CSCI1950 Z Computa3onal Methods for Biology Lecture 24. Ben Raphael April 29, hgp://cs.brown.edu/courses/csci1950 z/ Network Mo3fs
|
|
- Bonnie Williamson
- 6 years ago
- Views:
Transcription
1 CSCI1950 Z Computa3onal Methods for Biology Lecture 24 Ben Raphael April 29, 2009 hgp://cs.brown.edu/courses/csci1950 z/ Network Mo3fs Subnetworks with more occurrences than expected by chance. How to find? Exhaus3ve: Count all k node subgraphs. Heuris3c methods: sampling, greedy, etc. Approximate coun3ng via randomized algorithms. 1
2 Network Mo3fs Subnetworks with more occurrences than expected by chance. How to assess sta3s3cal significance? Compare number of occurrences to random network. Random Networks Occurrence of mo3fs depend strongly on network topology. What is an appropriate ensemble of random networks? (null model) 2
3 Random Networks One parameter governing occurrence of mo3fs is degree distribu3on. hgps://nwb.slis.indiana.edu/community/?n=customfillings.analysisofbiologicalnetworks Preserving Degree Distribu3on How to sample a graph with the same degree sequence? Method of Newman, Strogatz and Watts (2001) 1. Assign indegree i(v) and outdegree o(v) to vertex v according to degree sequence. 2. Randomly pair o(v) and i(w). 3
4 Network Mo3fs Transcrip3onal regulatory network of E. coli: 116 transcrip3on factors ~700 genes (operons) 577 interac3ons. Shen Orr et al E. coli Network Mo3fs Enumerated all 3 and 4 node mo3fs. Looked for iden3cal rows in adjacency matrix (SIM) Used clustering algorithm to iden3fy DOR. Shen Orr et al
5 Coun3ng Subnetworks G = (V,E). V = n. E = m. Network centric approach Count/enumerate all subgraphs with k ver3ces. Imprac3cal for large n, m, k Query based approach Enumerate query graphs Q. For each Q, count occurrences. (Subgraph isomorphism) Q could be a non induced subgraph. Coun3ng non induced subgraphs Suppose want to count paths in G = (V,E). Idea: use color coding to count colorful paths Dynamic programming solu3on (Whiteboard) Can extend dynamic program to count trees and bounded treewidth graphs. 5
6 Rela3on between Forward and Viterbi VITERBI Ini0aliza0on: V 0 (0) = 1 V k (0) = 0, for all k > 0 Itera0on: FORWARD Ini0aliza0on: f 0 (0) = 1 f k (0) = 0, for all k > 0 Itera0on: V j (i) = e j (x i ) max k V k (i 1) a kj f l (i) = e l (x i ) Σ k f k (i 1) a kl Termina0on: Termina0on: P(x, π*) = max k V k (N) P(x) = Σ k f k (N) a k0 Importance of Network Mo3fs Building block of networks. Indicate modular structure of biological networks. Appearance of some mo3fs might be explained by par3cular dynamics (e.g. feedforward and feedback loops) Healthy skep3cism about all these claims, par3cularly because data is incomplete. 6
7 Network Integra3on Given: G = (V,E) interac3on network. V = genes E = protein DNA or proteinprotein interac3ons Normalized expression z score z ij for gene i in condi3on/sample j. Goal: Find ac3ve subnetworks. Subgraphs whose genes are are differen3ally expressed in many condi3ons. Ideker, et al. (2002); Chuang et al. (2007) (Whiteboard) Network Integra3on Given: G = (V,E) interac3on network. V = genes E = protein DNA or proteinprotein interac3ons M = [ z ij ] z scores of gene i in condi3on/sample j. Ideker, et al. (2002); Chuang et al. (2007) Goal: Find A* = argmax r A A: connected subgraph 7
8 Finding High scoring subnetwork Simulated Annealing: Global op3miza3on method. Iden3fy set of ac3ve nodes. G w = working subgraph induced by ac3ve nodes. Based on idea of random, local search similar to MCMC. Temperature func3on controls when moves to subop3mal neighbors are permitng. Temperature decreased during search, so that eventually segle in local op3mum. Results 8
9 Future: Knockout Experiments & Reverse Engineering Input: Signal Output: Gene/protein expression. Given input output rela3onship for normal ( wild type ) and mutant ( knockout ) cells, what can one infer about the network? Topology: hard or impossible de novo: too many combina3ons. New interac3ons or signs of exis3ng interac3ons. Future: Engineering Networks Engineer biological networks to perform new tasks. Change metabolic networks to create cells that produce new products. 9
10 Sources Shen Orr, S.S., Milo, R., Mangan, S., et al Network mo3fs in the transcrip3onal regula3on network of Escherichia coli. Nature Gene;cs 31, Newman, M.E.J., Strogatz, S.H., and WaGs, D.J Random graphs with arbitrary degree distribu3ons and their applica3ons. Phys. Rev. E 64, Ideker T, Ozier O, Schwikowski B, Siegel AF. Discovering regulatory and signalling circuits in molecular interac3on networks. Bioinforma;cs. 2002;18 Suppl 1:S Chuang HY, Lee E, Liu YT, Lee D, Ideker T Network based classifica3on of breast cancer metastasis. Mol Syst Biol. 2007;3:
Networks. Can (John) Bruce Keck Founda7on Biotechnology Lab Bioinforma7cs Resource
Networks Can (John) Bruce Keck Founda7on Biotechnology Lab Bioinforma7cs Resource Networks in biology Protein-Protein Interaction Network of Yeast Transcriptional regulatory network of E.coli Experimental
More informationCSCI1950 Z Computa3onal Methods for Biology* (*Working Title) Lecture 1. Ben Raphael January 21, Course Par3culars
CSCI1950 Z Computa3onal Methods for Biology* (*Working Title) Lecture 1 Ben Raphael January 21, 2009 Course Par3culars Three major topics 1. Phylogeny: ~50% lectures 2. Func3onal Genomics: ~25% lectures
More informationNetwork motifs in the transcriptional regulation network (of Escherichia coli):
Network motifs in the transcriptional regulation network (of Escherichia coli): Janne.Ravantti@Helsinki.Fi (disclaimer: IANASB) Contents: Transcription Networks (aka. The Very Boring Biology Part ) Network
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 5
CSCI1950 Z Computa4onal Methods for Biology Lecture 5 Ben Raphael February 6, 2009 hip://cs.brown.edu/courses/csci1950 z/ Alignment vs. Distance Matrix Mouse: ACAGTGACGCCACACACGT Gorilla: CCTGCGACGTAACAAACGC
More informationGene Regulatory Networks II Computa.onal Genomics Seyoung Kim
Gene Regulatory Networks II 02-710 Computa.onal Genomics Seyoung Kim Goal: Discover Structure and Func;on of Complex systems in the Cell Identify the different regulators and their target genes that are
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 4. Ben Raphael February 2, hhp://cs.brown.edu/courses/csci1950 z/ Algorithm Summary
CSCI1950 Z Computa4onal Methods for Biology Lecture 4 Ben Raphael February 2, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Algorithm Summary Parsimony Probabilis4c Method Input Output Sankoff s & Fitch
More informationPriors in Dependency network learning
Priors in Dependency network learning Sushmita Roy sroy@biostat.wisc.edu Computa:onal Network Biology Biosta2s2cs & Medical Informa2cs 826 Computer Sciences 838 hbps://compnetbiocourse.discovery.wisc.edu
More informationSelf Similar (Scale Free, Power Law) Networks (I)
Self Similar (Scale Free, Power Law) Networks (I) E6083: lecture 4 Prof. Predrag R. Jelenković Dept. of Electrical Engineering Columbia University, NY 10027, USA {predrag}@ee.columbia.edu February 7, 2007
More informationRandom Boolean Networks
Random Boolean Networks Boolean network definition The first Boolean networks were proposed by Stuart A. Kauffman in 1969, as random models of genetic regulatory networks (Kauffman 1969, 1993). A Random
More informationLecture 8: Temporal programs and the global structure of transcription networks. Chap 5 of Alon. 5.1 Introduction
Lecture 8: Temporal programs and the global structure of transcription networks Chap 5 of Alon 5. Introduction We will see in this chapter that sensory transcription networks are largely made of just four
More informationBiological Networks Analysis
Biological Networks Analysis Degree Distribution and Network Motifs Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Networks: Networks vs. graphs A collection of nodesand
More informationBiological Networks. Gavin Conant 163B ASRC
Biological Networks Gavin Conant 163B ASRC conantg@missouri.edu 882-2931 Types of Network Regulatory Protein-interaction Metabolic Signaling Co-expressing General principle Relationship between genes Gene/protein/enzyme
More informationCSCI 360 Introduc/on to Ar/ficial Intelligence Week 2: Problem Solving and Op/miza/on
CSCI 360 Introduc/on to Ar/ficial Intelligence Week 2: Problem Solving and Op/miza/on Professor Wei-Min Shen Week 13.1 and 13.2 1 Status Check Extra credits? Announcement Evalua/on process will start soon
More informationGene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji
Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC
More informationGLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data
GLOBEX Bioinformatics (Summer 2015) Genetic networks and gene expression data 1 Gene Networks Definition: A gene network is a set of molecular components, such as genes and proteins, and interactions between
More informationComparative Network Analysis
Comparative Network Analysis BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2016 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by
More informationTranscrip:on factor binding mo:fs
Transcrip:on factor binding mo:fs BMMB- 597D Lecture 29 Shaun Mahony Transcrip.on factor binding sites Short: Typically between 6 20bp long Degenerate: TFs have favorite binding sequences but don t require
More informationGraph structure learning for network inference
Graph structure learning for network inference Sushmita Roy sroy@biostat.wisc.edu Computa9onal Network Biology Biosta2s2cs & Medical Informa2cs 826 Computer Sciences 838 hbps://compnetbiocourse.discovery.wisc.edu
More informationGraph Alignment and Biological Networks
Graph Alignment and Biological Networks Johannes Berg http://www.uni-koeln.de/ berg Institute for Theoretical Physics University of Cologne Germany p.1/12 Networks in molecular biology New large-scale
More informationComplex (Biological) Networks
Complex (Biological) Networks Today: Measuring Network Topology Thursday: Analyzing Metabolic Networks Elhanan Borenstein Some slides are based on slides from courses given by Roded Sharan and Tomer Shlomi
More informationComplex (Biological) Networks
Complex (Biological) Networks Today: Measuring Network Topology Thursday: Analyzing Metabolic Networks Elhanan Borenstein Some slides are based on slides from courses given by Roded Sharan and Tomer Shlomi
More informationNetwork models: random graphs
Network models: random graphs Leonid E. Zhukov School of Data Analysis and Artificial Intelligence Department of Computer Science National Research University Higher School of Economics Structural Analysis
More informationLatent Dirichlet Alloca/on
Latent Dirichlet Alloca/on Blei, Ng and Jordan ( 2002 ) Presented by Deepak Santhanam What is Latent Dirichlet Alloca/on? Genera/ve Model for collec/ons of discrete data Data generated by parameters which
More information56:198:582 Biological Networks Lecture 10
56:198:582 Biological Networks Lecture 10 Temporal Programs and the Global Structure The single-input module (SIM) network motif The network motifs we have studied so far all had a defined number of nodes.
More informationGraphical Models. Lecture 10: Variable Elimina:on, con:nued. Andrew McCallum
Graphical Models Lecture 10: Variable Elimina:on, con:nued Andrew McCallum mccallum@cs.umass.edu Thanks to Noah Smith and Carlos Guestrin for some slide materials. 1 Last Time Probabilis:c inference is
More informationBIOINF 4371 Drug Design 1 Oliver Kohlbacher & Jens Krüger
BIOINF 4371 Drug Design 1 Oliver Kohlbacher & Jens Krüger Winter 2013/2014 11. Docking Part IV: Receptor Flexibility Overview Receptor flexibility Types of flexibility Implica5ons for docking Examples
More informationLecture 6: The feed-forward loop (FFL) network motif
Lecture 6: The feed-forward loop (FFL) network motif Chapter 4 of Alon x 4. Introduction x z y z y Feed-forward loop (FFL) a= 3-node feedback loop (3Loop) a=3 Fig 4.a The feed-forward loop (FFL) and the
More informationBayesian networks Lecture 18. David Sontag New York University
Bayesian networks Lecture 18 David Sontag New York University Outline for today Modeling sequen&al data (e.g., =me series, speech processing) using hidden Markov models (HMMs) Bayesian networks Independence
More informationBoolean Gossip Networks
Boolean Gossip Networks Guodong Shi Research School of Engineering The Australian Na
More informationCSCI 1010 Models of Computa3on. Lecture 11 Proving Languages NP-Complete
CSCI 1010 Models of Computa3on Lecture 11 Proving Languages NP-Complete Overview P-3me reduc3ons Composi3on of P-3me reduc3ons Reduc3on from CIRCUIT SAT to SAT SAT is NP-complete. 3-SAT is NP-complete.
More informationCISC 636 Computational Biology & Bioinformatics (Fall 2016)
CISC 636 Computational Biology & Bioinformatics (Fall 2016) Predicting Protein-Protein Interactions CISC636, F16, Lec22, Liao 1 Background Proteins do not function as isolated entities. Protein-Protein
More informationStatistical analysis of biological networks.
Statistical analysis of biological networks. Assessing the exceptionality of network motifs S. Schbath Jouy-en-Josas/Evry/Paris, France http://genome.jouy.inra.fr/ssb/ Colloquium interactions math/info,
More informationECS 253 / MAE 253, Lecture 15 May 17, I. Probability generating function recap
ECS 253 / MAE 253, Lecture 15 May 17, 2016 I. Probability generating function recap Part I. Ensemble approaches A. Master equations (Random graph evolution, cluster aggregation) B. Network configuration
More informationNetworks in systems biology
Networks in systems biology Matthew Macauley Department of Mathematical Sciences Clemson University http://www.math.clemson.edu/~macaule/ Math 4500, Spring 2017 M. Macauley (Clemson) Networks in systems
More informationModularity and Graph Algorithms
Modularity and Graph Algorithms David Bader Georgia Institute of Technology Joe McCloskey National Security Agency 12 July 2010 1 Outline Modularity Optimization and the Clauset, Newman, and Moore Algorithm
More informationnetworks in molecular biology Wolfgang Huber
networks in molecular biology Wolfgang Huber networks in molecular biology Regulatory networks: components = gene products interactions = regulation of transcription, translation, phosphorylation... Metabolic
More informationThe Trouble with Community Detection
The Trouble with Community Detection Aaron Clauset Santa Fe Institute 7 April 2010 Nonlinear Dynamics of Networks Workshop U. Maryland, College Park Thanks to National Science Foundation REU Program James
More informationToday s Lecture: HMMs
Today s Lecture: HMMs Definitions Examples Probability calculations WDAG Dynamic programming algorithms: Forward Viterbi Parameter estimation Viterbi training 1 Hidden Markov Models Probability models
More informationSta$s$cal sequence recogni$on
Sta$s$cal sequence recogni$on Determinis$c sequence recogni$on Last $me, temporal integra$on of local distances via DP Integrates local matches over $me Normalizes $me varia$ons For cts speech, segments
More informationCSCI 360 Introduc/on to Ar/ficial Intelligence Week 2: Problem Solving and Op/miza/on. Instructor: Wei-Min Shen
CSCI 360 Introduc/on to Ar/ficial Intelligence Week 2: Problem Solving and Op/miza/on Instructor: Wei-Min Shen Today s Lecture Search Techniques (review & con/nue) Op/miza/on Techniques Home Work 1: descrip/on
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationNetwork Alignment 858L
Network Alignment 858L Terms & Questions A homologous h Interolog = B h Species 1 Species 2 Are there conserved pathways? What is the minimum set of pathways required for life? Can we compare networks
More informationDecision Trees Lecture 12
Decision Trees Lecture 12 David Sontag New York University Slides adapted from Luke Zettlemoyer, Carlos Guestrin, and Andrew Moore Machine Learning in the ER Physician documentation Triage Information
More informationCellular automata, entropy and box- coun4ng dimension
Cellular automata, entropy and box- coun4ng dimension Cellular Automata Cellular automata (CA) models epitomize the idea that simple rules can generate complex pa=erns. A CA consists of an array of cells
More informationBasic modeling approaches for biological systems. Mahesh Bule
Basic modeling approaches for biological systems Mahesh Bule The hierarchy of life from atoms to living organisms Modeling biological processes often requires accounting for action and feedback involving
More informationChapter 8: The Topology of Biological Networks. Overview
Chapter 8: The Topology of Biological Networks 8.1 Introduction & survey of network topology Prof. Yechiam Yemini (YY) Computer Science Department Columbia University A gallery of networks Small-world
More informationMachine Learning & Data Mining CS/CNS/EE 155. Lecture 11: Hidden Markov Models
Machine Learning & Data Mining CS/CNS/EE 155 Lecture 11: Hidden Markov Models 1 Kaggle Compe==on Part 1 2 Kaggle Compe==on Part 2 3 Announcements Updated Kaggle Report Due Date: 9pm on Monday Feb 13 th
More information56:198:582 Biological Networks Lecture 8
56:198:582 Biological Networks Lecture 8 Course organization Two complementary approaches to modeling and understanding biological networks Constraint-based modeling (Palsson) System-wide Metabolism Steady-state
More informationPrinciples of Gene Expression
Principles of Gene Expression I. Introduc5on Genome : the en*re set of genes (transcrip*on units) of an organism Transcriptome : the en*re set of marns found in a cell at a given *me Proteome : the en*re
More informationPseudospectral Methods For Op2mal Control. Jus2n Ruths March 27, 2009
Pseudospectral Methods For Op2mal Control Jus2n Ruths March 27, 2009 Introduc2on Pseudospectral methods arose to find solu2ons to Par2al Differen2al Equa2ons Recently adapted for Op2mal Control Key Ideas
More informationDesign and characterization of chemical space networks
Design and characterization of chemical space networks Martin Vogt B-IT Life Science Informatics Rheinische Friedrich-Wilhelms-University Bonn 16 August 2015 Network representations of chemical spaces
More informationProkaryo'c Operon Model Ac'vity
Prokaryo'c Operon Model Ac'vity Differen'al Expression of Genes Prokaryotes and eukaryotes precisely regulate gene expression in response to environmental condi6ons In mul6cellular eukaryotes, gene expression
More informationFounda'ons of Large- Scale Mul'media Informa'on Management and Retrieval. Lecture #4 Similarity. Edward Chang
Founda'ons of Large- Scale Mul'media Informa'on Management and Retrieval Lecture #4 Similarity Edward Y. Chang Edward Chang Foundations of LSMM 1 Edward Chang Foundations of LSMM 2 Similar? Edward Chang
More informationCISC 889 Bioinformatics (Spring 2004) Hidden Markov Models (II)
CISC 889 Bioinformatics (Spring 24) Hidden Markov Models (II) a. Likelihood: forward algorithm b. Decoding: Viterbi algorithm c. Model building: Baum-Welch algorithm Viterbi training Hidden Markov models
More informationProbability and Structure in Natural Language Processing
Probability and Structure in Natural Language Processing Noah Smith Heidelberg University, November 2014 Introduc@on Mo@va@on Sta@s@cal methods in NLP arrived ~20 years ago and now dominate. Mercer was
More informationAn Introduction to Exponential-Family Random Graph Models
An Introduction to Exponential-Family Random Graph Models Luo Lu Feb.8, 2011 1 / 11 Types of complications in social network Single relationship data A single relationship observed on a set of nodes at
More informationletter Network motifs in the transcriptional regulation network of Escherichia coli ... Z n X 1 X 2 X 3... X n Z 1 Z 2 Z 3 Z 4...
Network motifs in the transcriptional regulation network of Escherichia coli Shai S. Shen-Orr 1, Ron Milo 2, Shmoolik Mangan 1 & Uri Alon 1,2 Published online: 22 April 2002, DOI: 10.1038/ng881 a b c d
More informationProbabilistic models of biological sequence motifs
Probabilistic models of biological sequence motifs Discovery of new motifs Master in Bioinformatics UPF 2015-2016 Eduardo Eyras Computational Genomics Pompeu Fabra University - ICREA Barcelona, Spain what
More informationParameter Es*ma*on: Cracking Incomplete Data
Parameter Es*ma*on: Cracking Incomplete Data Khaled S. Refaat Collaborators: Arthur Choi and Adnan Darwiche Agenda Learning Graphical Models Complete vs. Incomplete Data Exploi*ng Data for Decomposi*on
More informationPhylogene)cs. IMBB 2016 BecA- ILRI Hub, Nairobi May 9 20, Joyce Nzioki
Phylogene)cs IMBB 2016 BecA- ILRI Hub, Nairobi May 9 20, 2016 Joyce Nzioki Phylogenetics The study of evolutionary relatedness of organisms. Derived from two Greek words:» Phle/Phylon: Tribe/Race» Genetikos:
More information56:198:582 Biological Networks Lecture 9
56:198:582 Biological Networks Lecture 9 The Feed-Forward Loop Network Motif Subgraphs in random networks We have discussed the simplest network motif, self-regulation, a pattern with one node We now consider
More informationChapter 4 Dynamic Bayesian Networks Fall Jin Gu, Michael Zhang
Chapter 4 Dynamic Bayesian Networks 2016 Fall Jin Gu, Michael Zhang Reviews: BN Representation Basic steps for BN representations Define variables Define the preliminary relations between variables Check
More informationBasics on bioinforma-cs Lecture 7. Nunzio D Agostino
Basics on bioinforma-cs Lecture 7 Nunzio D Agostino nunzio.dagostino@entecra.it; nunzio.dagostino@gmail.com Multiple alignments One sequence plays coy a pair of homologous sequence whisper many aligned
More informationOpinion Dynamics on Triad Scale Free Network
Opinion Dynamics on Triad Scale Free Network Li Qianqian 1 Liu Yijun 1,* Tian Ruya 1,2 Ma Ning 1,2 1 Institute of Policy and Management, Chinese Academy of Sciences, Beijing 100190, China lqqcindy@gmail.com,
More informationNetwork diffusion-based analysis of high-throughput data for the detection of differentially enriched modules
Network diffusion-based analysis of high-throughput data for the detection of differentially enriched modules Matteo Bersanelli 1+, Ettore Mosca 2+, Daniel Remondini 1, Gastone Castellani 1 and Luciano
More informationMini course on Complex Networks
Mini course on Complex Networks Massimo Ostilli 1 1 UFSC, Florianopolis, Brazil September 2017 Dep. de Fisica Organization of The Mini Course Day 1: Basic Topology of Equilibrium Networks Day 2: Percolation
More informationGraph Detection and Estimation Theory
Introduction Detection Estimation Graph Detection and Estimation Theory (and algorithms, and applications) Patrick J. Wolfe Statistics and Information Sciences Laboratory (SISL) School of Engineering and
More informationIntroduc)on to Ar)ficial Intelligence
Introduc)on to Ar)ficial Intelligence Lecture 13 Approximate Inference CS/CNS/EE 154 Andreas Krause Bayesian networks! Compact representa)on of distribu)ons over large number of variables! (OQen) allows
More informationNetwork alignment and querying
Network biology minicourse (part 4) Algorithmic challenges in genomics Network alignment and querying Roded Sharan School of Computer Science, Tel Aviv University Multiple Species PPI Data Rapid growth
More informationECS 253 / MAE 253 April 26, Intro to Biological Networks, Motifs, and Model selection/validation
ECS 253 / MAE 253 April 26, 2016 Intro to Biological Networks, Motifs, and Model selection/validation Announcement HW2, due May 3 (one week) HW2b, due May 5 HW2a, due May 5. Will be posted on Smartsite.
More informationBoolean models of gene regulatory networks. Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016
Boolean models of gene regulatory networks Matthew Macauley Math 4500: Mathematical Modeling Clemson University Spring 2016 Gene expression Gene expression is a process that takes gene info and creates
More informationBioinformatics I. CPBS 7711 October 29, 2015 Protein interaction networks. Debra Goldberg
Bioinformatics I CPBS 7711 October 29, 2015 Protein interaction networks Debra Goldberg debra@colorado.edu Overview Networks, protein interaction networks (PINs) Network models What can we learn from PINs
More informationAlgorithms, Lecture 3 on NP : Nondeterminis7c Polynomial Time
Algorithms, Lecture 3 on NP : Nondeterminis7c Polynomial Time Last week: Defined Polynomial Time Reduc7ons: Problem X is poly 7me reducible to Y X P Y if can solve X using poly computa7on and a poly number
More informationOverview. Overview. Social networks. What is a network? 10/29/14. Bioinformatics I. Networks are everywhere! Introduction to Networks
Bioinformatics I Overview CPBS 7711 October 29, 2014 Protein interaction networks Debra Goldberg debra@colorado.edu Networks, protein interaction networks (PINs) Network models What can we learn from PINs
More informationHOMEWORK #2 - MATH 3260
HOMEWORK # - MATH 36 ASSIGNED: JANUARAY 3, 3 DUE: FEBRUARY 1, AT :3PM 1) a) Give by listing the sequence of vertices 4 Hamiltonian cycles in K 9 no two of which have an edge in common. Solution: Here is
More informationProtein Complex Identification by Supervised Graph Clustering
Protein Complex Identification by Supervised Graph Clustering Yanjun Qi 1, Fernanda Balem 2, Christos Faloutsos 1, Judith Klein- Seetharaman 1,2, Ziv Bar-Joseph 1 1 School of Computer Science, Carnegie
More informationStructures and Hyperstructures in Metabolic Networks
Structures and Hyperstructures in Metabolic Networks Alberto Marchetti-Spaccamela (Sapienza U. Rome) joint work with V. Acuña, L.Cottret, P. Crescenzi, V. Lacroix, A. Marino, P. Milreu, A. Ribichini, MF.
More informationNetworks & pathways. Hedi Peterson MTAT Bioinformatics
Networks & pathways Hedi Peterson (peterson@quretec.com) MTAT.03.239 Bioinformatics 03.11.2010 Networks are graphs Nodes Edges Edges Directed, undirected, weighted Nodes Genes Proteins Metabolites Enzymes
More informationLecture 3: Markov chains.
1 BIOINFORMATIK II PROBABILITY & STATISTICS Summer semester 2008 The University of Zürich and ETH Zürich Lecture 3: Markov chains. Prof. Andrew Barbour Dr. Nicolas Pétrélis Adapted from a course by Dr.
More informationSemi-Markov/Graph Cuts
Semi-Markov/Graph Cuts Alireza Shafaei University of British Columbia August, 2015 1 / 30 A Quick Review For a general chain-structured UGM we have: n n p(x 1, x 2,..., x n ) φ i (x i ) φ i,i 1 (x i, x
More informationSYSTEMS BIOLOGY 1: NETWORKS
SYSTEMS BIOLOGY 1: NETWORKS SYSTEMS BIOLOGY Starting around 2000 a number of biologists started adopting the term systems biology for an approach to biology that emphasized the systems-character of biology:
More informationDiclique clustering in a directed network
Diclique clustering in a directed network Mindaugas Bloznelis and Lasse Leskelä Vilnius University and Aalto University October 17, 016 Abstract We discuss a notion of clustering for directed graphs, which
More informationEvolutionary Tree Analysis. Overview
CSI/BINF 5330 Evolutionary Tree Analysis Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Distance-Based Evolutionary Tree Reconstruction Character-Based
More informationSystems biology and biological networks
Systems Biology Workshop Systems biology and biological networks Center for Biological Sequence Analysis Networks in electronics Radio kindly provided by Lazebnik, Cancer Cell, 2002 Systems Biology Workshop,
More informationRela%ons and Their Proper%es. Slides by A. Bloomfield
Rela%ons and Their Proper%es Slides by A. Bloomfield What is a rela%on Let A and B be sets. A binary rela%on R is a subset of A B Example Let A be the students in a the CS major A = {Alice, Bob, Claire,
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS M1: ALGORITHM TO RECONSTRUCT TRANSCRIPTIONAL NETWORKS M-2 Figure 1: Procedure to reconstruct transcriptional regulatory networks M-2 M2: PROCEDURE TO IDENTIFY ORTHOLOGOUS PROTEINSM-3
More informationBayesian Networks. Why Joint Distributions are Important. CompSci 570 Ron Parr Department of Computer Science Duke University
Bayesian Networks CompSci 570 Ron Parr Department of Computer Science Duke University Why Joint Distributions are Important Joint distribu6ons gives P(X 1 X n ) Classifica6on/Diagnosis Suppose X 1 =disease
More informationProfiling Human Cell/Tissue Specific Gene Regulation Networks
Profiling Human Cell/Tissue Specific Gene Regulation Networks Louxin Zhang Department of Mathematics National University of Singapore matzlx@nus.edu.sg Network Biology < y 1 t, y 2 t,, y k t > u 1 u 2
More informationECS 289 F / MAE 298, Lecture 15 May 20, Diffusion, Cascades and Influence
ECS 289 F / MAE 298, Lecture 15 May 20, 2014 Diffusion, Cascades and Influence Diffusion and cascades in networks (Nodes in one of two states) Viruses (human and computer) contact processes epidemic thresholds
More informationCOMPARATIVE PATHWAY ANNOTATION WITH PROTEIN-DNA INTERACTION AND OPERON INFORMATION VIA GRAPH TREE DECOMPOSITION
COMPARATIVE PATHWAY ANNOTATION WITH PROTEIN-DNA INTERACTION AND OPERON INFORMATION VIA GRAPH TREE DECOMPOSITION JIZHEN ZHAO, DONGSHENG CHE AND LIMING CAI Department of Computer Science, University of Georgia,
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More informationPreface. Contributors
CONTENTS Foreword Preface Contributors PART I INTRODUCTION 1 1 Networks in Biology 3 Björn H. Junker 1.1 Introduction 3 1.2 Biology 101 4 1.2.1 Biochemistry and Molecular Biology 4 1.2.2 Cell Biology 6
More informationMachine Learning & Data Mining CS/CNS/EE 155. Lecture 8: Hidden Markov Models
Machine Learning & Data Mining CS/CNS/EE 155 Lecture 8: Hidden Markov Models 1 x = Fish Sleep y = (N, V) Sequence Predic=on (POS Tagging) x = The Dog Ate My Homework y = (D, N, V, D, N) x = The Fox Jumped
More informationBellman s Curse of Dimensionality
Bellman s Curse of Dimensionality n- dimensional state space Number of states grows exponen
More informationMinimum Edit Distance. Defini'on of Minimum Edit Distance
Minimum Edit Distance Defini'on of Minimum Edit Distance How similar are two strings? Spell correc'on The user typed graffe Which is closest? graf gra@ grail giraffe Computa'onal Biology Align two sequences
More informationComputer Vision. Pa0ern Recogni4on Concepts Part I. Luis F. Teixeira MAP- i 2012/13
Computer Vision Pa0ern Recogni4on Concepts Part I Luis F. Teixeira MAP- i 2012/13 What is it? Pa0ern Recogni4on Many defini4ons in the literature The assignment of a physical object or event to one of
More informationEvolu&on of Cellular Interac&on Networks. Pedro Beltrao Krogan and Lim UCSF
Evolu&on of Cellular Interac&on Networks Pedro Beltrao Krogan and Lim Labs @ UCSF Point muta&ons Recombina&on Duplica&ons Mutants Mutants Point muta&ons Recombina&on Duplica&ons Changes in protein- protein,
More informationCS281A/Stat241A Lecture 19
CS281A/Stat241A Lecture 19 p. 1/4 CS281A/Stat241A Lecture 19 Junction Tree Algorithm Peter Bartlett CS281A/Stat241A Lecture 19 p. 2/4 Announcements My office hours: Tuesday Nov 3 (today), 1-2pm, in 723
More informationBIOINF 4120 Bioinforma2cs 2 - Structures and Systems -
BIIF 4120 Bioinforma2cs 2 - Structures and Systems - liver Kohlbacher SS 2011 2. RA Structure Part I verview RA Types of RA and their biological func@on Two- dimensional structure Three- dimensional structure
More informationPredicting causal effects in large-scale systems from observational data
nature methods Predicting causal effects in large-scale systems from observational data Marloes H Maathuis 1, Diego Colombo 1, Markus Kalisch 1 & Peter Bühlmann 1,2 Supplementary figures and text: Supplementary
More information