CSCI 4181 / CSCI 6802 Algorithms in Bioinformatics
|
|
- Nigel Atkinson
- 5 years ago
- Views:
Transcription
1 CSCI 4181 / CSCI 6802 Algorithms in Bioinformatics 1
2 "In science there is only physics; all the rest is stamp collecting." -Ernest Rutherford 2
3 Was I a stamp collector? Alan Turing 3
4 Inte skert, men vad om mig*??? Carolus Linnaeus * Not sure, but what about me? 4
5 More generally,? (Why is Ernest Rutherford calling biology nonscience?) 5
6 Science Whether Turing was a scientist depends on your definition of science Mathematics and theoretical CS do not typically use the scientific method, and are not falsifiable in the sense that is normally applied today 6
7 And what about biology? There are stamp collecting elements (and phases) in biology But how could this be otherwise? And there is always some notion of an underlying theory 7
8 Disciplines of Biology Developmental biology 8 Richardson M K, Hanken J, Selwood L, Wright G M, Richards R J, Pieau C, Raynaud A. Haeckel, embryos, and evolution. Science. 1998; 280:
9 Molecular Biology - DNA, RNA, proteins and other molecules in the cell 9
10 Ecology - Interactions between organisms and the environment (including other organisms!) 10
11 Evolution - Changes that occur in living systems through time From 11
12 Stamp collecting perceptions Because biology is horrendously (er, amazingly) complex! Data collection can be tricky too (although we can concede the same for physics) 12
13 Lesser Rutherford: All science is either physics or stamp collecting. 13
14 Before we Leave Rutherford If your result needs a statistician then you should design a better experiment. 14
15 In general, biological experiments have too many random factors and uncontrolled variables to give neat results So we need STATISTICS to test hypotheses about the natural world. And statistics alone aren t enough (of which more later) Many advances in the field of statistics over the last 100 years have been driven by biological (ecological and molecular) questions 15
16 One More We don t have the money, so we have to think (Speaking about the experiments he carried out) For our purposes - money: infinite CPU cycles think: design efficient experiments ( efficient = data set selection + algorithms) 16
17 Example: the Global Ocean Survey ( ) 17
18 Over 6,000,000 protein sequences identified from the first phase alone All-versus-all comparisons using BLAST: >10 6 CPU hours Clustering with CD-HIT: about 500 hours on one machine 18
19 Now, we would rather use BLAST than CD-HIT* But we would rather use Smith-Waterman (better, slower) than BLAST! But we CANNOT use BLAST or S-W if we want to compare this huge dataset against everything else we know about *except we shouldn't, because it has some pretty awful bugs 19
20 Example 2: Cancer genomics Human genome Bacterial genome Typical gene Stratton et al., Nature (2009) 20
21 Project to sequence "the human genome": (ish), $3B Current cost of sequencing a human genome: $10,000 Storage requirements for human genome in plain text: 1.5 GB "It will soon be cheaper to resequence a nucleotide [i.e., a "letter"] of DNA than to store it" Francis Ouellette,
22 Bioinformatics The development and use of computational and statistical methods to manage and analyze biological data Biological data most often means molecular biological (DNA, protein) data, but the discipline is broader than this, and blurs into ecology, physiology and other disciplines 22
23 Algorithms in Bioinformatics Instructor: Dr. Robert Beiko Schedule: 10:35-11:55, Mondays and Wednesdays Location: Mona Campbell #1107 (tutorials to be determined) 23
24 Purpose Identify the key DATA TYPES in the biological domain Introduce the KEY QUESTIONS we want to ask of these data Examine representative ALGORITHMS for biological data analysis Consider the use of appropriate STATISTICAL MODELS of biology Think about the TRADEOFFS between exhaustive analysis and efficient heuristics 24
25 Component Undergraduate Graduate 1 15% 10% Tutorial 2 15% 10% 3 15% 10% 4 15% 10% Proposal 10% 10% Literature review N/A 10% Project Methods 10% 10% Oral presentation N/A 10% Final report 20% 20% 25
26 Critical Skills Data acquisition from online sources Examples: National Centre for Biotechnology Information (ncbi.nlm.nih.gov) US Department of Energy Joint Genome Institute (jgi.doe.gov) 26
27 Critical Skills Abstractions of biological data For instance: Evolutionary relationships as trees and graphs Biological sequences as strings Related sequences as matrices 27
28 Critical Skills Use and understand different methods How much accuracy do we lose when we choose different heuristic vs. exact methods? Do different methods treat biological data in more-orless appropriate ways? Model-based vs. model-free methods (and differences among models) 28
29 Critical Skills The assessment of statistically significant differences between data sets Parametric vs non-parametric tests Assumptions of different tests 29
30 Un-Critical Skills Programming / Scripting File format conversions Automation: repeat analysis of many data sets Simple string processing and extraction Commonly used tools Perl (including BioPerl) Python (ditto BioPython) C/C++/Java Not essential! But very helpful 30
31 BUT Everything in Context We will approach all of this in an APPLIED way You will learn it when you need to know it, and understand why it is relevant 31
32 THE PROJECT Can play to your background strengths Interpretation Method(s) Data but should show what you ve learned 32
33 THE PROJECT Interpretation Method(s) Data Choose an interesting data set 33
34 THE PROJECT Interpretation Data Methods Apply one or more methods (possibly with modifications) 34
35 THE PROJECT Method(s) Interpretation Compare the results obtained for different data sets or methods Data 35
36 THE PROJECT I can help point you in the right direction, but I encourage you to share ideas and resources. For instance: How do I do a t-test in R? My for loop isn t working! These results make no sense! 36
37 References No textbook per se Different texts address different parts of the course Textbooks are out-of-date as soon as they appear! Some information will be given as handouts See syllabus for recommendations 37
38 References Scientific publications Particularly when we look at specific methods in depth 38
39 Course Overview Three modules (about one month each), illustrating a different challenge in bioinformatics and different solutions Four tutorials: get your hands into it The three modules are: BIOLOGICAL SEQUENCE CLASSIFICATION SEQUENCE ALIGNMENT PHYLOGENETIC ANALYSIS 39
40 Module 1 Sequence classification Sequences A bunch of numbers A bunch of numbers insight via Decision trees Statistical classification Artificial neural networks Support vector machines 40
41 Module 2 Sequence Alignment Types of alignment problems Dynamic programming Hidden Markov models Heuristics Variations: Bayesian, progressive, graph-based approaches 41
42 Module 3 Phylogenetic analysis Distance matrix methods Character-based methods Searching vs. sampling tree space Statistical support 42
43 Organisms, Genomes, Sequences, and so on Life at Different Resolutions 43
44 Essential properties of an organism Reproduction Sexual Asexual Tetrahymena thermophila ( Amoeba proteus ( 44
45 Essential properties of an organism Cellularity Unicellular Multicellular Treponema pallidum ( Caenorhabditis elegans (959 cells) ( 45
46 Essential properties of an organism Biochemical processes Fermentation Antibiotic synthesis 46
47 The capacity to do all of these things comes from the GENOME of an organism Genome = the complete set of genetic material (DNA for all known organisms) 47
48 Prokaryotes Eukaryotes espacial.org 48
49 The Human Genome 23 linear chromosomes ~3 billion DNA residues ~20,000 genes (controversy!) 49
50 Escherichia coli strain K12 1 circular chromosome, 2 plasmids ~5.6 million DNA residues 5326 genes 50
51 Genes on the main chromosome Gene order 51
52 The DNA sequence of a gene 5 - ATG CGT TAC TTC GAA ATG GCA ACC CAC TCG GGG ACT TCC TCC AAC GGT TGA TAC GCA ATG AAG CTT TAC CGT TGG GTG AGC CCC TGA AGG AGG TTG CCA ACT- 5 52
53 DNA to protein sequence ATG CGT TAC TTC GAA ATG GCA ACC CAC TCG GGG ACT TCC TCC AAC GGT TGA M A Y F E M A T H S G T S S N G * 53
54 Protein sequence and structure M A Y F E M A T H S G T S S N G * 54
55 55
56 Metabolism Proteins working together 56
57 57
58 Pathways (metabolism + self-replication + signalling) = 58
59 Communities of organisms 59
60 60
Practical Bioinformatics
5/2/2017 Dictionaries d i c t i o n a r y = { A : T, T : A, G : C, C : G } d i c t i o n a r y [ G ] d i c t i o n a r y [ N ] = N d i c t i o n a r y. h a s k e y ( C ) Dictionaries g e n e t i c C o
More informationCharacterization of Pathogenic Genes through Condensed Matrix Method, Case Study through Bacterial Zeta Toxin
International Journal of Genetic Engineering and Biotechnology. ISSN 0974-3073 Volume 2, Number 1 (2011), pp. 109-114 International Research Publication House http://www.irphouse.com Characterization of
More informationAdvanced topics in bioinformatics
Feinberg Graduate School of the Weizmann Institute of Science Advanced topics in bioinformatics Shmuel Pietrokovski & Eitan Rubin Spring 2003 Course WWW site: http://bioinformatics.weizmann.ac.il/courses/atib
More informationCrick s early Hypothesis Revisited
Crick s early Hypothesis Revisited Or The Existence of a Universal Coding Frame Ryan Rossi, Jean-Louis Lassez and Axel Bernal UPenn Center for Bioinformatics BIOINFORMATICS The application of computer
More informationSEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA
SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS 1 Prokaryotes and Eukaryotes 2 DNA and RNA 3 4 Double helix structure Codons Codons are triplets of bases from the RNA sequence. Each triplet defines an amino-acid.
More informationGrade Level: AP Biology may be taken in grades 11 or 12.
ADVANCEMENT PLACEMENT BIOLOGY COURSE SYLLABUS MRS. ANGELA FARRONATO Grade Level: AP Biology may be taken in grades 11 or 12. Course Overview: This course is designed to cover all of the material included
More informationLassen Community College Course Outline
Lassen Community College Course Outline BIOL-1 Principles of Molecular and Cellular Biology 4.0 Units I. Catalog Description A course in principles of biology, with special emphasis given to molecular
More informationVirginia Western Community College BIO 101 General Biology I
BIO 101 General Biology I Prerequisites Successful completion of MTE 1, 2, 3, 4, and 5; and a placement recommendation for ENG 111, co-enrollment in ENF 3/ENG 111, or successful completion of all developmental
More informationValley Central School District 944 State Route 17K Montgomery, NY Telephone Number: (845) ext Fax Number: (845)
Valley Central School District 944 State Route 17K Montgomery, NY 12549 Telephone Number: (845)457-2400 ext. 18121 Fax Number: (845)457-4254 Advance Placement Biology Presented to the Board of Education
More informationHigh throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence beyond 950 nm
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence
More informationHonors Biology 9. Dr. Donald Bowlin Ext. 1220
Honors Biology 9 Instructor Dr. Donald Bowlin Phone 412-571-6000 Ext. 1220 Email bowlin@kosd.org Classroom Location Room 220 Mission Statement The KOSD s mission is to provide a safe learning environment
More informationUpdated: 10/11/2018 Page 1 of 5
A. Academic Division: Health Sciences B. Discipline: Biology C. Course Number and Title: BIOL1230 Biology I MASTER SYLLABUS 2018-2019 D. Course Coordinator: Justin Tickhill Assistant Dean: Melinda Roepke,
More informationI. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes.
I. Molecules and Cells: Cells are the structural and functional units of life; cellular processes are based on physical and chemical changes. A. Chemistry of Life B. Cells 1. Water How do the unique chemical
More information1. CHEMISTRY OF LIFE. Tutorial Outline
Tutorial Outline North Carolina Tutorials are designed specifically for the Common Core State Standards for English language arts, the North Carolina Standard Course of Study for Math, and the North Carolina
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More informationSTAAR Biology Assessment
STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules as building blocks of cells, and that cells are the basic unit of
More informationPerformance Indicators: Students who demonstrate this understanding can:
OVERVIEW The academic standards and performance indicators establish the practices and core content for all Biology courses in South Carolina high schools. The core ideas within the standards are not meant
More informationCampbell Biology AP Edition 11 th Edition, 2018
A Correlation and Narrative Summary of Campbell Biology AP Edition 11 th Edition, 2018 To the AP Biology Curriculum Framework AP is a trademark registered and/or owned by the College Board, which was not
More informationSupplementary Information for
Supplementary Information for Evolutionary conservation of codon optimality reveals hidden signatures of co-translational folding Sebastian Pechmann & Judith Frydman Department of Biology and BioX, Stanford
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationWest Windsor-Plainsboro Regional School District AP Biology Grades 11-12
West Windsor-Plainsboro Regional School District AP Biology Grades 11-12 Unit 1: Chemistry of Life Content Area: Science Course & Grade Level: AP Biology, 11 12 Summary and Rationale The structural levels
More informationBiology Assessment. Eligible Texas Essential Knowledge and Skills
Biology Assessment Eligible Texas Essential Knowledge and Skills STAAR Biology Assessment Reporting Category 1: Cell Structure and Function The student will demonstrate an understanding of biomolecules
More informationAP BIOLOGY SUMMER ASSIGNMENT
AP BIOLOGY SUMMER ASSIGNMENT Welcome to EDHS Advanced Placement Biology! The attached summer assignment is required for all AP Biology students for the 2011-2012 school year. The assignment consists of
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationSUPPLEMENTARY DATA - 1 -
- 1 - SUPPLEMENTARY DATA Construction of B. subtilis rnpb complementation plasmids For complementation, the B. subtilis rnpb wild-type gene (rnpbwt) under control of its native rnpb promoter and terminator
More informationSUPPORTING INFORMATION FOR. SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA
SUPPORTING INFORMATION FOR SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA Aik T. Ooi, Cliff I. Stains, Indraneel Ghosh *, David J. Segal
More informationComparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationFAIRBANKS NORTH STAR BOROUGH SCHOOL DISTRICT - SCIENCE CURRICULUM. Prentice Hall Biology (Miller/Levine) 2010 MASTERY CORE OBJECTIVES HIGH SCHOOL
MASTERY CORE OBJECTIVES HIGH SCHOOL LIFE SCIENCE Overview: Life Science is a one-year course for students who learn best with extra time to approach the subject. The academic focus is to develop student
More informationTutorials are designed specifically for the Virginia Standards of Learning to prepare students for the Standards of Learning tests.
Tutorial Outline Tutorials are designed specifically for the Virginia Standards of Learning to prepare students for the Standards of Learning tests. Biology Tutorials offer targeted instruction, practice,
More informationStudying Life. Lesson Overview. Lesson Overview. 1.3 Studying Life
Lesson Overview 1.3 Characteristics of Living Things What characteristics do all living things share? Living things are made up of basic units called cells, are based on a universal genetic code, obtain
More informationAP Biology UNIT 1: CELL BIOLOGY. Advanced Placement
Advanced Placement AP Biology builds students' understanding of biology on both the micro and macro scales. After studying cell biology, students move on to understand how evolution drives the diversity
More informationCOMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.
North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01
More informationBuilding a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy
Supporting Information Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy Cuichen Wu,, Da Han,, Tao Chen,, Lu Peng, Guizhi Zhu,, Mingxu You,, Liping Qiu,, Kwame Sefah,
More informationEvaluate evidence provided by data from many scientific disciplines to support biological evolution. [LO 1.9, SP 5.3]
Learning Objectives Evaluate evidence provided by data from many scientific disciplines to support biological evolution. [LO 1.9, SP 5.3] Refine evidence based on data from many scientific disciplines
More informationNSCI Basic Properties of Life and The Biochemistry of Life on Earth
NSCI 314 LIFE IN THE COSMOS 4 Basic Properties of Life and The Biochemistry of Life on Earth Dr. Karen Kolehmainen Department of Physics CSUSB http://physics.csusb.edu/~karen/ WHAT IS LIFE? HARD TO DEFINE,
More informationGrundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)
More informationField 045: Science Life Science Assessment Blueprint
Field 045: Science Life Science Assessment Blueprint Domain I Foundations of Science 0001 The Nature and Processes of Science (Standard 1) 0002 Central Concepts and Connections in Science (Standard 2)
More informationSupplemental data. Pommerrenig et al. (2011). Plant Cell /tpc
Supplemental Figure 1. Prediction of phloem-specific MTK1 expression in Arabidopsis shoots and roots. The images and the corresponding numbers showing absolute (A) or relative expression levels (B) of
More informationBio 101 General Biology 1
Revised: Fall 2016 Bio 101 General Biology 1 COURSE OUTLINE Prerequisites: Prerequisite: Successful completion of MTE 1, 2, 3, 4, and 5, and a placement recommendation for ENG 111, co-enrollment in ENF
More informationFundamentals of Biology Valencia College BSC1010C
1 Fundamentals of Biology Valencia College BSC1010C 1 Studying Life Chapter objectives: What Is Biology? Is All Life on Earth Related? How Do Biologists Investigate Life? How Does Biology Influence Public
More informationChapter Chemical Uniqueness 1/23/2009. The Uses of Principles. Zoology: the Study of Animal Life. Fig. 1.1
Fig. 1.1 Chapter 1 Life: Biological Principles and the Science of Zoology BIO 2402 General Zoology Copyright The McGraw Hill Companies, Inc. Permission required for reproduction or display. The Uses of
More informationBIOLOGY I: COURSE OVERVIEW
BIOLOGY I: COURSE OVERVIEW The academic standards for High School Biology I establish the content knowledge and skills for Tennessee students in order to prepare them for the rigorous levels of higher
More informationSupporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)-
Supporting Information for Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)- Dependence and Its Ability to Chelate Multiple Nutrient Transition Metal Ions Rose C. Hadley,
More informationLedyard Public Schools Science Curriculum. Biology. Level-2. Instructional Council Approval June 1, 2005
Ledyard Public Schools Science Curriculum Biology Level-2 1422 Instructional Council Approval June 1, 2005 Suggested Time: Approximately 9 weeks Essential Question Cells & Cell Processes 1. What compounds
More informationMap of AP-Aligned Bio-Rad Kits with Learning Objectives
Map of AP-Aligned Bio-Rad Kits with Learning Objectives Cover more than one AP Biology Big Idea with these AP-aligned Bio-Rad kits. Big Idea 1 Big Idea 2 Big Idea 3 Big Idea 4 ThINQ! pglo Transformation
More informationEnergy Requirement Energy existed in several forms satisfied condition 2 (much more UV than present no ozone layer!)
Biology 10 Chapter 19-3 p 553-558 Earth s Early History Objectives Describe the hypotheses scientists have about early Earth, and the origin of life. Describe the theory of how eukaryotic cells formed.
More informationComputational Structural Bioinformatics
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://koehllab.genomecenter.ucdavis.edu/teaching/ecs129 koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite
More informationReadings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell and Reese Student Selected Magazine Article
Unit Subtopics and Duration Unit 1: Principles of Science Themes in science Research and Lab techniques 6 days Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell
More informationSTRUCTURAL BIOINFORMATICS I. Fall 2015
STRUCTURAL BIOINFORMATICS I Fall 2015 Info Course Number - Classification: Biology 5411 Class Schedule: Monday 5:30-7:50 PM, SERC Room 456 (4 th floor) Instructors: Vincenzo Carnevale - SERC, Room 704C;
More informationCreating a Dichotomous Key
Dichotomous Keys A tool used that allows users to determine the identity of unknown species Keys consist of a series of choices, where the user selects from a series of connected pairs Each pair of choices
More informationThe Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
More informationADVANCED PLACEMENT BIOLOGY
ADVANCED PLACEMENT BIOLOGY Description Advanced Placement Biology is designed to be the equivalent of a two-semester college introductory course for Biology majors. The course meets seven periods per week
More informationVCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
More informationComputational methods for predicting protein-protein interactions
Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational
More informationAP Biology Essential Knowledge Cards BIG IDEA 1
AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific
More informationText of objective. Investigate and describe the structure and functions of cells including: Cell organelles
This document is designed to help North Carolina educators teach the s (Standard Course of Study). NCDPI staff are continually updating and improving these tools to better serve teachers. Biology 2009-to-2004
More informationAdvanced Placement Biology
Advanced Placement Biology 2014-2015 Course Description This course is designed to be equivalent to a two-semester college introductory biology course sequence. AP Biology covers topics regularly covered
More informationevoglow - express N kit distributed by Cat.#: FP product information broad host range vectors - gram negative bacteria
evoglow - express N kit broad host range vectors - gram negative bacteria product information distributed by Cat.#: FP-21020 Content: Product Overview... 3 evoglow express N -kit... 3 The evoglow -Fluorescent
More informationSCOTCAT Credits: 20 SCQF Level 7 Semester 1 Academic year: 2018/ am, Practical classes one per week pm Mon, Tue, or Wed
Biology (BL) modules BL1101 Biology 1 SCOTCAT Credits: 20 SCQF Level 7 Semester 1 10.00 am; Practical classes one per week 2.00-5.00 pm Mon, Tue, or Wed This module is an introduction to molecular and
More information2015 FALL FINAL REVIEW
2015 FALL FINAL REVIEW Biomolecules & Enzymes Illustrate table and fill in parts missing 9A I can compare and contrast the structure and function of biomolecules. 9C I know the role of enzymes and how
More informationAP Biology Curriculum Framework
AP Biology Curriculum Framework This chart correlates the College Board s Advanced Placement Biology Curriculum Framework to the corresponding chapters and Key Concept numbers in Campbell BIOLOGY IN FOCUS,
More informationBIOINFORMATICS LAB AP BIOLOGY
BIOINFORMATICS LAB AP BIOLOGY Bioinformatics is the science of collecting and analyzing complex biological data. Bioinformatics combines computer science, statistics and biology to allow scientists to
More informationElectronic supplementary material
Applied Microbiology and Biotechnology Electronic supplementary material A family of AA9 lytic polysaccharide monooxygenases in Aspergillus nidulans is differentially regulated by multiple substrates and
More informationevoglow - express N kit Cat. No.: product information broad host range vectors - gram negative bacteria
evoglow - express N kit broad host range vectors - gram negative bacteria product information Cat. No.: 2.1.020 evocatal GmbH 2 Content: Product Overview... 4 evoglow express N kit... 4 The evoglow Fluorescent
More informationTopic 3: Genetics (Student) Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species.
Topic 3: Genetics (Student) 3.2 Essential Idea: Chromosomes carry genes in a linear sequence that is shared by members of a species. 3.2 Chromosomes 3.2.U1 Prokaryotes have one chromosome consisting of
More informationCELL AND MICROBIOLOGY Nadia Iskandarani
7Course Title: Head of Department: Teacher(s) + e-mail: Cycle/Division: Biology IA: CELL AND MICROBIOLOGY Nadia Iskandarani Ms.Ibtessam: ibtissam.h@greenwood.sch.ae High School Grade Level: Grade 10 Credit
More informationComputational Biology Course Descriptions 12-14
Computational Biology Course Descriptions 12-14 Course Number and Title INTRODUCTORY COURSES BIO 311C: Introductory Biology I BIO 311D: Introductory Biology II BIO 325: Genetics CH 301: Principles of Chemistry
More informationProbability models for machine learning. Advanced topics ML4bio 2016 Alan Moses
Probability models for machine learning Advanced topics ML4bio 2016 Alan Moses What did we cover in this course so far? 4 major areas of machine learning: Clustering Dimensionality reduction Classification
More informationMolecular Biology Of The Cell 6th Edition Alberts
We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with molecular biology of
More informationSSR ( ) Vol. 48 No ( Microsatellite marker) ( Simple sequence repeat,ssr),
48 3 () Vol. 48 No. 3 2009 5 Journal of Xiamen University (Nat ural Science) May 2009 SSR,,,, 3 (, 361005) : SSR. 21 516,410. 60 %96. 7 %. (),(Between2groups linkage method),.,, 11 (),. 12,. (, ), : 0.
More informationEvolvable Neural Networks for Time Series Prediction with Adaptive Learning Interval
Evolvable Neural Networs for Time Series Prediction with Adaptive Learning Interval Dong-Woo Lee *, Seong G. Kong *, and Kwee-Bo Sim ** *Department of Electrical and Computer Engineering, The University
More information6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008
MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationFORMAT FOR CORRELATION TO THE GEORGIA PERFORMANCE STANDARDS. Subject Area: Science State-Funded Course: Biology
FORMAT FOR CORRELATION TO THE GEORGIA PERFORMANCE STANDARDS Subject Area: Science State-Funded Course: Biology Textbook Title: Biology, (Miller/Levine) 2010 Publisher: Pearson Education SCSh1 Co-Requisite
More informationModelling and Analysis in Bioinformatics. Lecture 1: Genomic k-mer Statistics
582746 Modelling and Analysis in Bioinformatics Lecture 1: Genomic k-mer Statistics Juha Kärkkäinen 06.09.2016 Outline Course introduction Genomic k-mers 1-Mers 2-Mers 3-Mers k-mers for Larger k Outline
More informationUnit # - Title Intro to Biology Unit 1 - Scientific Method Unit 2 - Chemistry
Intro to Biology Unit 1 - Scientific Method Unit 2 - Chemistry What is Biology? What is Science? What tools, skills, knowledge, and dispositions are needed to conduct scientific inquiry? How do the rules
More informationBioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
More informationMolecular and cellular biology is about studying cell structure and function
Chapter 1 Exploring the World of the Cell In This Chapter Discovering the microscopic world Getting matter and energy Reading the genetic code Molecular and cellular biology is about studying cell structure
More informationBioinformatics and BLAST
Bioinformatics and BLAST Overview Recap of last time Similarity discussion Algorithms: Needleman-Wunsch Smith-Waterman BLAST Implementation issues and current research Recap from Last Time Genome consists
More informationProgramme Specification (Undergraduate) For 2017/18 entry Date amended: 25/06/18
Programme Specification (Undergraduate) For 2017/18 entry Date amended: 25/06/18 1. Programme title(s) and UCAS code(s): BSc Biological Sciences C100 BSc Biological Sciences (Biochemistry) C700 BSc Biological
More informationLamar University College of Arts and Sciences. Hayes Building Phone: Office Hours: T 2:15-4:00 R 2:15-4:00
Fall 2014 Department: Lamar University College of Arts and Sciences Biology Course Number/Section: BIOL 1406/01 Course Title: General Biology I Credit Hours: 4.0 Professor: Dr. Randall Terry Hayes Building
More informationSara C. Madeira. Universidade da Beira Interior. (Thanks to Ana Teresa Freitas, IST for useful resources on this subject)
Bioinformática Sequence Alignment Pairwise Sequence Alignment Universidade da Beira Interior (Thanks to Ana Teresa Freitas, IST for useful resources on this subject) 1 16/3/29 & 23/3/29 27/4/29 Outline
More informationBiology the study of life. Lecture 15
Biology the study of life Lecture 15 Life (a life form: an organism ) can be defined as an organized genetic unit capable of metabolism, reproduction, & evolution (Purves et al., 2003) There is order to
More informationBiology. Slide 1 of 36. End Show. Copyright Pearson Prentice Hall
Biology 1 of 36 2 of 36 Formation of Earth Formation of Earth Hypotheses about Earth s early history are based on a relatively small amount of evidence. Gaps and uncertainties make it likely that scientific
More informationEnduring understanding 1.A: Change in the genetic makeup of a population over time is evolution.
The AP Biology course is designed to enable you to develop advanced inquiry and reasoning skills, such as designing a plan for collecting data, analyzing data, applying mathematical routines, and connecting
More informationAP Biology. Read college-level text for understanding and be able to summarize main concepts
St. Mary's College AP Biology Continuity and Change Consider how specific changes to an ecosystem (geological, climatic, introduction of new organisms, etc.) can affect the organisms that live within it.
More informationBiology. Lessons: 15% Quizzes: 25% Projects: 30% Tests: 30% Assignment Weighting per Unit Without Projects. Lessons: 21% Quizzes: 36% Tests: 43%
Biology This course consists of 12 units, which provide an overview of the basic concepts and natural laws of Biology. Unit 1 deals with the organization of living organisms. Unit 2 addresses the chemistry
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationGenomes and Their Evolution
Chapter 21 Genomes and Their Evolution PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationAP* Biology Prep Course
AP* Biology Prep Course SYLLABUS Welcome to the FlinnPREP AP* Biology Online Prep Course! Your enrollment in this course is your first step toward a 5 on the AP* Biology exam. FlinnPREP covers fundamental
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Zn 2+ -binding sites in USP18. (a) The two molecules of USP18 present in the asymmetric unit are shown. Chain A is shown in blue, chain B in green. Bound Zn 2+ ions are shown as
More informationScience Unit Learning Summary
Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In
More informationTeaching Licensure: Biology
Teaching Licensure: Biology About the test Teacher qualification test in biology is a 2-hour computerized test that targets teachers who teach biology in cycle 3 schools in UAE. The content of this test
More informationBiology: End of Semester Projects The end of the semester is HERE!!!
Biology: End of Semester Projects The end of the semester is HERE!!! We will be doing a project that will sum up what we have done this semester. It will help you review the material in one of the units
More informationThe minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
More informationI. Molecules & Cells. A. Unit One: The Nature of Science. B. Unit Two: The Chemistry of Life. C. Unit Three: The Biology of the Cell.
I. Molecules & Cells A. Unit One: The Nature of Science a. How is the scientific method used to solve problems? b. What is the importance of controls? c. How does Darwin s theory of evolution illustrate
More informationOhio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse
Tutorial Outline Ohio Tutorials are designed specifically for the Ohio Learning Standards to prepare students for the Ohio State Tests and end-ofcourse exams. Biology Tutorials offer targeted instruction,
More informationA A A A B B1
LEARNING OBJECTIVES FOR EACH BIG IDEA WITH ASSOCIATED SCIENCE PRACTICES AND ESSENTIAL KNOWLEDGE Learning Objectives will be the target for AP Biology exam questions Learning Objectives Sci Prac Es Knowl
More informationMicrobes usually have few distinguishing properties that relate them, so a hierarchical taxonomy mainly has not been possible.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationMicrobial Taxonomy. Slowly evolving molecules (e.g., rrna) used for large-scale structure; "fast- clock" molecules for fine-structure.
Microbial Taxonomy Traditional taxonomy or the classification through identification and nomenclature of microbes, both "prokaryote" and eukaryote, has been in a mess we were stuck with it for traditional
More informationSTAAR Biology: Assessment Activities. Biological Evolution and Classification. The Charles A. Dana Center at The University of Texas at Austin
Biological Evolution and Classification Scientific Evidence of Common Ancestry 211 212 Biological Evolution and Classification Teacher Pages Purpose The purpose of this activity is to reinforce students
More information