ACCGGTTTCGAATTGACAATTAATCATCGGCTCGTATAATGGTACC TGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGG AATTGTGAGCGGATAACAATTTCACAGGTACC
|
|
|
- Adrian Nelson
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTAL TABLE S1. Promoter and riboswitch sequences used in this study. Predicted transcriptional start sites are bolded and underlined. Riboswitch sequences were obtained from Topp et al., Appl Environ Microbiol, 76(23):7881-4, 2010, and were cloned immediately after the promoter sequences listed. Aptamer sequences are underlined. ATG start codons immediately precede myc-yfp or sacb, with the exception of the riboswitch F EcoRI vector control. Name conii promoter trc promoter with laco Riboswitch A Riboswitch B Riboswitch C Riboswitch D Riboswitch E Riboswitch F Riboswitch F EcoRI Riboswitch F, no aptamer Sequence ACCGGTTTCGAATTGACAATTAATCATCGGCTCGTATAATGGTACC TGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGG AATTGTGAGCGGATAACAATTTCACAGGTACC CTGAGAAGGGGCAACAAGATG CTGAGAAGGGGCAACAAGATG CGGTACCTGATAAGATAGGGGTGATACCAGCATCGTCTT GATGCCCTTGGCAGCACCAAGGGACAACAAGATG CTGCTAAGGTAACAACAAGATG CTGCTAAGGAGGTAACAACAAGATG CTGCTAAGGAGGCAACAAGATG CTGCTAAGGAGGCAACAAGATGAATTC TGCTAAGGAGGCAACAAGATG
2 A! vector! var A! var C! var D! var E! var B! B! vector! var A! var C! var D! var E! var B! FIG S1 Fluorescence micrographs of model laboratory strains expressing different riboswitch variants regulating expression of YFP. (A) Synechococcus elongatus PCC 7942 and B. Anabaena sp. PCC Images on the left show autofluorescence from photosynthetic pigments and images on the right show YFP expression. Cultures were treated with no additions (BG11), 1% DMSO, or 2 mm theophylline for one day. Scale bars depict 5 microns.!
3 A! vector! var A! var B! var C! var D! var E! B! vector! var A! var B! var C! var D! var E! FIG S2 Fluorescence micrographs of model production strains expressing different riboswitch variants regulating expression of YFP. (A) Leptolyngbya sp. BL0902 and (B) Synechocystis sp. WHSyn. Images on the left show autofluorescence from photosynthetic pigments, and images on the right show YFP expression. Cultures were treated with no additions (BG11), 1% DMSO, or 2 mm theophylline for one day. Scale bars depict 5 microns.!
4 A! Synechococcus! Induction Ratio! Fluorescence Units! B! wild type! vector! variant A! variant B! variant C! variant D! variant E! FIG S3 Flow cytometry analysis of Synechococcus elongatus PCC 7942 expressing different riboswitch variants regulating expression of YFP. Cultures were treated with no additions (BG11), 1% DMSO, or 2 mm theophylline for one day. (A) YFP expression was quantified using the geometric mean of each sample after background subtraction of vector-only control strains. YFP expression in induced (closed circles) and uninduced (open circles) cultures. Fluorescence units are averages of three replicates +/- SD (scale on right). Columns depict induction ratios calculated as induced values divided by uninduced values (scale on left). (B) Flow cytometry data are shown in pairs, with histograms on the left showing the distribution of autofluorescence (FL3), and histograms on the right showing the distribution of YFP expression (FL1) in log scale, with signal intensity (X-axis) versus number of cells (Y-axis).!
5 A! 2 Synechocystis! 150 B! Induction Ratio! 15" 1 5" wild type! A" B" C" D" E" F" Fluorescence"Units" Fluorescence Units! vector! variant A! variant B! variant C! variant D! variant E! FIG S4 Flow cytometry analysis of Synechocystis sp. WHSyn expressing different riboswitch variants regulating expression of YFP. Cultures were treated with no additions (BG11), 1% DMSO, or 2 mm theophylline for one day. (A) YFP expression was quantified using the geometric mean of each sample after background subtraction of vector-only control strains. YFP expression in induced (closed circles) and uninduced (open circles) cultures. Fluorescence units are averages of three replicates +/- SD (scale on right). Columns depict induction ratios calculated as induced values divided by uninduced values (scale on left). (B) Flow cytometry data are shown in pairs, with histograms on the left showing the distribution of autofluorescence (FL3), and histograms on the right showing the distribution of YFP expression (FL1) in log scale, with signal intensity (X-axis) versus number of cells (Y-axis).!
6 Synechococcus! Ac9va9on"Ra9o" Induction Ratio! 2 1 Riboswitch F(theo" F! F(RBS" F! Fluorescence"Uni Units! FIG S5 Expression under riboswitch F regulation compared to constitutive translation from only ribosome binding site F (RBS F) in Synechococcus elongatus PCC Transcription in both strains was driven by the P conii promoter. The RBS F construct was constructed by deleting the aptamer region of riboswitch F (see Supplemental Table 1). Strains were treated with 2 mm theophylline or 1% DMSO negative control for one day. Fluorescence units (scale on right) of YFP expression in induced (closed circles) and uninduced (open circles) cultures. Values given are averages of three replicates +/- SD. Columns depict induction ratios, calculated as induced values divided by uninduced values (scale on left). Measurements were made using a fluorescence plate reader after normalization of cultures by OD 750.!
Regulation of Gene Expression in Diverse Cyanobacterial Species Using
AEM Accepts, published online ahead of print on 22 August 2014 Appl. Environ. Microbiol. doi:10.1128/aem.01697-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 Regulation
the noisy gene Biology of the Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB)
Biology of the the noisy gene Universidad Autónoma de Madrid Jan 2008 Juan F. Poyatos Spanish National Biotechnology Centre (CNB) day III: noisy bacteria - Regulation of noise (B. subtilis) - Intrinsic/Extrinsic
Bi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Breker et al., http://www.jcb.org/cgi/content/full/jcb.201301120/dc1 Figure S1. Single-cell proteomics of stress responses. (a) Using
Supplementary Materials for
www.advances.sciencemag.org/cgi/content/full/1/5/e1500358/dc1 Supplementary Materials for Transplantability of a circadian clock to a noncircadian organism Anna H. Chen, David Lubkowicz, Vivian Yeong,
Supplementary Information for. Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria
Supplementary Information for Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria Isabella Santi 1 *, Neeraj Dhar 1, Djenet Bousbaine 1, Yuichi Wakamoto, John D.
Symbol Definition Value Range (Experimental) Time of the end of residual growth 10 h 10
Table 1. Definitions and experimental values of parameters Symbol Definition Value ange (Experimental) T I Time of the end of residual growth 10 h 10 T D D D ate s s G max V max c-fed c-fed Delay in Death
Promoter Sequence Determines the Relationship between Expression Level and Noise
Promoter Sequence Determines the Relationship between Expression Level and Noise Lucas. Carey 1., David van Dijk 1,3., Peter M. A. Sloot 2,3, Jaap A. Kaandorp 3, Eran Segal 1 * 1 Department of Computer
Slide 1 / 7. Free Response
Slide 1 / 7 Free Response Slide 2 / 7 Slide 3 / 7 1 The above diagrams illustrate the experiments carried out by Griffith and Hershey and Chaserespectively. Describe the hypothesis or conclusion that each
Supplemental Data. Hou et al. (2016). Plant Cell /tpc
Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence
Supplementary Figure 1. Confirmation of REF52-hE2F1p::4NLS-d4Venus reporter cells and characterization of E2F dynamics. (a) Alignment of E2F dynamics
Supplementary Figure 1. Confirmation of REF52-hE2F1p::4NLS-d4Venus reporter cells and characterization of E2F dynamics. (a) Alignment of E2F dynamics trajectories to endogenous E2F1 mrna expression. Gray
Chapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes
Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
Supporting Online Material
Supporting Online Material 1 Materials and Methods 1.1 Strains and Plasmids All plasmids used in this study were derived from a set of yeast single integration vectors which were gifts from N. Helman and
SUPPLEMENTARY MATERIAL
Activity [RLU] Activity [RLU] RAB:TALA TALA:RAB TALB:RAB RAB:TALB RAB:TALB TALB:RAB TALA:RAB RAB:TALA Activity [nrlu] Activity [nrlu] SUPPLEMENTARY MATERIAL a b 100 100 50 50 0 0 5 25 50 5 25 50 0 50 50
Cell-free and in vivo characterization of Lux, Las, and Rpa quorum activation systems in E. coli Supporting Information
Cell-free and in vivo characterization of Lux, Las, and Rpa quorum activation systems in E. coli Supporting Information Andrew D. Halleran 1 and Richard M. Murray 1, 2 1. Biology and Biological Engineering,
A transcription activator-like effector induction system mediated by proteolysis
SUPPLEMENTARY INFORMATION A transcription activator-like effector induction system mediated by proteolysis Matthew F. Copeland 1,2, Mark C. Politz 1, Charles B. Johnson 1,3, Andrew L. Markley 1, Brian
4. Why not make all enzymes all the time (even if not needed)? Enzyme synthesis uses a lot of energy.
1 C2005/F2401 '10-- Lecture 15 -- Last Edited: 11/02/10 01:58 PM Copyright 2010 Deborah Mowshowitz and Lawrence Chasin Department of Biological Sciences Columbia University New York, NY. Handouts: 15A
Supplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA
I (pa) I (pa) A WT + HCO 3 B 2 V (mv) 15 1 5 5 2 slac14/δnc #5 + HCO 3 4 6 WT (n = 6) 8 WT + HCO 3 (n = 7) slac14/δnc #5 (n = 6) slac14/δnc #5 + HCO 3 (n = 1) C WT + ABA D 2 V (mv) 15 1 5 5 2 slac14/δnc
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
Prochlorococcus (a model marine microbe)
chlorococcus (a model marine microbe) 0.5μm Features of a Model Organism for Microbial Oceanography Widespread Abundant Predictable Simple Culture collection Amenable to study in the field Genomic Database
Fitness constraints on horizontal gene transfer
Fitness constraints on horizontal gene transfer Dan I Andersson University of Uppsala, Department of Medical Biochemistry and Microbiology, Uppsala, Sweden GMM 3, 30 Aug--2 Sep, Oslo, Norway Acknowledgements:
Production of recombinant proteins in microalgae at pilot greenhouse scale
Production of recombinant proteins in microalgae at pilot greenhouse scale Javier Gimpel University of California, San Diego Volvox carteri Algae Biomass Summit 2014 San Diego, CA 10/01/14 Expression of
GENETICS - CLUTCH CH.12 GENE REGULATION IN PROKARYOTES.
GEETICS - CLUTCH CH.12 GEE REGULATIO I PROKARYOTES!! www.clutchprep.com GEETICS - CLUTCH CH.12 GEE REGULATIO I PROKARYOTES COCEPT: LAC OPERO An operon is a group of genes with similar functions that are
Translation and Operons
Translation and Operons You Should Be Able To 1. Describe the three stages translation. including the movement of trna molecules through the ribosome. 2. Compare and contrast the roles of three different
Other host processes. Key. Orthogonal translation
Core host processes s e s e s e p T s i s i s i p E Metabolism Other host processes p H Host gene expression X {E, T, H} e e e Key Host mrnas Circuit mrnas Proteins ω X (e) e Core ribosomal mrnas h-rrna
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,
Supporting online material
Supporting online material Materials and Methods Target proteins All predicted ORFs in the E. coli genome (1) were downloaded from the Colibri data base (2) (http://genolist.pasteur.fr/colibri/). 737 proteins
7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
Stochastic simulations!
Stochastic simulations! Application to biomolecular networks! Literature overview Noise in genetic networks! Origins! How to measure the noise and distinguish between the two sources of noise (intrinsic
Stochastic simulations
Stochastic simulations Application to molecular networks Literature overview Noise in genetic networks Origins How to measure and distinguish between the two types of noise (intrinsic vs extrinsic)? What
Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for
Supplemental Methods Mini-Tn7 Derivative Construction and Characterization. Mini-Tn7 derivatives for constitutive expression of fluorescent proteins in S. oneidensis were constructed as follows. The EcoRI-XbaI
Chapter 17 The Mechanism of Translation I: Initiation
Chapter 17 The Mechanism of Translation I: Initiation Focus only on experiments discussed in class. Completely skip Figure 17.36 Read pg 521-527 up to the sentence that begins "In 1969, Joan Steitz..."
Supplemental Information
Molecular Cell, Volume 52 Supplemental Information The Translational Landscape of the Mammalian Cell Cycle Craig R. Stumpf, Melissa V. Moreno, Adam B. Olshen, Barry S. Taylor, and Davide Ruggero Supplemental
Multistability in the lactose utilization network of E. coli. Lauren Nakonechny, Katherine Smith, Michael Volk, Robert Wallace Mentor: J.
Multistability in the lactose utilization network of E. coli Lauren Nakonechny, Katherine Smith, Michael Volk, Robert Wallace Mentor: J. Ruby Abrams Motivation Understanding biological switches in the
Supplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing
Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing 0.1% SDS without boiling. The gel was analyzed by a fluorescent
Regulation of Gene Expression in Bacteria and Their Viruses
11 Regulation of Gene Expression in Bacteria and Their Viruses WORKING WITH THE FIGURES 1. Compare the structure of IPTG shown in Figure 11-7 with the structure of galactose shown in Figure 11-5. Why is
Supporting Information
1 Supporting Information 5 6 7 8 9 10 11 1 1 1 15 16 17 Sequences: E. coli lysine riboswitch (ECRS): GTACTACCTGCGCTAGCGCAGGCCAGAAGAGGCGCGTTGCCCAAGTAACGGTGTTGGAGGAGCCAG TCCTGTGATAACACCTGAGGGGGTGCATCGCCGAGGTGATTGAACGGCTGGCCACGTTCATCATCGG
Biology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
BME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
Chapter 5. Design Principles for Riboswitch Function. The text in this chapter is reprinted with permission from Chase L Beisel and Christina D
57 Chapter 5 Design Principles for Riboswitch Function The text in this chapter is reprinted with permission from Chase L Beisel and Christina D Smole. PLoS Comput Biol 2009, 5(4): e000363. doi:0.37/journal.pcbi.000363.
MicroRNA mir-34 provides robustness to environmental stress response via
MicroRNA mir-34 provides robustness to environmental stress respoe via the DAF-16 network in C. elega Meltem Isik 1,2, T. Keith Blackwell 2, and Eugene Berezikov 1,3 1 Hubrecht Ititute-KNAW and University
Optimization of the heme biosynthesis pathway for the production of. 5-aminolevulinic acid in Escherichia coli
Supplementary Information Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli Junli Zhang 1,2,3, Zhen Kang 1,2,3, Jian Chen 2,3 & Guocheng Du 2,4
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Comparing rotated- and nonrotated-state lifetimes among mrna m 6 A modifications in different codon contexts. a. mrna sequences used for each experiments, as same as shown in Figure
Supporting information for
Supporting information for Rewiring multi-domain protein switches: transforming a fluorescent Zn 2+ -sensor into a light-responsive Zn 2+ binding protein Stijn J.A. Aper and Maarten Merkx Laboratory of
Energy and Cellular Metabolism
1 Chapter 4 About This Chapter Energy and Cellular Metabolism 2 Energy in biological systems Chemical reactions Enzymes Metabolism Figure 4.1 Energy transfer in the environment Table 4.1 Properties of
2. Mathematical descriptions. (i) the master equation (ii) Langevin theory. 3. Single cell measurements
1. Why stochastic?. Mathematical descriptions (i) the master equation (ii) Langevin theory 3. Single cell measurements 4. Consequences Any chemical reaction is stochastic. k P d φ dp dt = k d P deterministic
SUPPLEMENTARY INFORMATION
med!1,2 Wild-type (N2) end!3 elt!2 5 1 15 Time (minutes) 5 1 15 Time (minutes) med!1,2 end!3 5 1 15 Time (minutes) elt!2 5 1 15 Time (minutes) Supplementary Figure 1: Number of med-1,2, end-3, end-1 and
3D-Printed Fluidic Devices Enable Quantitative Evaluation of Blood Components in Modified Storage Solutions for Use in Transfusion Medicine
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 214 Supplementary Information 3D-Printed Fluidic Devices Enable Quantitative Evaluation of Blood Components
UNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
Lecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
Videos. Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.
Translation Translation Videos Bozeman, transcription and translation: https://youtu.be/h3b9arupxzg Crashcourse: Transcription and Translation - https://youtu.be/itsb2sqr-r0 Translation Translation The
Accurate Recovery of Ribosome Positions Reveals Slow Translation of Wobble-Pairing Codons in Yeast
Accurate Recovery of Ribosome Positions Reveals Slow Translation of Wobble-Pairing Codons in Yeast Hao Wang 1, Joel McManus 1,2, and Carl Kingsford 1 1 Computational Biology Department, School of Computer
Ron et al SUPPLEMENTAL DATA
Ron et al SUPPLEMENTAL DATA Hairy root transformation using Agrobacterium rhizogenes as a tool for exploring cell type-specific gene expression and function using tomato as a model Mily Ron, Kaisa Kajala,
PROTEIN SYNTHESIS INTRO
MR. POMERANTZ Page 1 of 6 Protein synthesis Intro. Use the text book to help properly answer the following questions 1. RNA differs from DNA in that RNA a. is single-stranded. c. contains the nitrogen
Name: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
Multiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
Supplementary Figure 1. Schematic overview of single-molecule tracking to quantify regulator unbinding kinetics from chromosome in living E.
Supplementary Figure 1. Schematic overview of single-molecule tracking to quantify regulator unbinding kinetics from chromosome in living E. coli cells and data analysis procedures. (a1-a2) Experimental
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
Computational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
A synthetic oscillatory network of transcriptional regulators
A synthetic oscillatory network of transcriptional regulators Michael B. Elowitz & Stanislas Leibler, Nature, 403, 2000 igem Team Heidelberg 2008 Journal Club Andreas Kühne Introduction Networks of interacting
Biosensors 2017, 7, 4; doi: /bios
S1 of S5 Supplementary Materials: Alternating Current-Dielectrophoresis Collection and Chaining of Phytoplankton on Chip: Comparison of Individual Species and Artificial Communities Coralie Siebman, Orlin
pvitro1-blasti-gfp/seap
pvitro1-blasti-gfp/seap An expression plasmid coding for the GFP and SEAP reporter genes Catalog # pvitro1-bgfpsp For research use only Version # 15H17-MM PRODUCT INFORMATION Contents: 20 µg of pvitro1-blasti-gfp/seap
BE 150: Design Principles of Genetic Circuits
BE 50: Design Principles of Genetic Circuits Justin Bois Caltech Spring, 208 This document was prepared at Caltech with financial support from the Donna and Benjamin M. Rosen Bioengineering Center. 208
SUPPLEMENTARY INFORMATION
Supplementar Information Stochastic gene expression out-of-stead-state in the canobacterial circadian clock Jeffre R. Chabot, Juan M. Pedraza, Prashant Luitel & Alexander van Oudenaarden EXPERIMENTAL MATERIALS
Bacterial strains, plasmids, and growth conditions. Bacterial strains and
I Text I Materials and Methods acterial strains, plasmids, and growth conditions. acterial strains and plasmids used in this study are listed in I Table. almonella enterica serovar Typhimurium strains
FSC-W FSC-H CD4 CD62-L
Supplementary Fig. 1 a SSC-A FSC-A FSC-W FSC-H SSC-W SSC-H CD4 CD62-L b SSC-A FSC-A FSC-W FSC-A FSC-A 7-AAD FSC-A CD4 IL-9 CD4 c SSC-A FSC-A FSC-W FSC-H SSC-W SSC-H 7-AAD KI67 Annexin-V 7-AAD d I L -5
Syllabus for Grade 7. More details on each of the topics is covered in the following pages.
Syllabus for Grade 7 Chapter 1 Algebraic Reasoning Chapter 2 Integers and rational numbers Chapter 3 Number Theory Chapter 4 Rational number Chapter 5 Patterns and functions Chapter 6 Proportional Relationships
ALGEBRA GRADE 7 MINNESOTA ACADEMIC STANDARDS CORRELATED TO MOVING WITH MATH. Part B Student Book Skill Builders (SB)
MINNESOTA ACADEMIC STANDARDS CORRELATED TO MOVING WITH MATH ALGEBRA GRADE 7 NUMBER AND OPERATION Read, write, represent and compare positive and negative rational numbers, expressed as integers, fractions
(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular microbiology
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular microbiology Time Allowed: 1 hour 30 minutes Marking
Translation Part 2 of Protein Synthesis
Translation Part 2 of Protein Synthesis IN: How is transcription like making a jello mold? (be specific) What process does this diagram represent? A. Mutation B. Replication C.Transcription D.Translation
Regression for finding binding energies
Regression for finding binding energies (c) 2016 Justin Bois. This work is licensed under a Creative Commons Attribution License CC-BY 4.0. All code contained herein is licensed under MIT license. Now
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
Advanced Topics in RNA and DNA. DNA Microarrays Aptamers
Quiz 1 Advanced Topics in RNA and DNA DNA Microarrays Aptamers 2 Quantifying mrna levels to asses protein expression 3 The DNA Microarray Experiment 4 Application of DNA Microarrays 5 Some applications
Bioinformatics: Network Analysis
Bioinformatics: Network Analysis Kinetics of Gene Regulation COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 The simplest model of gene expression involves only two steps: the
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
MAKIKO AICHI AND TATSUO OMATA* Department of Applied Biological Sciences, School of Agricultural Sciences, Nagoya University, Nagoya, Japan
JOURNAL OF BACTERIOLOGY, Aug. 1997, p. 4671 4675 Vol. 179, No. 15 0021-9193/97/$04.00 0 Copyright 1997, American Society for Microbiology Involvement of NtcB, a LysR Family Transcription Factor, in Nitrite
DNA Technology, Bacteria, Virus and Meiosis Test REVIEW
Be prepared to turn in a completed test review before your test. In addition to the questions below you should be able to make and analyze a plasmid map. Prokaryotic Gene Regulation 1. What is meant by
Written Exam 15 December Course name: Introduction to Systems Biology Course no
Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate
K i + [R i ] n = [Rtot i ] (2) ] = β i [M i ] δ i [Ri tot ] (5) + α m j (6) 1 + r n i. dr i dt = βm i δr i (7) m j = βm i = δr i (9) 1 + r n + α.
![K i + [R i ] n = [Rtot i ] (2) ] = β i [M i ] δ i [Ri tot ] (5) + α m j (6) 1 + r n i. dr i dt = βm i δr i (7) m j = βm i = δr i (9) 1 + r n + α.](/thumbs/85/92758342.jpg "K i + [R i ] n = [Rtot i ] (2) ] = β i [M i ] δ i [Ri tot ] (5) + α m j (6) 1 + r n i. dr i dt = βm i δr i (7) m j = βm i = δr i (9) 1 + r n + α.")
The lamba phage will remain in the lysogenic state if ci proteins preominate, but will be transforme into the lytic cycle if cro proteins preominate. cro: (Control of Repressor's Operator) Transcription
Nature Protocols: doi: /nprot Supplementary Figure 1
Supplementary Figure 1 Photographs of the 3D-MTC device and the confocal fluorescence microscopy. I: The system consists of a Leica SP8-Confocal microscope (with an option of STED), a confocal PC, a 3D-MTC
Supporting Information
Supporting Information Mullins et al. 10.1073/pnas.0906781106 SI Text Detection of Calcium Binding by 45 Ca 2 Overlay. The 45 CaCl 2 (1 mci, 37 MBq) was obtained from NEN. The general method of 45 Ca 2
Cannibalism by Sporulating Bacteria
Cannibalism by Sporulating Bacteria José E. González-Pastor, Erret C. Hobbs, Richard Losick 2003. Science 301:510-513 Introduction Some bacteria form spores. Scientist are intrigued by them. Bacillus subtilis
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Figure S1. Mitochondrial morphology in Fis1-null, Mff-null and Fis1/Mff-null MEF cells. (A) Western blotting of lysates from Fis1-null, Mff-null and Fis1/Mff-null cells. Lysates were
arxiv: v2 [q-bio.mn] 20 Nov 2017
![arxiv: v2 [q-bio.mn] 20 Nov 2017](/thumbs/90/101591847.jpg "arxiv: v2 [q-bio.mn] 20 Nov 2017")
Models of protein production with cell cycle Renaud Dessalles, Vincent Fromion, Philippe Robert arxiv:7.6378v [q-bio.mn] Nov 7 Abstract Classical stochastic models of protein production usually do not
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/345/ra91/dc1 Supplementary Materials for TGF-β induced epithelial-to-mesenchymal transition proceeds through stepwise activation of multiple feedback loops Jingyu
SUPPLEMENTARY INFORMATION
PRC2 represses dedifferentiation of mature somatic cells in Arabidopsis Momoko Ikeuchi 1 *, Akira Iwase 1 *, Bart Rymen 1, Hirofumi Harashima 1, Michitaro Shibata 1, Mariko Ohnuma 1, Christian Breuer 1,
1. In most cases, genes code for and it is that
Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2362 Figure S1 CYLD and CASPASE 8 genes are co-regulated. Analysis of gene expression across 79 tissues was carried out as described previously [Ref: PMID: 18636086]. Briefly, microarray
Supplementary information
Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 2018 Bütof et al., page 1 Supplementary information Supplementary Table S1. Metal content of C. metallidurans
The Making of the Fittest: Evolving Switches, Evolving Bodies
INTRODUCTION MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH The types and amounts of proteins produced by a given cell in the body are very important and carefully regulated. Transcribing
Sll1263, a Unique Cation Diffusion Facilitator Protein that Promotes Iron Uptake in the Cyanobacterium Synechocystis sp.
Regular Paper Sll1263, a Unique Cation Diffusion Facilitator Protein that Promotes Iron Uptake in the Cyanobacterium Synechocystis sp. Strain PCC 6803 Hai-Bo Jiang 1, Wen-Jing Lou 1, Han-Ying Du 1, Neil
Random Boolean Networks
Random Boolean Networks Boolean network definition The first Boolean networks were proposed by Stuart A. Kauffman in 1969, as random models of genetic regulatory networks (Kauffman 1969, 1993). A Random
2 Genome evolution: gene fusion versus gene fission
2 Genome evolution: gene fusion versus gene fission Berend Snel, Peer Bork and Martijn A. Huynen Trends in Genetics 16 (2000) 9-11 13 Chapter 2 Introduction With the advent of complete genome sequencing,
Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring
Current Biology Supplemental Information Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring Caroline Laplante, Julien Berro, Erdem Karatekin,