V L agcgtggaggagctgctgatcggcggcgagatgatcaaagccggcaccctgacactggag S V E E L L I G G E M I K A G T L T L E gaggtgcggcgcaagttcaacaacggcgagatcaacttcagatct E V R R K F N N G E I N F R S

CXCR4-R (KKR FokI domain) Target sequence (5 to 3 ) GACTTGTGGGTG atggactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgac M D Y K D H D G D Y K D H D I D Y K D D gatgacaagatggcccccaagaagaagaggaaggtcggcattcatggggtacccgccgct D D K M A P K K K R K V G I H G V P A A atggctgagaggcccttccagtgtcgaatctgcatgcgtaacttcagtcgctccgactcc M A E R P F Q C R I C M R N F S R S D S ctgctgcgccacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtggg L L R H I R T H T G E K P F A C D I C G aggaagtttgcccgctccgaccacctgaccacccataccaagatacacacgggatctcag R K F A R S D H L T T H T K I H T G S Q aagcccttccagtgtcgaatctgcatgcgtaacttcagtcgctccgactccctgtccgcc K P F Q C R I C M R N F S R S D S L S A cacatccgcacccacacaggcgagaagccttttgcctgtgacatttgtgggaggaagttt H I R T H T G E K P F A C D I C G R K F gccgaccgctccaacctgacccgccataccaagatacacctgcggggatcccagctggtg A D R S N L T R H T K I H L R G S Q L V aagagcgagctggaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccac K S E L E E K K S E L R H K L K Y V P H gagtacatcgagctgatcgagatcgccaggaacagcacccaggaccgcatcctggagatg E Y I E L I E I A R N S T Q D R I L E M aaggtgatggagttcttcatgaaggtgtacggctacaggggaaagcacctgggcggaagc K V M E F F M K V Y G Y R G K H L G G S agaaagcctgacggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtg R K P D G A I Y T V G S P I D Y G V I V gacacaaaggcctacagcggcggctacaatctgcctatcggccaggccgacgagatgcag D T K A Y S G G Y N L P I G Q A D E M Q agatacgtgaaggagaaccagacccggaataagcacatcaaccccaacgagtggtggaag R Y V K E N Q T R N K H I N P N E W W K gtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggc V Y P S S V T E F K F L F V S G H F K G aactacaaggcccagctgaccaggctgaaccgcaaaaccaactgcaatggcgccgtgctg N Y K A Q L T R L N R K T N C N G A V L agcgtggaggagctgctgatcggcggcgagatgatcaaagccggcaccctgacactggag S V E E L L I G G E M I K A G T L T L E gaggtgcggcgcaagttcaacaacggcgagatcaacttc E V R R K F N N G E I N F The recognition helices are shown in red and the FokI mutations are labeled in blue.

Supplementary Note 2 RFLP donor vector sequence Ggaagttaaagcccatgtttctaatacaatgaacattatgttatgcccaaacttaacaccatcatttcatatgatagcactttcttatag tgttaccttatgctccctgaccaaactcccagacatcaacttgtacttttctattttattctagatctttttgtattgttgttttaaatactttcc tgcccattagaggacctaggagccaccctcctctcccctcttaactgatatttagcctttcatgggctttgcatataatggaaatttca aaatccaccctgagaaatgaaaaccaagtagaggaaaaataaactcttcaaaacacacactaccttccactgctcttttgaagaaa actttacagcttccacaagttaagactccataatgacatcctgaagcttcatcagagcacaccaggcagagtttgggaggtggtcc tgttgttgaggcatccagtccagacgggatccagccatactcactgctgttgaggagctggatggaggagagcttacatctggtc tcatgctggggctaaagaaggggaagaacagtgttatgatttaactgtcaaaggaatatcaaaatacagttctcttagcttctcactt catagtcagaatgctcacagtgaactctggcttcaagtgctagcaggcactaaaatatcctagctaaatatattcaaatcatgttatat tcttctttaaacaaaattaagaatgaggtcatttcttttgaagtgtctccaaaatagaatggtgtggttctggttcacttcttcttctttttttt tttttttttagatgcttaggatttatttttataatcacg The tag sequence is shown in red and the BamHI site is underlined. The ZFN binding sites are labeled in blue.