SUPPLEMENTARY INFORMATION FILE. Remote electronic control of DNA-based reactions and. nanostructures assembly

Transcription

1 SUPPLEMENTARY INFORMATION FILE Remote electronic control of DNA-based reactions and nanostructures assembly Alessia Amodio, 1,# Erica Del Grosso, 1,# Alessandra Troina, 1 Ernesto Placidi, 2 Francesco Ricci 1,* 1 Chemistry Department, University of Rome, Tor Vergata, Via della Ricerca Scientifica, 00133, Rome, Italy. 2 Istituto di Struttura della Materia (ISM-CNR), via Fosso del Cavaliere 100, Rome, Italy.

2 Chemicals. Reagent-grade chemicals, including tris-base, glacial acid acetic, sodium chloride, magnesium chloride, ethylenediaminetetraacetic acid, ethanol and acetone (all from Sigma-Aldrich, St Louis, Missouri) were used without further purifications. HPLC purified oligonucleotides were purchased from IBA (Gottingen, Germany) and employed without further purification. The following oligos modified and non-modified were used: System 1: S1_target_complex_F: 5 - Alexa Fluor 568-ATAGATCCTGATAGCGAGAC - 3 S1_target_complex_Q: 5 - TTGCTAGGTCTCGCTATCAGGATCTAT -BHQ2-3 S1_Input Strand_SH: 5 - ATAGATCCTGATAGCGAGACCTAGCAA- C6 SH - 3 System 2: S2_target_complex_F: 5 - AAGGAAAGAGGAAGAAAA -Alexa Fluor S2_target_complex _Q: 5 - BHQ1 - TTTTCTTCCTCTTTCCTTGTTACATTGCACACT - 3 S2_Input Strand_SH: 5 - SH- C6 - GCAATGTAACAAGGAAAGAGGA - 3 System 3: S3_target_complex_F: 5 - Alexa Fluor 680 TGCTCTACCAGAC - 3 S3_target_complex_Q: 5 - TGGTATTGTCTGGTAGAGCA - BHQ2-3 S3_Input Strand_SH: 5 - TGCTCTACCAGACAATACCAATCCGC - C6 SH - 3 Nanotubes: System 1: t1_1: 5 -ATACCATAGATCCTGATAGC-3 t2_1: 5 -AGCAACCTGAAACCAGAATT-3 t3_1: 5 -GAATTCTACTCGTGGATCTATGGTAT-3 t4_1: 5 -AGAATTGCGTCGTGGTTGCTAGGTCTCGCTATCACCGATGTG-3 t4q570_1: 5 -AGAATTGCGTCGTGGTTGCTAGGTCTCGCTATCACCGATGTG-QUASAR570-3 t5_1: 5 -AATTCTGGTTTCACCTTAACGATACC-3 t6_1: 5 -CGTTAAGGACGACGCAATTCTCACATCGGACGAGTAG-3 Deprotector_1 (D): 5 -ATAGATCCTGATAGCGAGACCTAGCAACCTGAAACCA-3 D_SH_1: 5 - SH - C6 - ATAGATCCTGATAGCGAGACCTAGCAACCTGAAACCA-3 S2

3 System 2: t1_2: 5 - TACCTCTCAGTGGACAGCCG -3 t2_2: 5 - GCGTTGGACGAAACTGTCTG -3 t3_2: 5 - GTCTGGTAGAGCACCACTGAGAGGTA -3 t4_2: 5 - TCCAGAACGGCTGTGGCTAAACAGTAACCGAAGCACCAACGCT -3 t4q670_2: 5 -QUASAR670TCCAGAACGGCTGTGGCTAAACAGTAACCGAAGCACCAACGCT-3 t5_2: 5 - CAGACAGTTTCGTGGTCATCGTACCT -3 t6_2: 5 - CGATGACCTGCTTCGGTTACTGTTTAGCCTGCTCTAC -3 Deprotector_2 (D): 5 - CTCAGTGGAGGACAGCCGTTCTGGAGCGTTGGACGAAACT -3 D_SH_2: 5 - SH- C6 - CTCAGTGGAGGACAGCCGTTCTGGAGCGTTGGACGAAACT -3 Buffer conditions. DNA oligonucleotides were suspended to a final concentration of 100 μm and stored in 0.01 M TRIS buffer M MgCl 2, ph 7, at -20 C. In all experiments we used solutions of TAE 1x + 15 mm MgCl 2 (starting ph = 8.2) with the ph adjusted with the addition of 1 M HCl or 1 M NaOH. All experiments were performed at 25 C. Electronic activation of DNA strand displacement reactions. For the electronic activation of DNA strand displacement reactions the following procedure was employed. First, we used gold screen-printed electrode chips produced in-house as reported elsewhere. 1 Briefly, the electrodes were printed with a 245 DEK (Weymouth,UK) screen printing machine, and using the following conductive inks: graphite-based (Loctite edag PF-407A), gold-based (DuPont conductor paste BQ-331) and silver-based (Loctite edag PF- 410) and a grey dielectric paste insulating ink. The inks were printed on a polyester flexible film (Autostat HT5). Each gold-based screen printed electrode chip contains three printed separated portions that act as the working (gold-based ink), the reference (silver-based ink) and the counter electrode (the carbon-based ink). The diameter of the working electrode was 0.3 cm, which resulted in an apparent geometric area of 0.07 cm 2. The thiol-modified input strands are supplied as a mixed disulfide with 6-mercapto-1-hexanol. The thiol-modified input strand (100 μm) was reduced in a solution of 0.4 mm tris(2-carboxyethyl)-phosphine hydrochloride (TCEP) in 100 mm NaCl/10 mm potassium phosphate ph 7.0 for 1 h. The soreduced input strand was deposited onto the gold working-electrode surface by placing a 20 μl solution of 1 M NaCl, 10 mm sodium phosphate, ph 7.0. The spontaneous formation of a self-assembled monolayer due to gold-thiol reaction was allowed for 24 hours. To modulate the amount of input strand deposited onto the surface of the working electrode we have employed different concentrations during the deposition step (from 0.5 µm to 10 µm). The electrodes were then thoroughly rinsed with distilled water. All experiments were performed using a portable PalmSens potentiostat instrument connected to a laptop. To perform electronic activation of the strand displacement reactions we placed a 100 μl drop of a solution of TAE/Mg 2+ buffer containing the target complex (10 nm). The electronic activation S3

4 was achieved by applying a fixed potential of -1.2 V vs Ag/AgCl for 30 seconds unless otherwise noted. At the end of this electrochemical procedure, the 100 μl mixture reaction was immediately transferred into a micro-cuvette for fluorescence measurement. All fluorescence measurements were obtained using a Cary Eclipse Fluorimeter (Varian). For system 1 (AlexaFluor 568) an excitation wavelength of 578 (± 5) nm and acquisition at 603 (± 5) nm was used. For system 2 (AlexaFluor 488) an excitation wavelength of 495 (± 5) nm and acquisition at 519 (± 5) nm was used. For system 3 (AlexaFluor 680) an excitation wavelength of 679 (± 5) nm and acquisition at 702 (± 5) nm was used. All the measurements have been performed at 25 C. For control experiments (no electronic input, see Fig. 1), we have used the same exact procedure described above except that no potential was applied to the electrode. Electrochemical characterization of system 1. The following input strand labeled at one end with a thiol group and at the other end with methylene blue was used for these experiments: S2_input_strand_SH_MB: 5 - SH- C6 - GCAATGTAACAAGGAAAGAGGA - MB -3 After input strand immobilization, the electrode surface was rinsed with deionized water before measurement. Square wave voltammetry (SWV) was recorded from -0.1 V to -0.5 V vs Ag/AgCl using an amplitude of 25 mv with a frequency of 100 Hz. After the application of the potential the electrode was thoroughly rinsed with distilled water and the current was measured again. Calculation of Probe Surface Density. Probe surface density (i.e., the number of electroactive probe DNA moles per unit area of the electrode surface, N tot ) was determined using a previously established relationship with ACV peak current 2 described in eq. 1: sin h (nfe (1) I avg (E 0 ) = 2nfFN ac RT) tot cos h(nfe ac RT) +1 where I avg (E 0 ) is the average AC peak current in a voltammogram, n is the number of electrons transferred per redox event (with our MB label n = 2), F is the Faraday current, R is the universal gas constant, T is the temperature, E ac is the amplitude, and f is the frequency of the applied AC voltage perturbation. Experimentally, four frequency values were used (5, 10, 50, and 100 Hz), and the average current peak was calculated so as to give the value of N tot. 3 Protected tile annealing. The protected tiles for both the systems were prepared as reported elsewhere. 4 Briefly, the tile-forming strands were prepared in TAE/Mg 2+ buffer at a concentration of 5 μm and annealed with a Bio-Rad Mastercycler Gradient thermocycler. The solution was then brought down from 95 C to 20 C at a constant rate over a course of 6 h. Electronic activation of DNA nanotubes self-assembly. The deprotector has been deposited onto the gold working-electrode surface as described above. To perform electronic activation of the strand displacement reactions we placed a 20 μl drop of a solution of TAE/Mg 2+ buffer ph 8.0 containing the protected tile (80 nm). The electronic activation was achieved by applying a fixed potential of -1.2 V vs Ag/AgCl for 10 S4

5 seconds. The mixture reactions were analyzed using Confocal Laser Scanning Microscopy and Atomic Force Microscopy. Confocal laser scanning microscopy. For fluorescence microscopy imaging the central strand of both tiles (t4, see sequence above) was labelled at the 3 end with either Quasar570 (system 1) or Quasar670 (system 2). A confocal laser scanning microscope Olympus FV 1000 was used. The emitted photons were collected by a 60x, oil objective. A 2 μl drop of the mixture reaction (50 nm) was deposited between a clean microscope slide and a coverslip. Atomic Force Microscopy. AFM topographic height images of the self-assembly nanotubes were acquired with a Veeco Multimode (Nanoscope IIIa). Firstly, 10 µl of 50 nm mixture reaction was deposited onto freshly cleaved mica substrate. Once dried the samples were measured in air in tapping mode with Si tip (resonant frequency: 300 khz, spring constant: 40 N/m, scan rate: Hz). We acquired about 20 images for each sample, from different location of each substrate. The topographic images were processed with 1st order flattening, and analyzed using Gwyddion References: (1) Ricci, F.; Amine, A.; Palleschi, G.; Moscone, D. Biosens. Bioelectron. 2003, 18, (2) O Connor, S. D.; Olsen, G. T.; Creager, S. E. J. Electroanal. Chem. 1999, 466, (3) Ricci, F.; Lai, R.Y.; Heeger, A.J.; Plaxco, K.W.; Sumner, J. J. Langmuir. 2007, 23, (4) Zhang, D. Y.; Hariadi, R. F.; Choi, H. M. T.; Winfree, E. Nat. Commun. 2013, 4, S5

6 SUPPORTING FIGURES Figure S1. Strand displacement reaction does not occur when no electronic input is applied on the surface chip. Signals very close to the background value are observed at 5, 10 and 15 minutes. Only after waiting 30 and 60 minutes we observe a measurable leak signal that is still very small compared to the final signal obtained when electronic input strand desorption is performed. The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0. The concentration of input strand used during the deposition step was 10 M and a fixed applied potential of -1.2 V vs. Ag/AgCl was applied for 30 s. S6

7 Figure S2. To quantitatively control the amount of input strand desorbed from the chip surface we used a DNA labelled with an electrochemically active tag (i.e., methylene blue) and measured the SWV signal before and after the potential application. On the right an example of SWV scan. S7

8 Figure S3. Current signal of the electrochemical label (methyelene blue) before (No V) and after the potential input is applied provides a measure of the amount of input strand retained on the chip surface. The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0. The applied potential (from 0 V to -1.5 V vs. Ag/AgCl) was applied for a total period of 30 s. The concentration of input strand labelled with methylene blue used during the deposition step was 10 M. S8

9 Figure S4. Cathodic current produced by the breakage of the Au-S bond recorded during the application of the potential shows the modulation of the input strand desorption. The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0. The applied potential (from 0 V to -1.5 V vs. Ag/AgCl) was applied for a total period of 30 s. The concentration of input strand used during the deposition step was 10 M. S9

10 Figure S5. Comparison between the strand displacement reaction achieved though the exogenous addition of the input strand (left) and after the application of a cathodic potential (right). In this experiment we have compared the signal achieved by exogenously adding the input strand in solution (at 3 nm final concentration) and that achieved after the electronic release of the input strand. Here we have used a high density chip (density = 3.8 (± 0.2) x mol/cm 2 ) and 30 sec of electronic input (at -1.2 V vs Ag/AgCl). Under these conditions, assuming a total release of the DNA-input strand from the electrode surface, we achieve a final concentration of the input strand in a 100 L solution of 2.7 nm. As expected, this would give a signal comparable to that obtained by exogenously adding the input strand in solution (at 3 nm final concentration). The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0. The concentration of input strand used during the deposition step was 10 M and a fixed applied potential of -1.2 V vs. Ag/AgCl was applied for 30 s. S10

11 Figure S6. Modulation of input strand desorption using methylene-blue-tagged DNA strand achieved by varying the total period at which a fixed potential is applied on the chip surface. The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0. The concentration of input strand used during the deposition step was 10 M and a fixed applied potential of -1.2 V vs. Ag/AgCl was applied for different periods (from 2 s to 30 s). S11

12 Figure S7. Reversibility of the electronic-induced desorption of the input strand. Upon the application of the cathodic potential (-1.2 V for 30 sec) we waited different periods before the addition of the reporter complex in solution. After 5 and 15 minutes no variation in the strand displacement reaction efficiency is observed. Instead after 30 or 60 minutes it is observed a significant reduction of the strand displacement reaction likely due to a spontaneous re-absorption of the input strand on the chip surface. The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0. The concentration of input strand used during the deposition step was 10 M and a fixed applied potential of -1.2 V vs. Ag/AgCl was applied for 30 s. S12

13 Figure S8. Electronic activation and modulation of strand displacement activation using the system 2. Here we have employed an input DNA strand (system 2), containing a 10-base toehold portion and a 12-base invading domain (see sequences in the experimental section). The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0, containing 10 nm of target duplex labelled with a fluorophore/quencher pair. The concentration of input strand used during the deposition step was 10 M. Applied voltage potential from -1.5 to -0.2 V vs. Ag/AgCl for a total period of 30 s. The values shown here represent averages of three independent measurements; error bars reflect standard deviations. S13

14 Figure S9. Electronic activation and modulation of system 3 by varying the cathodic applied potential. Here we have employed an input DNA strand, containing a 7-base toehold portion and a 13-base invading domain (see sequences above). The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0, containing 10 nm of target duplex labelled with a fluorophore/quencher pair. The concentration of input strand used in the coating step is 10 M. Fixed potentials (from -1.5 to -0.2 V vs. Ag/AgCl) were applied for a total period of 30 s. S14

15 Figure S10. Modulation of strand displacement reaction of system 2 by varying the period of potential application. The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0, containing 10 nm of target duplex (system 2) labelled with a fluorophore/quencher pair. The concentration of input strand used during the deposition step was 10 M. A potential of -1.2 V vs. Ag/AgCl was applied for different periods (from 0 to 30 s, as shown in the figure). S15

16 Figure S11. Electronic activation and modulation of strand displacement reaction with system 3. The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0, containing 10 nm of target duplex labelled with a fluorophore/quencher pair. The concentration of input strand (system 3) used during the deposition step was 10 M. A potential of -1.2 V vs. Ag/AgCl was applied for different periods (from 0 to 30 s, as shown in the figure). S16

17 Figure S12. Modulation of strand displacement reaction of system 2 by varying the input strand surface density. The density of the input strand (system 2) on the chip surface is modulated by varying the DNA input strand concentration used during the deposition step (from 0.1 M to 10 M). The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0, containing 10 nm of target duplex (system 3) labelled with a fluorophore/quencher pair. A potential of -1.2 V vs. Ag/AgCl was applied for a period of 30 s. S17

18 Figure S13. Modulation of strand displacement reaction of system 3 by varying the input strand surface density. The density of the input strand (system 3) on the chip surface is modulated by varying the DNA input strand concentration used during the deposition step (from 0.1 M to 10 M). The experiments were performed at 25 C in a 100 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0, containing 10 nm of target duplex (system 3) labelled with a fluorophore/quencher pair. A potential of -1.2 V vs. Ag/AgCl was applied for a period of 30 s. S18

19 Figure S14. Confocal laser scanning microscopy images confirm the possibility to remotely control nanotubes self-assembly through electronic input. Confocal laser scanning microscopy images (system 1) obtained by applying the cathodic potential (left) and in a control experiment (no applied potential, right). The experiments were performed at 25 C in a 20 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0, containing 80 nm of protected tile. The concentration of the deprotector used during the deposition step was 10 M and a fixed applied potential of -1.2 V vs. Ag/AgCl was applied for 10 s. Scale bar is 4 m. S19

20 Figure S15. AFM images confirm the possibility to remotely control nanotubes selfassembly through electronic input. AFM images (system 1) obtained by applying the cathodic potential (top) and with a control experiment (no applied potential, bottom). The experiments were performed at 25 C in a 20 L solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0, containing 80 nm of protected tile. The concentration of the deprotector used during the deposition step was 10 M and a fixed applied potential of -1.2 V vs. Ag/AgCl was applied for 10 s. Scale bar is shown in each image. S20

21 Figure S16. Orthogonal electronic control of DNA nanostructures self-assembly. By using a two- electrode chip with two different deprotector strands it is possible orthogonally trigger self-assembly in the same solution through electronic input (a). Confocal laser scanning microscopy images of the two systems obtained by applying the cathodic potential in different combination (b). Filled and black circles are used to identify the electrode at which the potential was applied. The experiments were performed at 25 C in a 20 μl solution of TAE 1x buffer + 15 mm MgCl 2 ph 7.0, containing 80 nm of each protected tile. The concentration of each deprotector used during the deposition step was 10 μm and a fixed applied potential of V vs. Ag/AgCl was applied for 10 s. Scale bar is 4 μm. S21