Potato Genome Analysis
|
|
- Andra Skinner
- 6 years ago
- Views:
Transcription
1 Potato Genome Analysis Xin Liu Deputy director BGI research WCRTC Nanning
2 Reference genome construction???????????????????????????????????????? Sequencing HELL RIEND WELCOME BGI ZHEN LLOFRI DSWEL METOBG HENZH HELLOF SWEL METO GISHEN ELLOFR DSW COM OBGI ENZHEN OFIIEN WELCOM GISH NZHEN Assemble HELLO FRIENDS WELCOME TO BGISHENZHEN
3 Second generation sequencing for assembly Construct libraries with hierarchical insert-sizes; 250bp, 500bp, 800bp, 2kb, 5kb, 10kb, 20kb, 40kb Sequence the libraries; 60X genome coverage; De novo assembly Annotation and evolutionary analysis
4 Genome survey 1. 30X data 2. K-mer analysis 3. Preliminary assembly 4. Heterozygosity simulation analysis 5. GC depth distribution analysis 1.Genome size 2.Heterozygosity rate 3.GC content 4.Repeat sequence proportion
5 The potato genome Would provide important resource for crop improvement
6 Information of potato genome Autotetraploid (2n=4x=48) Highly heterozygous Heterozygous diploid available Double haplotype available Different dataset available Genome size: 850 Mb
7 Sample selection DM R44 (DM) resulted from chromosome doubling of a monoploid (1n=1x=12) derived by anther culture of a heterozygous diploid (2n=2x=24) S. tuberosum group Phureja clone (PI ).
8 Heterozygosity affecting genome assembly Heterozygosity would result in breakdown of the assembly. Rei Kajitani, Kouta Toshimoto, Hideki Noguchi, et al.
9 Assess the genome 33,761,617,031 bases Peak at 40 Genome size estimated to be: 844 Mb S. tuberosum group Phureja DM R44
10 The heterozygous diploid S. tuberosum group Tuberosum RH
11 Assessing the heterozygosity
12 Assemble the DM genome: data
13 The potato genome assembly 727 Mb, 6.1% Ns/gaps, 86% of the genome N kb, 443 super scaffolds a: Chromosome karyotype b: Gene density c: Repeats coverage d: Transcription state e: GC content f: Subtelomeric repeats distribution
14 Comparing to Sanger sequenced BACs 97.1% of 181,558 available Sanger-sequenced S. tuberosum ESTs
15 Comparing to Sanger sequenced BACs
16 Comparing to BAC/fosmid ends
17 Anchoring to the chromosomes Anchored 623Mb (86%) to chromosomes With 90.3% of the genes on chromosomes
18 Repeat annotation and assessment
19 Repeat content
20 Gene annotation Genomic sequence Protein sequences Rough alignment ab initio prediction Alignment cdna/est sequences Syteny info. Precise alignment Homologybased genes Post-filtering ab initio genes cdna/est genes TE proteins 12.1% derived solely from ab initio gene predictions RNA-seq reads Genome mapping Gene sets combination Combined gene set Gene sets modification 31.5 Gb of RNA-Seq data from 32 DM and 16 RH samples/tissues 90.2% of 824,621,408 DM reads and 88.6% of 140,375,647 RH reads mapped Final gene set 39,031 protein-coding genes 9,875 genes (25.3%) had alternative splicing
21 Gene annotation result
22 Genome evolution gene families Oryza sativa Brachypodium distachyon Sorghum bicolor Zea mays Arabidopsis thaliana Carcia papaya Populus trichocarpa Vitis vinifera Glycine max Monocots Eudicots Chalamydomanas reinhardtii Physcomitrella patens Algae, moss 4,479 potato genes clustered in 3,181 families 34,051 potato genes clustered with at least one genome 2,642 genes are asterid-specific 3,372 gens are potato lineage-specific
23 Genome evolution - synteny 1,811 syntenic blocks involving 10,046 genes
24 Genome evolution whole genome duplication ~89 MYA ~67 MYA γ event (~185MYA)
25 Genome evolution evidence for WGD
26 Comparing RH and DM 1,644 RH BAC clones 178Mb of non-redundant sequences (~10%) 99Mb of RH sequence (55%) to the DM genome The aligned regions with 97.5% identity SNP every 40 bp and one indel (12.8 bp in average) every 394 bp between RH and DM 6.6Mb of sequence could be aligned with 96.5% identity with in two haplotypes and SNP per 29 bp and 1 indel per 253 bp (average length 10.4 bp)
27 Comparing at the whole genome level 1,118 million NGS reads (84X) from RH million reads aligned to Mb (90.6%) of DM genome 3.67 million SNPs Premature stop, frame shift, presence/absence variants
28 Inbreeding depression 3,018 premature stop codons (606 homozygous and 2,412 heterozygous, 1,760 of which are specific) 80 frameshift mutations (49 homozygous and 31 heterozygous) 275 PAV genes (246 RH specific and 29 were DM specific)
29 Inbreeding depression One instance of copy number variation Five genes with premature stop codons Seven RH-specific genes
30 Tuber biology 15,235 genes expressed in the transition from stolons to tubers 15,235 1, ,217 transcripts with >5-fold expression in stolons versus five RH tuber tissues 333 transcripts upregulated during the transition from stolons to tubers. Particularly, proteinase inhibitors, i.e. KTI (Kunitz protease inhibitor)
31 KTI family 28 Kunitz protease inhibitor genes (KTIs)
32 KTI family
33 Starch synthesis
34 Flowering time regulation for tuber induction
35 Disease resistance Many NBS-LRR genes are pseudogenes owing to indels, frame shift mutations, or premature stop codons, including R1, R3a et al., which might be driven by the rapid evolution of effector genes in the potato late blight pathogen, Phytophthora infestans 39.4%
36 Acknowledgement
Stage 1: Karyotype Stage 2: Gene content & order Step 3
Supplementary Figure Method used for ancestral genome reconstruction. MRCA (Most Recent Common Ancestor), AMK (Ancestral Monocot Karyotype), AEK (Ancestral Eudicot Karyotype), AGK (Ancestral Grass Karyotype)
More informationPaleo-evolutionary plasticity of plant disease resistance genes
Zhang et al. BMC Genomics 2014, 15:187 RESEARCH ARTICLE Paleo-evolutionary plasticity of plant disease resistance genes Rongzhi Zhang 1,2, Florent Murat 1, Caroline Pont 1, Thierry Langin 1 and Jerome
More informationSupplemental Figure 1. Comparisons of GC3 distribution computed with raw EST data, bi-beta fits and complete genome sequences for 6 species.
Supplemental Figure 1. Comparisons of GC3 distribution computed with raw EST data, bi-beta fits and complete genome sequences for 6 species. Filled distributions: GC3 computed with raw EST data. Dashed
More informationBioinformatics tools to analyze complex genomes. Yves Van de Peer Ghent University/VIB
Bioinformatics tools to analyze complex genomes Yves Van de Peer Ghent University/VIB Detecting colinearity and large-scale gene duplications A 1 2 3 4 5 6 7 8 9 10 11 Speciation/Duplicatio n S1 S2 1
More informationSupplementary Material
Supplementary Material Supplementary Table S1. Genomes available in build 47 Supplementary Table S2. Counts of putative contiguous gene split models in 39 plant reference genomes in build 47 Supplementary
More informationSupplementary Information for: The genome of the extremophile crucifer Thellungiella parvula
Supplementary Information for: The genome of the extremophile crucifer Thellungiella parvula Maheshi Dassanayake 1,9, Dong-Ha Oh 1,9, Jeffrey S. Haas 1,2, Alvaro Hernandez 3, Hyewon Hong 1,4, Shahjahan
More informationEukaryotic vs. Prokaryotic genes
BIO 5099: Molecular Biology for Computer Scientists (et al) Lecture 18: Eukaryotic genes http://compbio.uchsc.edu/hunter/bio5099 Larry.Hunter@uchsc.edu Eukaryotic vs. Prokaryotic genes Like in prokaryotes,
More informationEvaluation of Genome Sequencing Quality in Selected Plant Species Using Expressed Sequence Tags
Evaluation of Genome Sequencing Quality in Selected Plant Species Using Expressed Sequence Tags Lingfei Shangguan 1, Jian Han 1, Emrul Kayesh 1, Xin Sun 1, Changqing Zhang 2, Tariq Pervaiz 1, Xicheng Wen
More informationSupplementary Figure 3
Supplementary Figure 3 7.0 Col Kas-1 Line FTH1A 8.4 F3PII3 8.9 F26H11 ATQ1 T9I22 PLS8 F26B6-B 9.6 F27L4 9.81 F27D4 9.92 9.96 10.12 10.14 10.2 11.1 0.5 Mb T1D16 Col % RGR 83.3 101 227 93.5 75.9 132 90 375
More information10-810: Advanced Algorithms and Models for Computational Biology. microrna and Whole Genome Comparison
10-810: Advanced Algorithms and Models for Computational Biology microrna and Whole Genome Comparison Central Dogma: 90s Transcription factors DNA transcription mrna translation Proteins Central Dogma:
More informationGenome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus
Genome-wide Identification of Lineage Specific Genes in Arabidopsis, Oryza and Populus Xiaohan Yang Sara Jawdy Timothy Tschaplinski Gerald Tuskan Environmental Sciences Division Oak Ridge National Laboratory
More informationMarialaura Destefanis 1,3, Istvan Nagy 1,4, Brian Rigney 1, Glenn J Bryan 2, Karen McLean 2, Ingo Hein 2, Denis Griffin 1 and Dan Milbourne 1*
Destefanis et al. BMC Plant Biology (2015) 15:255 DOI 10.1186/s12870-015-0645-8 RESEARCH ARTICLE Open Access A disease resistance locus on potato and tomato chromosome 4 exhibits a conserved multipartite
More information,(CL806925),(CL ),(CL829057),(CL ),(CL862603) BAC45136 putative nucleotide-binding
Additional Data File 13. List of 83 disease resistance-related genes that matched the unmapped BESs of On, Or, and Og. BESs that had internal stop codons within the aligned regions are presented in parentheses.
More informationImpact of recurrent gene duplication on adaptation of plant genomes
Fischer et al. BMC Plant Biology 2014, 14:151 RESEARCH ARTICLE Open Access Impact of recurrent gene duplication on adaptation of plant genomes Iris Fischer 1,2*, Jacques Dainat 3,6, Vincent Ranwez 3, Sylvain
More informationComparative genomics: Overview & Tools + MUMmer algorithm
Comparative genomics: Overview & Tools + MUMmer algorithm Urmila Kulkarni-Kale Bioinformatics Centre University of Pune, Pune 411 007. urmila@bioinfo.ernet.in Genome sequence: Fact file 1995: The first
More informationAnnotation of Plant Genomes using RNA-seq. Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA)
Annotation of Plant Genomes using RNA-seq Matteo Pellegrini (UCLA) In collaboration with Sabeeha Merchant (UCLA) inuscu1-35bp 5 _ 0 _ 5 _ What is Annotation inuscu2-75bp luscu1-75bp 0 _ 5 _ Reconstruction
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationGenome-wide discovery of G-quadruplex forming sequences and their functional
*Correspondence and requests for materials should be addressed to R.G. (rohini@nipgr.ac.in) Genome-wide discovery of G-quadruplex forming sequences and their functional relevance in plants Rohini Garg*,
More informationPhylogenetic Comparison of F-Box (FBX) Gene Superfamily within the Plant Kingdom Reveals Divergent Evolutionary Histories Indicative of Genomic Drift
Phylogenetic Comparison of F-Box (FBX) Gene Superfamily within the Plant Kingdom Reveals Divergent Evolutionary Histories Indicative of Genomic Drift Zhihua Hua 1, Cheng Zou 2, Shin-Han Shiu 2, Richard
More informationSupplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type
A B 2 3 3 2 1 1 Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type (A) and d27 (B) seedlings at the four
More informationUNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
More informationIntro Gene regulation Synteny The End. Today. Gene regulation Synteny Good bye!
Today Gene regulation Synteny Good bye! Gene regulation What governs gene transcription? Genes active under different circumstances. Gene regulation What governs gene transcription? Genes active under
More informationLineage specific conserved noncoding sequences in plants
Lineage specific conserved noncoding sequences in plants Nilmini Hettiarachchi Department of Genetics, SOKENDAI National Institute of Genetics, Mishima, Japan 20 th June 2014 Conserved Noncoding Sequences
More informationNew insights into the evolution and functional divergence of the SWEET family in Saccharum based on comparative genomics
Hu et al. BMC Plant Biology (2018) 18:270 https://doi.org/10.1186/s12870-018-1495-y RESEARCH ARTICLE Open Access New insights into the evolution and functional divergence of the SWEET family in Saccharum
More informationEvolution by duplication: paleopolyploidy events in plants reconstructed by deciphering the evolutionary history of VOZ transcription factors
Gao et al. BMC Plant Biology (2018) 18:256 https://doi.org/10.1186/s12870-018-1437-8 RESEARCH ARTICLE Evolution by duplication: paleopolyploidy events in plants reconstructed by deciphering the evolutionary
More information(Lys), resulting in translation of a polypeptide without the Lys amino acid. resulting in translation of a polypeptide without the Lys amino acid.
1. A change that makes a polypeptide defective has been discovered in its amino acid sequence. The normal and defective amino acid sequences are shown below. Researchers are attempting to reproduce the
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationHost_microbe_PPI - R package to analyse intra-species and interspecies protein-protein interactions in the model plant Arabidopsis thaliana
Host_microbe_PPI - R package to analyse intra-species and interspecies protein-protein interactions in the model plant Arabidopsis thaliana Thomas Nussbaumer 1,2 1 Institute of Network Biology (INET),
More informationGoing Beyond SNPs with Next Genera5on Sequencing Technology Personalized Medicine: Understanding Your Own Genome Fall 2014
Going Beyond SNPs with Next Genera5on Sequencing Technology 02-223 Personalized Medicine: Understanding Your Own Genome Fall 2014 Next Genera5on Sequencing Technology (NGS) NGS technology Discover more
More informationSupplementary Figure 1. Number of CC- and TIR- type NBS- LRR genes and presence of mir482/2118 on sequenced plant genomes.
Number of CC- NBS and CC- NBS- LRR R- genes Number of TIR- NBS and TIR- NBS- LRR R- genes 0 50 100 150 200 250 0 50 100 150 200 250 300 350 400 450 mir482 and mir2118 Cajanus cajan Glycine max Hevea brasiliensis
More informationGenomes Comparision via de Bruijn graphs
Genomes Comparision via de Bruijn graphs Student: Ilya Minkin Advisor: Son Pham St. Petersburg Academic University June 4, 2012 1 / 19 Synteny Blocks: Algorithmic challenge Suppose that we are given two
More informationRegulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication
SUPPORTING ONLINE MATERIALS Regulatory Change in YABBY-like Transcription Factor Led to Evolution of Extreme Fruit Size during Tomato Domestication Bin Cong, Luz Barrero, & Steven Tanksley 1 SUPPORTING
More informationSystematic comparison of lncrnas with protein coding mrnas in population expression and their response to environmental change
Xu et al. BMC Plant Biology (2017) 17:42 DOI 10.1186/s12870-017-0984-8 RESEARCH ARTICLE Open Access Systematic comparison of lncrnas with protein coding mrnas in population expression and their response
More informationSystematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii
Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii Hengling Wei 1,2, Wei Li 1, Xiwei Sun 1, Shuijin Zhu 1 *, Jun Zhu 1 * 1 Key
More informationChapters 12&13 Notes: DNA, RNA & Protein Synthesis
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,
More informationCao, J, K Schneeberger, S Ossowski, et al Whole genome sequencing of multiple Arabidopsis thaliana populations. Nat Genet 43:
Figure S1. Syntenic map of SAE1B duplication. We have used the nucleotide sequences of Arabidopsis thaliana Col-0 gene tandem duplicates AT5G50580 and AT5G506800 as queries in independent BLASTN searches
More informationGenome-wide analysis of the MYB transcription factor superfamily in soybean
Du et al. BMC Plant Biology 2012, 12:106 RESEARCH ARTICLE Open Access Genome-wide analysis of the MYB transcription factor superfamily in soybean Hai Du 1,2,3, Si-Si Yang 1,2, Zhe Liang 4, Bo-Run Feng
More informationUSDA-DOE Plant Feedstock Genomics for Bioenergy
USDA-DOE Plant Feedstock Genomics for Bioenergy BERAC Thursday, June 7, 2012 Cathy Ronning, DOE-BER Ed Kaleikau, USDA-NIFA Plant Feedstock Genomics for Bioenergy Joint competitive grants program initiated
More informationBrowsing Genomic Information with Ensembl Plants
Browsing Genomic Information with Ensembl Plants Etienne de Villiers, PhD (Adapted from slides by Bert Overduin EMBL-EBI) Outline of workshop Brief introduction to Ensembl Plants History Content Tutorial
More informationSmall RNA in rice genome
Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 Small RNA in rice genome WANG Kai ( 1, ZHU Xiaopeng ( 2, ZHONG Lan ( 1,3 & CHEN Runsheng ( 1,2 1. Beijing Genomics Institute/Center of Genomics and
More informationVariation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla
Variation, Evolution, and Correlation Analysis of C+G Content and Genome or Chromosome Size in Different Kingdoms and Phyla Xiu-Qing Li 1 *, Donglei Du 2 1 Molecular Genetics Laboratory, Potato Research
More informationSupplemental Table 1. Primers used for cloning and PCR amplification in this study
Supplemental Table 1. Primers used for cloning and PCR amplification in this study Target Gene Primer sequence NATA1 (At2g393) forward GGG GAC AAG TTT GTA CAA AAA AGC AGG CTT CAT GGC GCC TCC AAC CGC AGC
More informationIntroduction to de novo RNA-seq assembly
Introduction to de novo RNA-seq assembly Introduction Ideal day for a molecular biologist Ideal Sequencer Any type of biological material Genetic material with high quality and yield Cutting-Edge Technologies
More informationScience Unit Learning Summary
Learning Summary Inheritance, variation and evolution Content Sexual and asexual reproduction. Meiosis leads to non-identical cells being formed while mitosis leads to identical cells being formed. In
More informationGenome sequence of Plasmopara viticola and insight into the pathogenic mechanism
Genome sequence of Plasmopara viticola and insight into the pathogenic mechanism Ling Yin 1,3,, Yunhe An 1,2,, Junjie Qu 3,, Xinlong Li 1, Yali Zhang 1, Ian Dry 5, Huijun Wu 2*, Jiang Lu 1,4** 1 College
More informationOrigin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants
Liu et al. BMC Evolutionary Biology (2017) 17:47 DOI 10.1186/s12862-017-0891-5 RESEARCH ARTICLE Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants
More informationGenome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots
Genome-Wide Computational Prediction and Analysis of Core Promoter Elements across Plant Monocots and Dicots Sunita Kumari 1, Doreen Ware 1,2 * 1 Cold Spring Harbor Laboratory, Cold Spring Harbor, New
More informationGenome-wide analysis of nucleotide-binding site disease resistance genes in Medicago truncatula
Chin. Sci. Bull. (2014) 59(11):1129 1138 DOI 10.1007/s11434-014-0155-3 Article csb.scichina.com www.springer.com/scp Bioinformatics Genome-wide analysis of nucleotide-binding site disease resistance genes
More informationPrinciples of Genetics
Principles of Genetics Snustad, D ISBN-13: 9780470903599 Table of Contents C H A P T E R 1 The Science of Genetics 1 An Invitation 2 Three Great Milestones in Genetics 2 DNA as the Genetic Material 6 Genetics
More informationRNA- seq read mapping
RNA- seq read mapping Pär Engström SciLifeLab RNA- seq workshop October 216 IniDal steps in RNA- seq data processing 1. Quality checks on reads 2. Trim 3' adapters (opdonal (for species with a reference
More informationFei Lu. Post doctoral Associate Cornell University
Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.
More informationThe Saguaro Genome. Toward the Ecological Genomics of a Sonoran Desert Icon. Dr. Dario Copetti June 30, 2015 STEMAZing workshop TCSS
The Saguaro Genome Toward the Ecological Genomics of a Sonoran Desert Icon Dr. Dario Copetti June 30, 2015 STEMAZing workshop TCSS Why study a genome? - the genome contains the genetic information of an
More informationA diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males.
Multiple Choice Use the following information for questions 1-3. A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and
More informationPlant Genome Sequencing
Plant Genome Sequencing Traditional Sanger Sequencing Genome Sequencing Approach 1. Create sequencing libraries of different insert sizes 2kb o Bulk of sequencing is performed on these libraries 10kb o
More informationThe Eukaryotic Genome and Its Expression. The Eukaryotic Genome and Its Expression. A. The Eukaryotic Genome. Lecture Series 11
The Eukaryotic Genome and Its Expression Lecture Series 11 The Eukaryotic Genome and Its Expression A. The Eukaryotic Genome B. Repetitive Sequences (rem: teleomeres) C. The Structures of Protein-Coding
More informationPLAZA: A Comparative Genomics Resource to Study Gene and Genome Evolution in Plants W
The Plant Cell, Vol. 21: 3718 3731, December 2009, www.plantcell.org ã 2009 American Society of Plant Biologists Special Series on Large-Scale Biology PLAZA: A Comparative Genomics Resource to Study Gene
More informationGenômica comparativa. João Carlos Setubal IQ-USP outubro /5/2012 J. C. Setubal
Genômica comparativa João Carlos Setubal IQ-USP outubro 2012 11/5/2012 J. C. Setubal 1 Comparative genomics There are currently (out/2012) 2,230 completed sequenced microbial genomes publicly available
More informationName: Period: EOC Review Part F Outline
Name: Period: EOC Review Part F Outline Mitosis and Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences
More informationStructure, phylogeny, allelic haplotypes and expression of sucrose transporter gene families in Saccharum
Zhang et al. BMC Genomics (2016) 17:88 DOI 10.1186/s12864-016-2419-6 RESEARCH ARTICLE Open Access Structure, phylogeny, allelic haplotypes and expression of sucrose transporter gene families in Saccharum
More informationBiology. Biology. Slide 1 of 26. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 26 Fruit fly chromosome 12-5 Gene Regulation Mouse chromosomes Fruit fly embryo Mouse embryo Adult fruit fly Adult mouse 2 of 26 Gene Regulation: An Example Gene Regulation: An Example
More informationSouth Green Bioinformatics activities at CIRAD
South Green Bioinformatics activities at CIRAD Data Integration Team of the research unit DAP Manuel Ruiz, CIP, Lima, 23rd january The Joint Research Unit DAP (Développement et Amélioration des Plantes
More informationtraining workshop 2015
TransPLANT user training workshop 2015 Slides: http://tinyurl.com/transplant2015 Workshop on variation data EMBL-EBI Hinxton-UK 2nd July 2015 Ensembl Genomes Team Notes: This workshop is based on Ensembl
More information1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine.
Protein Synthesis & Mutations RNA 1. Contains the sugar ribose instead of deoxyribose. 2. Single-stranded instead of double stranded. 3. Contains uracil in place of thymine. RNA Contains: 1. Adenine 2.
More informationExploring structural variation and gene family architecture with De Novo assemblies of 15 Medicago genomes
Zhou et al. BMC Genomics (2017) 18:261 DOI 10.1186/s12864-017-3654-1 RESEARCH ARTICLE Open Access Exploring structural variation and gene family architecture with De Novo assemblies of 15 Medicago genomes
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature111 cytosol Model: PILS function in cellular auxin homeostasis ER nucleus IAA degradation? sequestration? conjugation? storage? signalling? PILS IAA ER cytosol Supplemental Figure 1 Model
More informationWhat can sequences tell us?
Bioinformatics What can sequences tell us? AGACCTGAGATAACCGATAC By themselves? Not a heck of a lot...* *Indeed, one of the key results learned from the Human Genome Project is that disease is much more
More informationOutline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/8/16
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature13082 Supplementary Table 1. Examination of nectar production in wild-type and atsweet9 flowers. No. of flowers with detectable nectar out of the total observed
More informationLecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
More informationGenetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
More informationbiology Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana
Biology 2013, 2, 1465-1487; doi:10.3390/biology2041465 Article OPEN ACCESS biology ISSN 2079-7737 www.mdpi.com/journal/biology Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs
More informationGiri Narasimhan. CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools. Evaluation. Course Homepage.
CAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools Giri Narasimhan ECS 389; Phone: x3748 giri@cis.fiu.edu www.cis.fiu.edu/~giri/teach/bioinfs06.html 1/12/06 CAP5510/CGS5166 1 Evaluation
More informationNon-host resistance to wheat stem rust in Brachypodium species
Non-host resistance to wheat stem rust in Brachypodium species Dr. Melania Figueroa Assistant Professor Department of Plant Pathology and Stakman-Borlaug Center for Sustainable Plant Health University
More informationFigure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and
Figure S1: Mitochondrial gene map for Pythium ultimum BR144. Arrows indicate transcriptional orientation, clockwise for the outer row and counterclockwise for the inner row, with green representing coding
More informationRelated Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
More informationAlgorithmics and Bioinformatics
Algorithmics and Bioinformatics Gregory Kucherov and Philippe Gambette LIGM/CNRS Université Paris-Est Marne-la-Vallée, France Schedule Course webpage: https://wikimpri.dptinfo.ens-cachan.fr/doku.php?id=cours:c-1-32
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationThe Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector.
The Developmental Transcriptome of the Mosquito Aedes aegypti, an invasive species and major arbovirus vector. Omar S. Akbari*, Igor Antoshechkin*, Henry Amrhein, Brian Williams, Race Diloreto, Jeremy
More informationThe Journal of Animal & Plant Sciences, 28(5): 2018, Page: Sadia et al., ISSN:
The Journal of Animal & Plant Sciences, 28(5): 2018, Page: 1532-1536 Sadia et al., ISSN: 1018-7081 Short Communication BIOINFORMATICS ANALYSIS OF CODON USAGE BIAS AND RNA SECONDARY STRUCTURES FOR SALT
More informationUntitled Document. A. antibiotics B. cell structure C. DNA structure D. sterile procedures
Name: Date: 1. The discovery of which of the following has most directly led to advances in the identification of suspects in criminal investigations and in the identification of genetic diseases? A. antibiotics
More informationLecture Notes: BIOL2007 Molecular Evolution
Lecture Notes: BIOL2007 Molecular Evolution Kanchon Dasmahapatra (k.dasmahapatra@ucl.ac.uk) Introduction By now we all are familiar and understand, or think we understand, how evolution works on traits
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More informationSupplementary Tables and Figures
Supplementary Tables Supplementary Tables and Figures Supplementary Table 1: Tumor types and samples analyzed. Supplementary Table 2: Genes analyzed here. Supplementary Table 3: Statistically significant
More informationIntroduction to Bioinformatics
CSCI8980: Applied Machine Learning in Computational Biology Introduction to Bioinformatics Rui Kuang Department of Computer Science and Engineering University of Minnesota kuang@cs.umn.edu History of Bioinformatics
More informationLecture 3: A basic statistical concept
Lecture 3: A basic statistical concept P value In statistical hypothesis testing, the p value is the probability of obtaining a result at least as extreme as the one that was actually observed, assuming
More informationChromosomal rearrangements in mammalian genomes : characterising the breakpoints. Claire Lemaitre
PhD defense Chromosomal rearrangements in mammalian genomes : characterising the breakpoints Claire Lemaitre Laboratoire de Biométrie et Biologie Évolutive Université Claude Bernard Lyon 1 6 novembre 2008
More informationWhole Genome Alignment. Adam Phillippy University of Maryland, Fall 2012
Whole Genome Alignment Adam Phillippy University of Maryland, Fall 2012 Motivation cancergenome.nih.gov Breast cancer karyotypes www.path.cam.ac.uk Goal of whole-genome alignment } For two genomes, A and
More informationComputational Structural Bioinformatics
Computational Structural Bioinformatics ECS129 Instructor: Patrice Koehl http://koehllab.genomecenter.ucdavis.edu/teaching/ecs129 koehl@cs.ucdavis.edu Learning curve Math / CS Biology/ Chemistry Pre-requisite
More informationAdaptation in the Human Genome. HapMap. The HapMap is a Resource for Population Genetic Studies. Single Nucleotide Polymorphism (SNP)
Adaptation in the Human Genome A genome-wide scan for signatures of adaptive evolution using SNP data Single Nucleotide Polymorphism (SNP) A nucleotide difference at a given location in the genome Joanna
More informationCGS 5991 (2 Credits) Bioinformatics Tools
CAP 5991 (3 Credits) Introduction to Bioinformatics CGS 5991 (2 Credits) Bioinformatics Tools Giri Narasimhan 8/26/03 CAP/CGS 5991: Lecture 1 1 Course Schedules CAP 5991 (3 credit) will meet every Tue
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More informationStudent Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes
9 The Nucleus Student Learning Outcomes: Nucleus distinguishes Eukaryotes from Prokaryotes Explain general structures of Nuclear Envelope, Nuclear Lamina, Nuclear Pore Complex Explain movement of proteins
More informationGENOME DUPLICATION AND GENE ANNOTATION: AN EXAMPLE FOR A REFERENCE PLANT SPECIES.
GENOME DUPLICATION AND GENE ANNOTATION: AN EXAMPLE FOR A REFERENCE PLANT SPECIES. Alessandra Vigilante, Mara Sangiovanni, Chiara Colantuono, Luigi Frusciante and Maria Luisa Chiusano Dept. of Soil, Plant,
More informationFull file at CHAPTER 2 Genetics
CHAPTER 2 Genetics MULTIPLE CHOICE 1. Chromosomes are a. small linear bodies. b. contained in cells. c. replicated during cell division. 2. A cross between true-breeding plants bearing yellow seeds produces
More informationSUPPLEMENTARY MATERIAL SUPPLEMENTARY TABLES
SUPPLEMENTARY MATERIAL SUPPLEMENTARY TABLES Supplementary Table 1. Genomes available in Gramene build 38 Supplementary Table 2. Ontology associations in Gramene build 38 Supplementary Table 3. Synteny
More informationComparative genomics. Lucy Skrabanek ICB, WMC 6 May 2008
Comparative genomics Lucy Skrabanek ICB, WMC 6 May 2008 What does it encompass? Genome conservation transfer knowledge gained from model organisms to non-model organisms Genome evolution understand how
More informationOutline. Genome Evolution. Genome. Genome Architecture. Constraints on Genome Evolution. New Evolutionary Synthesis 11/1/18
Genome Evolution Outline 1. What: Patterns of Genome Evolution Carol Eunmi Lee Evolution 410 University of Wisconsin 2. Why? Evolution of Genome Complexity and the interaction between Natural Selection
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature23897 Supplementary Notes 1 Evolution of gene families 1.1 Evolution of gene family sizes We determined the expansion and contraction of orthologous gene families using CAFÉ 2.2 1. One
More informationGenotyping By Sequencing (GBS) Method Overview
enotyping By Sequencing (BS) Method Overview Sharon E Mitchell Institute for enomic Diversity Cornell University http://wwwmaizegeneticsnet/ Topics Presented Background/oals BS lab protocol Illumina sequencing
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More information