Evolutionary divergence of the plant elicitor peptides (Peps)
|
|
- Emil Pierce
- 6 years ago
- Views:
Transcription
1 Evolutionary divergence of the plant elicitor peptides (Peps) and their receptors: interfamily incompatibility of perception but compatibility of downstream signalling Item Type Article Authors Lori, M.; van Verk, M. C.; Hander, T.; Schatowitz, H.; Klauser, D.; Flury, P.; Gehring, Christoph A; Boller, T.; Bartels, S. Citation Evolutionary divergence of the plant elicitor peptides (Peps) and their receptors: interfamily incompatibility of perception but compatibility of downstream signalling 2015 Journal of Experimental Botany Eprint version Publisher's Version/PDF DOI /jxb/erv236 Publisher Oxford University Press (OUP) Journal Journal of Experimental Botany Rights This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( creativecommons.org/licenses/by/3.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Download date 05/07/ :38:39 Link to Item
2 Evolutionary divergence of the plant elicitor peptides (Peps) and their receptors: interfamily incompatibility of perception but compatibility of downstream signalling Martina Lori, Marcel van Verk, Tim Hander, Hendrik Schatowitz, Dominik Klauser, Pascale Flury, Chris Gehring, Thomas Boller, and Sebastian Bartels Supplemental Files Supplementary Table S3: Identity comparison of PROPEP sequences Full-length amino-acid sequences of published and novel HMMER identified PROPEP sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Table S4: Identity comparison of Pep sequences Pep amino-acid sequences deduced from published and novel HMMER identified PROPEP sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Table S5: Identity comparison of PEPR sequences Full-length amino-acid sequences of PEPR sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Table S6: Identity comparison of PEPR LRR domains The LRR domains of PEPR sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Table S7: Identity comparison of PEPR kinase domains The kinase domains of PEPR sequences were compared for the percentage of identical residues in aligned positions (upper half), and the number of identical residues in aligned positions (lower half). Colours indicate increasing amount of identity from low (blue) via white to high (red). Supplementary Figure S1: Plasticity of the Pep-PEPR-LRR interaction site Sequence alignment of the LRR region of the PEPR sequences from Figure 1B. Amino acid residues are coloured based on the conservation and interacting residues of AtPEPR1-LRR (underlined in red) as described by Tang et al., The LRR sequence of SlPEPR1 and ZmPEPR1a, used in this study, are underlined in grey. Yellow residues: conserved amino acids of AtPEPR1LRR. Magenta residues: AtPep1 interacting amino acids of AtPEPR1LRR. Below the sequence alignment the overall conservation is indicated by pink bars and a sequence logo.
3
4
5
6
7
8
The Arabidopsis Pep-PEPR system is induced by herbivore feeding and contributes to JA-mediated plant defence against herbivory
Journal of Experimental Botany, Vol. 66, No. 17 pp. 5327 5336, 2015 doi:10.1093/jxb/erv250 Advance Access publication 1 June 2015 This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Crystallization. a, Crystallization constructs of the ET B receptor are shown, with all of the modifications to the human wild-type the ET B receptor indicated. Residues interacting
More informationBMC Evolutionary Biology 2013, 13:6
BMC Evolutionary Biology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Correction: Male-killing
More informationUniversity of Dundee. Published in: Molecular Biology and Evolution. DOI: /molbev/msw235. Publication date: 2016
University of Dundee Progressive and biased divergent evolution underpins the origin and diversification of peridinin dinoflagellate plastids Dorrell, Richard G.; Klinger, Christen M.; Newby, Robert J.;
More informationTable S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
SUPPLEMENTAL DATA Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants Sense primer (5 to 3 ) Anti-sense primer (5 to 3 ) GAL1 mutants GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg
More informationSupporting Information
Supporting Information Development of a human vasopressin V 1a -receptor antagonist from an evolutionary-related insect neuropeptide Maria Giulia Di Giglio, Markus Muttenthaler, Kasper Harpsøe, Zita Liutkeviciute,
More information2-(3-Chloro-4-hydroxylphenyl)-N-(3,4- dimethyoxyphenethyl)acetamide. Author. Published. Journal Title DOI. Copyright Statement.
2-(3-Chloro-4-hydroxylphenyl)-N-(3,4- dimethyoxyphenethyl)acetamide Author Davis, Rohan, Healy, Peter Published 2008 Journal Title Acta Crystallographica. Section E: Structure reports online DOI https://doi.org/10.1107/s1600536808013299
More informationResearch Article A Generalization of a Class of Matrices: Analytic Inverse and Determinant
Advances in Numerical Analysis Volume 2011, Article ID 593548, 6 pages doi:10.1155/2011/593548 Research Article A Generalization of a Class of Matrices: Analytic Inverse and Determinant F. N. Valvi Department
More informationHiromi Nishida. 1. Introduction. 2. Materials and Methods
Evolutionary Biology Volume 212, Article ID 342482, 5 pages doi:1.1155/212/342482 Research Article Comparative Analyses of Base Compositions, DNA Sizes, and Dinucleotide Frequency Profiles in Archaeal
More informationConsideration of Viscoelasticity in Time Step FEM-Based Restraint Analyses of Hardening Concrete
Journal of Modern Physics, 2013, 4, 9-14 http://dx.doi.org/10.4236/jmp.2013.410a2002 Published Online October 2013 (http://www.scirp.org/journal/jmp) Consideration of Viscoelasticity in Time Step FEM-Based
More informationBacterial protease uses distinct thermodynamic signatures for substrate recognition
Bacterial protease uses distinct thermodynamic signatures for substrate recognition Gustavo Arruda Bezerra, Yuko Ohara-Nemoto, Irina Cornaciu, Sofiya Fedosyuk, Guillaume Hoffmann, Adam Round, José A. Márquez,
More informationNote on the Expected Value of a Function of a Fuzzy Variable
International Journal of Mathematical Analysis Vol. 9, 15, no. 55, 71-76 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/1.1988/ijma.15.5145 Note on the Expected Value of a Function of a Fuzzy Variable
More informationAbstract. Introduction. Research paper
Journal of Experimental Botany, Vol. 64, No. 17, pp. 5309 5321, 2013 doi:10.1093/jxb/ert330 Advance Access publication 22 October, 2013 Research paper The family of Peps and their precursors in Arabidopsis:
More informationResearch Article Global Existence and Boundedness of Solutions to a Second-Order Nonlinear Differential System
Applied Mathematics Volume 212, Article ID 63783, 12 pages doi:1.1155/212/63783 Research Article Global Existence and Boundedness of Solutions to a Second-Order Nonlinear Differential System Changjian
More informationVeller, M.G.P. van. This is a "Post-Print" accepted manuscript, which will be published in "Qualitative and Quantitative Methods in Libraries (QQML)"
Identification of multidisciplinary research based upon dissimilarity analysis of journals included in reference lists of Wageningen University & Research articles Veller, M.G.P. van This is a "Post-Print"
More informationUniversity of Groningen
University of Groningen Role of mitochondrial inner membrane organizing system in protein biogenesis of the mitochondrial outer membrane Bohnert, Maria; Wenz, Lena-Sophie; Zerbes, Ralf M.; Horvath, Susanne
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our
More informationImpact of the crystallization condition on importin-β conformation
Supporting information Volume 72 (2016) Supporting information for article: Impact of the crystallization condition on importin-β conformation Marcel J. Tauchert, Clément Hémonnot, Piotr Neumann, Sarah
More informationCyclic Nucleotide Signaling (Methods In Signal Transduction Series)
Cyclic Nucleotide Signaling (Methods In Signal Transduction Series) If searched for a book Cyclic Nucleotide Signaling (Methods in Signal Transduction Series) in pdf format, then you've come to correct
More informationSolving Poisson Equation within Local Fractional Derivative Operators
vol. (207), Article ID 0253, 2 pages doi:0.3/207/0253 AgiAl Publishing House http://www.agialpress.com/ Research Article Solving Poisson Equation within Local Fractional Derivative Operators Hassan Kamil
More informationApproximations to the t Distribution
Applied Mathematical Sciences, Vol. 9, 2015, no. 49, 2445-2449 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ams.2015.52148 Approximations to the t Distribution Bashar Zogheib 1 and Ali Elsaheli
More informationConvex Sets Strict Separation in Hilbert Spaces
Applied Mathematical Sciences, Vol. 8, 2014, no. 64, 3155-3160 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ams.2014.44257 Convex Sets Strict Separation in Hilbert Spaces M. A. M. Ferreira 1
More informationA note on the Lipkin model in arbitrary fermion number
Prog. Theor. Exp. Phys. 017, 081D01 9 pages) DOI: 10.1093/ptep/ptx105 Letter A note on the Lipkin model in arbitrary fermion number Yasuhiko Tsue 1,,, Constança Providência 1,, João da Providência 1,,
More informationOn Some Identities of k-fibonacci Sequences Modulo Ring Z 6 and Z 10
Applied Mathematical Sciences, Vol. 12, 2018, no. 9, 441-448 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2018.8228 On Some Identities of k-fibonacci Sequences Modulo Ring Z 6 and Z 10 Tri
More informationBahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction
Name page 1 of 6 Bahnson Biochemistry Cume, April 8, 2006 The Structural Biology of Signal Transduction Part I. The ion Ca 2+ can function as a 2 nd messenger. Pick a specific signal transduction pathway
More informationRhodamine B pentyl ester and its methyl, ethyl, propyl, and butyl homologues
Rhodamine B pentyl ester and its methyl, ethyl, propyl, and butyl homologues Author Cosgrove, Kelly Published 2006 Journal Title Molbank Version Published DOI https://doi.org/10.3390/m515 Copyright Statement
More informationUniversity of Groningen
University of Groningen Identification of Early Intermediates of Caspase Activation Using Selective Inhibitors and Activity-Based Probes Berger, Alicia B.; Witte, Martin; Denault, Jean-Bernard; Sadaghiani,
More informationFrom Pascal Triangle to Golden Pyramid
Asian Research Journal of Mathematics 6(): -9, 07; Article no.arjom.9964 ISSN: 456-477X From Pascal Triangle to Golden Pyramid Lovemore Mamombe * Department of Civil Engineering, University of Zimbabwe,
More informationSome Properties of a Semi Dynamical System. Generated by von Forester-Losata Type. Partial Equations
Int. Journal of Math. Analysis, Vol. 7, 2013, no. 38, 1863-1868 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ijma.2013.3481 Some Properties of a Semi Dynamical System Generated by von Forester-Losata
More informationSolving Homogeneous Systems with Sub-matrices
Pure Mathematical Sciences, Vol 7, 218, no 1, 11-18 HIKARI Ltd, wwwm-hikaricom https://doiorg/112988/pms218843 Solving Homogeneous Systems with Sub-matrices Massoud Malek Mathematics, California State
More informationResearch Article Technical Note on Q, r, L Inventory Model with Defective Items
Hindawi Publishing Corporation Abstract and Applied Analysis Volume 010, Article ID 878645, 8 pages doi:10.1155/010/878645 Research Article Technical Note on Q, r, L Inventory Model with Defective Items
More informationComparison of Pre-service Physics Teachers Conceptual Understanding of Classical and Quantum Mechanics
New Physics: Sae Mulli, Vol. 64, No. 1, January 2014, pp. 56 65 DOI: 10.3938/NPSM.64.56 Comparison of Pre-service Physics Teachers Conceptual Understanding of Classical and Quantum Mechanics Sungmin Im
More informationResearch Article Uniqueness Theorems on Difference Monomials of Entire Functions
Abstract and Applied Analysis Volume 202, Article ID 40735, 8 pages doi:0.55/202/40735 Research Article Uniqueness Theorems on Difference Monomials of Entire Functions Gang Wang, Deng-li Han, 2 and Zhi-Tao
More informationDiophantine Equations. Elementary Methods
International Mathematical Forum, Vol. 12, 2017, no. 9, 429-438 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/imf.2017.7223 Diophantine Equations. Elementary Methods Rafael Jakimczuk División Matemática,
More informationResearch Article New Examples of Einstein Metrics in Dimension Four
International Mathematics and Mathematical Sciences Volume 2010, Article ID 716035, 9 pages doi:10.1155/2010/716035 Research Article New Examples of Einstein Metrics in Dimension Four Ryad Ghanam Department
More informationThird and Fourth Order Piece-wise Defined Recursive Sequences
International Mathematical Forum, Vol. 11, 016, no., 61-69 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.1988/imf.016.5973 Third and Fourth Order Piece-wise Defined Recursive Sequences Saleem Al-Ashhab
More informationEnhancing hydrogen production of microalgae by redirecting electrons from photosystem I to hydrogenase
Electronic Supplementary Material (ESI) for Energy & Environmental Science. This journal is The Royal Society of Chemistry 2014 Supplementary information for Enhancing hydrogen production of microalgae
More informationSUPPLEMENTARY INFORMATION
Supplementary materials Figure S1 Fusion protein of Sulfolobus solfataricus SRP54 and a signal peptide. a, Expression vector for the fusion protein. The signal peptide of yeast dipeptidyl aminopeptidase
More informationOrigin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants
Liu et al. BMC Evolutionary Biology (2017) 17:47 DOI 10.1186/s12862-017-0891-5 RESEARCH ARTICLE Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Identification of the ScDcp2 minimal region interacting with both ScDcp1 and the ScEdc3 LSm domain. Pull-down experiment of untagged ScEdc3 LSm with various ScDcp1-Dcp2-His 6 fragments.
More informationResearch Article A Note on Kantorovich Inequality for Hermite Matrices
Hindawi Publishing Corporation Journal of Inequalities and Applications Volume 0, Article ID 5767, 6 pages doi:0.55/0/5767 Research Article A Note on Kantorovich Inequality for Hermite Matrices Zhibing
More informationResearch Article Translative Packing of Unit Squares into Squares
International Mathematics and Mathematical Sciences Volume 01, Article ID 61301, 7 pages doi:10.1155/01/61301 Research Article Translative Packing of Unit Squares into Squares Janusz Januszewski Institute
More informationHigh Sensitivity Gas Sensor Based on IR Spectroscopy Technology and Application
PHOTONIC SENSORS / Vol. 6, No. 2, 2016: 127 131 High Sensitivity Gas Sensor Based on IR Spectroscopy Technology and Application Hengyi LI Department of Electronic Information Engineering, Jincheng College
More informationResearch Article A Nice Separation of Some Seiffert-Type Means by Power Means
International Mathematics and Mathematical Sciences Volume 2012, Article ID 40692, 6 pages doi:10.1155/2012/40692 Research Article A Nice Separation of Some Seiffert-Type Means by Power Means Iulia Costin
More informationSUPPLEMENTARY INFORMATION
University of Groningen Direct observation of the spin-dependent Peltier effect Flipse, J.; Bakker, F. L.; Slachter, A.; Dejene, F. K.; van Wees, Bart Published in: Nature Nanotechnology DOI: 10.1038/NNANO.2012.2
More informationBasins of Attraction for Optimal Third Order Methods for Multiple Roots
Applied Mathematical Sciences, Vol., 6, no., 58-59 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.988/ams.6.65 Basins of Attraction for Optimal Third Order Methods for Multiple Roots Young Hee Geum Department
More informationFormula for Lucas Like Sequence of Fourth Step and Fifth Step
International Mathematical Forum, Vol. 12, 2017, no., 10-110 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/imf.2017.612169 Formula for Lucas Like Sequence of Fourth Step and Fifth Step Rena Parindeni
More informationFigure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and
Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and counterclockwise for the inner row, with green representing coding
More informationRestrained Independent 2-Domination in the Join and Corona of Graphs
Applied Mathematical Sciences, Vol. 11, 2017, no. 64, 3171-3176 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2017.711343 Restrained Independent 2-Domination in the Join and Corona of Graphs
More informationOn a Certain Representation in the Pairs of Normed Spaces
Applied Mathematical Sciences, Vol. 12, 2018, no. 3, 115-119 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2018.712362 On a Certain Representation in the Pairs of ormed Spaces Ahiro Hoshida
More informationJeremy Chang Identifying protein protein interactions with statistical coupling analysis
Jeremy Chang Identifying protein protein interactions with statistical coupling analysis Abstract: We used an algorithm known as statistical coupling analysis (SCA) 1 to create a set of features for building
More informationThe Law of Luminous Intensity Variation and Technical Vision
Adv. Studies Theor. Phys. Vol. 7 2013 no. 8 349-354 HIKARI Ltd www.m-hikari.com The Law of Luminous Intensity Variation and Technical Vision Anna Gorbenko Department of Intelligent Systems and Robotics
More informationResearch Article Improved Estimators of the Mean of a Normal Distribution with a Known Coefficient of Variation
Probability and Statistics Volume 2012, Article ID 807045, 5 pages doi:10.1155/2012/807045 Research Article Improved Estimators of the Mean of a Normal Distribution with a Known Coefficient of Variation
More informationDisconvergent and Divergent Fuzzy Sequences
International Mathematical Forum, Vol. 9, 2014, no. 33, 1625-1630 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/imf.2014.49167 Disconvergent and Divergent Fuzzy Sequences M. Muthukumari Research
More informationSome identities related to Riemann zeta-function
Xin Journal of Inequalities and Applications 206 206:2 DOI 0.86/s660-06-0980-9 R E S E A R C H Open Access Some identities related to Riemann zeta-function Lin Xin * * Correspondence: estellexin@stumail.nwu.edu.cn
More informationResearch Article Polynomial GCD Derived through Monic Polynomial Subtractions
International Scholarly Research Network ISRN Applied Mathematics Volume 2011, Article ID 714102, 7 pages doi:10.5402/2011/714102 Research Article Polynomial GCD Derived through Monic Polynomial Subtractions
More informationSite Suitability Analysis for Local Airport Using Geographic Information System
Cloud Publications International Journal of Advanced Remote Sensing and GIS 2018, Volume 7, Issue 1, pp. 2719-2727 ISSN 2320 0243, Crossref: 10.23953/cloud.ijarsg.368 Research Article Site Suitability
More informationFactorization of Directed Graph Describing Protein Network
Applied Mathematical Sciences, Vol. 11, 2017, no. 39, 1925-1931 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2017.76205 Factorization of Directed Graph Describing Protein Network G.Sh. Tsitsiashvili
More informationROOT SQUARE MEAN GRAPHS OF ORDER 5
Available online at http://scik.org J. Math. Comput. Sci. 5 (2015), No. 5, 708-715 ISSN: 1927-5307 ROOT SQUARE MEAN GRAPHS OF ORDER 5 S.S. SANDHYA 1 S. SOMASUNDARAM 2 AND S. ANUSA 3,* 1 Department of Mathematics,
More informationResearch Article The Solution Set Characterization and Error Bound for the Extended Mixed Linear Complementarity Problem
Journal of Applied Mathematics Volume 2012, Article ID 219478, 15 pages doi:10.1155/2012/219478 Research Article The Solution Set Characterization and Error Bound for the Extended Mixed Linear Complementarity
More informationTHE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN
THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN HSP90 AND BOTH SCF E3 UBIQUITIN LIGASES AND KINETOCHORES Oliver Willhoft, Richard Kerr, Dipali Patel, Wenjuan Zhang, Caezar Al-Jassar, Tina
More informationResearch Article Subordination Results on Subclasses Concerning Sakaguchi Functions
Hindawi Publishing Corporation Journal of Inequalities and Applications Volume 2009, Article ID 574014, 7 pages doi:10.1155/2009/574014 Research Article Subordination Results on Subclasses Concerning Sakaguchi
More informationRHS Plants for Pollinators Registered trademark guidelines
RHS Registered trademark guidelines 2 1 Introduction Welcome to the s guidelines for the RHS registered trademark. The RHS mark has been developed to be easy to use. The rules around its application have
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our
More informationBIOINFORMATICS: An Introduction
BIOINFORMATICS: An Introduction What is Bioinformatics? The term was first coined in 1988 by Dr. Hwa Lim The original definition was : a collective term for data compilation, organisation, analysis and
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/1/e1500989/dc1 Supplementary Materials for An epidermis-driven mechanism positions and scales stem cell niches in plants Jérémy Gruel, Benoit Landrein, Paul Tarr,
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More informationLesson 2. Parts of a plant Contains: Worksheet 3.1 Support worksheet 3.1
Unit 3. Plants Lesson 2. Parts of a plant Contains: Worksheet 3.1 Support worksheet 3.1 WORKSHEET 3.1 1. Read and circle the words that are part of a plant. Draw the plant. This plant has six roots. It
More informationAnalysis of Forward Collision Warning System. Based on Vehicle-mounted Sensors on. Roads with an Up-Down Road gradient
Contemporary Engineering Sciences, Vol. 7, 2014, no. 22, 1139-1145 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ces.2014.49142 Analysis of Forward Collision Warning System Based on Vehicle-mounted
More informationSIMPLE MICROMECHANICAL MODEL OF PROTEIN CRYSTALS FOR THEIR MECHANICAL CHARACTERIZATIONS
EPJ Web of Conferences 6, 6 51 (21) DOI:1.151/epjconf/21651 Owned by the authors, published by EDP Sciences, 21 SIMPLE MICROMECHANICAL MODEL OF PROTEIN CRYSTALS FOR THEIR MECHANICAL CHARACTERIZATIONS Gwonchan
More informationImprovements in Newton-Rapshon Method for Nonlinear Equations Using Modified Adomian Decomposition Method
International Journal of Mathematical Analysis Vol. 9, 2015, no. 39, 1919-1928 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ijma.2015.54124 Improvements in Newton-Rapshon Method for Nonlinear
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/6/e1700147/dc1 Supplementary Materials for Ribosome rearrangements at the onset of translational bypassing Xabier Agirrezabala, Ekaterina Samatova, Mariia Klimova,
More informationPoincaré`s Map in a Van der Pol Equation
International Journal of Mathematical Analysis Vol. 8, 014, no. 59, 939-943 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.1988/ijma.014.411338 Poincaré`s Map in a Van der Pol Equation Eduardo-Luis
More informationRemark on the Sensitivity of Simulated Solutions of the Nonlinear Dynamical System to the Used Numerical Method
International Journal of Mathematical Analysis Vol. 9, 2015, no. 55, 2749-2754 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ijma.2015.59236 Remark on the Sensitivity of Simulated Solutions of
More informationSupplementary Figure 1. Fourier shell correlation curves for sub-tomogram averages and
Supplementary Figure 1. Fourier shell correlation curves for sub-tomogram averages and comparisons to other published in situ T3SS structures. a, Resolution estimates after applying Fourier shell correlation
More informationResearch Article Ulam-Hyers-Rassias Stability of a Hyperbolic Partial Differential Equation
International Scholarly Research Network ISRN Mathematical Analysis Volume 212, Article ID 69754, 1 pages doi:1.542/212/69754 Research Article Ulam-Hyers-Rassias Stability of a Hyperbolic Partial Differential
More informationOn Symmetric Bi-Multipliers of Lattice Implication Algebras
International Mathematical Forum, Vol. 13, 2018, no. 7, 343-350 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/imf.2018.8423 On Symmetric Bi-Multipliers of Lattice Implication Algebras Kyung Ho
More informationOn Numerical Solutions of Systems of. Ordinary Differential Equations. by Numerical-Analytical Method
Applied Mathematical Sciences, Vol. 8, 2014, no. 164, 8199-8207 HIKARI Ltd, www.m-hiari.com http://dx.doi.org/10.12988/ams.2014.410807 On Numerical Solutions of Systems of Ordinary Differential Equations
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,500 108,000 1.7 M Open access books available International authors and editors Downloads Our
More informationCreative Commons: Attribution 3.0 Hong Kong License
Title Mechanism of the X-ray and soft gamma-ray emissions from the high magnetic field pulsar: PSR B1509-58 Author(s) Wang, Y; Takata, J; Cheng, KS Citation Journal of Astronomy and Space Science, 2013,
More informationAn Improved Hybrid Algorithm to Bisection Method and Newton-Raphson Method
Applied Mathematical Sciences, Vol. 11, 2017, no. 56, 2789-2797 HIKARI Ltd, www.m-hikari.com https://doi.org/10.12988/ams.2017.710302 An Improved Hybrid Algorithm to Bisection Method and Newton-Raphson
More informationSome New Three Step Iterative Methods for Solving Nonlinear Equation Using Steffensen s and Halley Method
British Journal of Mathematics & Computer Science 19(2): 1-9, 2016; Article no.bjmcs.2922 ISSN: 221-081 SCIENCEDOMAIN international www.sciencedomain.org Some New Three Step Iterative Methods for Solving
More informationAntibound State for Klein-Gordon Equation
International Journal of Mathematical Analysis Vol. 8, 2014, no. 59, 2945-2949 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ijma.2014.411374 Antibound State for Klein-Gordon Equation Ana-Magnolia
More informationResearch Article Subnormal Solutions of Second-Order Nonhomogeneous Linear Differential Equations with Periodic Coefficients
Hindawi Publishing Corporation Journal of Inequalities and Applications Volume 2009, Article ID 416273, 12 pages doi:10.1155/2009/416273 Research Article Subnormal Solutions of Second-Order Nonhomogeneous
More informationResearch Article Parametric Evaluations of the Rogers-Ramanujan Continued Fraction
International Mathematics and Mathematical Sciences Volume 011, Article ID 940839, 11 pages doi:10.1155/011/940839 Research Article Parametric Evaluations of the Rogers-Ramanujan Continued Fraction Nikos
More informationLecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm. Alignment scoring schemes and theory: substitution matrices and gap models
Lecture 2, 5/12/2001: Local alignment the Smith-Waterman algorithm Alignment scoring schemes and theory: substitution matrices and gap models 1 Local sequence alignments Local sequence alignments are necessary
More informationDiammonium biphenyl-4,4'-disulfonate. Author. Published. Journal Title DOI. Copyright Statement. Downloaded from. Link to published version
Diammonium biphenyl-4,4'-disulfonate Author Smith, Graham, Wermuth, Urs, Healy, Peter Published 2008 Journal Title Acta Crystallographica. Section E: Structure Reports Online DOI https://doi.org/10.1107/s1600536807061995
More informationSupplementary Figure 1
Supplementary Figure 1 The correlation of n-score cutoff and FDR in both CID-only and CID-ETD fragmentation strategies. A bar diagram of different n-score thresholds applied in the search, plotted against
More informationDirect Product of BF-Algebras
International Journal of Algebra, Vol. 10, 2016, no. 3, 125-132 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ija.2016.614 Direct Product of BF-Algebras Randy C. Teves and Joemar C. Endam Department
More informationBioinformatics Exercises
Bioinformatics Exercises AP Biology Teachers Workshop Susan Cates, Ph.D. Evolution of Species Phylogenetic Trees show the relatedness of organisms Common Ancestor (Root of the tree) 1 Rooted vs. Unrooted
More informationHyperbolic Functions and. the Heat Balance Integral Method
Nonl. Analysis and Differential Equations, Vol. 1, 2013, no. 1, 23-27 HIKARI Ltd, www.m-hikari.com Hyperbolic Functions and the Heat Balance Integral Method G. Nhawu and G. Tapedzesa Department of Mathematics,
More informationTridip Sheet, Raja Banerjee*
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Supplementary information The C NN motif: an intrinsic lover of sulfate and phosphate ions
More informationMeasuring quaternary structure similarity using global versus local measures.
Supplementary Figure 1 Measuring quaternary structure similarity using global versus local measures. (a) Structural similarity of two protein complexes can be inferred from a global superposition, which
More informationResearch Article A New Class of Meromorphically Analytic Functions with Applications to the Generalized Hypergeometric Functions
Abstract and Applied Analysis Volume 20, Article ID 59405, 0 pages doi:0.55/20/59405 Research Article A New Class of Meromorphically Analytic Functions with Applications to the Generalized Hypergeometric
More informationAspects of the optical system relevant for the KM3NeT timing calibration
EPJ Web of Conferences 116, 06002 (2016) DOI: 10.1051/epjconf/201611606002 C Owned by the authors, published by EDP Sciences, 2016 Aspects of the optical system relevant for the KM3NeT timing calibration
More informationPAMP-triggered immunity (PTI)
PAMP-triggered immunity (PTI) PAMP-triggered immunity (PTI) Recognition of danger signals - Distinguish self or damaged self versus non-self fundamental to any immune system - PAMP or MAMP pathogen/microbe-associated
More informationResearch Article An Optimized Grey GM(2,1) Model and Forecasting of Highway Subgrade Settlement
Mathematical Problems in Engineering Volume 015, Article ID 606707, 6 pages http://dx.doi.org/10.1155/015/606707 Research Article An Optimized Grey GM(,1) Model and Forecasting of Highway Subgrade Settlement
More informationBinary Relations in the Space of Binary Relations. I.
Applied Mathematical Sciences, Vol. 8, 2014, no. 109, 5407-5414 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/10.12988/ams.2014.47515 Binary Relations in the Space of Binary Relations. I. Vyacheslav V.
More informationUsing Bioinformatics to Study Evolutionary Relationships Instructions
3 Using Bioinformatics to Study Evolutionary Relationships Instructions Student Researcher Background: Making and Using Multiple Sequence Alignments One of the primary tasks of genetic researchers is comparing
More informationSupporting Information
Supporting Information Ottmann et al. 10.1073/pnas.0907587106 Fig. S1. Primary structure alignment of SBT3 with C5 peptidase from Streptococcus pyogenes. The Matchmaker tool in UCSF Chimera (http:// www.cgl.ucsf.edu/chimera)
More information