Supporting Online Material
|
|
- Neil Evans
- 5 years ago
- Views:
Transcription
1 1 Stomatal Patterning and Differentiation by Synergistic Interactions of Receptor Kinases Elena D. Shpak, Jessica Messmer McAbee, Lynn Jo Pillitteri, and Keiko U. Torii Supporting Online Material Material and Methods Supplementary References and Notes Figs. S1 to S5 Tables. S1 Material and Methods Plant materials and double~quadruple mutant construction Arabidopsis Columbia (Col) plants were used as wild type. Complete loss-of-function alleles of ER (At2g26330), ERL1 (At5g62230), and ERL2 (At5g07180), namely er-105, erl1-2, and erl2-1, respectively, were used for analyses. tmm-1 was acquired from the ABRC (Ohio State Univ). To generate tmm er, tmm er erl1, tmm er erl2, tmm erl1 erl2, and tmm er erl1 erl2 quadruple mutant, tmm-1 plants were crossed with plants of the genotype er/er erl1/+ erl2/erl2. Plants of the correct genotype were isolated from the F3 or F4 populations. The presence of er, erl1 and erl2 mutations were determined by PCR as described previously (1, 2). The presence of the tmm-1 mutation was determined by
2 2 sequencing the PCR-amplified TMM coding region with primer TMM-743 (5 - CACTCACAAGCTGTGGATCGTT-3 ). Reporter constructs and histology The ER::GUS, ERL1::GUS and ERL2::GUS constructs were described previously (1). The 0.5 kb 5 upstream sequence of TMM (3) was amplified by primers TMMp5 (5 - CGAATTCCTTTCGTAGTTACTTCATTATTCA-3 ) and TMMp3 (5 - CGAATTCGGTTTAGGTTCGAAATTGTCAGTGT-3 ) and cloned into EcoRI-digested pesh224 (1) to generate TMM::GUS (pkut574). GUS staining, light microscopy and scanning electron microscopy were performed as described previously (1). For DIC microscopy, tissues were treated in 9:1 ethanol:acetic acid solution, rehydrated through an ethanol series, cleared in 8:1:1 chloral hydrate:water:glycerol, and viewed under Nikon Optishot equipped with a Sony DXC-960MD CCD video camera. The DIC microscopic images in Figure 4 are taken under Olympus BX51 equipped with an Olympus DP million-pixel digital camera. The line drawings of the DIC images were false colored using Adobe Photoshop 7. Quantitative analysis The methods of Geisler et al. (1998)(4) were used as a guide for data collection. For the quantitative analysis, one three-week-old cotyledon, one fully expanded leaf, one mature stem segment, and one fully expanded silique were collected from each of five plants for each genotype grown in the same conditions. This material was cleared, and then stored and viewed in chloral hydrate solution. Epidermal peels were taken from fresh pedicels
3 3 and viewed at 40X. For each organ, five random DIC images were taken at 20X. The numbers of stomata, stomatal lineage ground cells, and pavement cells were counted in each image. Stomatal indices were calculated as the number of stomata divided by number of stomatal cells plus non-stomatal epidermal cells, then multiplied by 100. Supplementary References and Notes 1. E. D. Shpak, C. T. Berthiaume, E. J. Hill, K. U. Torii, Development 131, 1491 (2004). 2. K. U. Torii, L. A. Hanson, C. A. B. Josefsson, E. D. Shpak, in Morphogenesis and patterning in biological systems T. Sekimura, Ed. (Springer-Verlag, Tokyo, 2003) pp J. A. Nadeau, F. D. Sack, Science 296, 1697 (2002). 4. M. Geisler, M. Yang, F. D. Sack, Planta 205, 522 (1998).
4
5
6
7
8
9 Table S1 Stomatal index (SI) for five organs in eight genotypes. SI = (# stomata/ # stomatal cells + # non-stomatal epidermal cells) x100. (±SE, n=5 for each organ) Cotyledon, Leaf, abaxial Stem Pedicel Silique abaxial WT (Col) 20.7±0.6 # 21.0± ± ± ±0.3 er 17.9±0.3 b 21.6± ±0.6 12±0.5 c 16.0±0.2 erl1 22.3± ±0.4 a 15.3±0.5 b 14.5±0.5 c 17.7±0.3 b erl2 20.0± ±0.9 c 14.7±0.6 c 13.0± ±0.5 erl1 erl2 24.2± ±0.7 b 16.3±0.8 b 16.3±0.6 b 19.7±0.3 a er erl1 25.3±1.0 b 26.0±0.4 a 15.1±0.9 c 19.1±0.9 a 18.3±0.3 a er erl2 20.5± ± ± ± ±0.4 er erl 1erl2 37.0±0.4 a 33.7±1.0 a 34.0±2.0 a 39.7±0.6 a 36.3±0.9 a a Significantly different from the WT (p<0.001) b Significantly different from the WT (p<0.01) c Significantly different from the WT (p<0.05) # The Student s T-test was performed for statistic significance. Numbers in black are not significantly different from wild type. Numbers in blue are significantly higher than wild type. Numbers in red are significantly lower than wild type.
Evaluation of receptor protein TOO MANY MOUTHS (TMM) as a Glycosylphosphatidylinositol-Anchored Protein
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2017 Evaluation of receptor protein
More informationDevelopment 143: doi: /dev : Supplementary information
Supplementary Materials and Methods Plant materials The mutants and transgenic plants used in the present study were as follows: E361 (from Alex Webb s laboratory); tmm-1, ptmm::tmm-gfp and flp-1 (from
More informationSUPPLEMENTARY INFORMATION
Supplemental Methods Isolation and mapping of SPCH An EMS-mutagenized population of tmm-1 (Col);E1728 (an enhancer trap GFP marking guard cells) was created. M2 seeds were collected from M1 s planted in
More informationEpidermal cell density is auto-regulated via a secretory peptide, EPIDERMAL PATTERNING FACTOR 2 in Arabidopsis leaves.
Plant and Cell Physiology Advance Access published May 12, 2009 Epidermal cell density is auto-regulated via a secretory peptide, EPIDERMAL PATTERNING FACTOR 2 in Arabidopsis leaves. Category: Rapid Paper
More informationThe secretory peptide gene EPF1 enforces the stomatal one-cell-spacing rule
RESEARCH COMMUNICATION The secretory peptide gene EPF1 enforces the stomatal one-cell-spacing rule Kenta Hara, 1,4 Ryoko Kajita, 1,4 Keiko U. Torii, 2 Dominique C. Bergmann, 3 and Tatsuo Kakimoto 1 1 Department
More informationRegional specification of stomatal production by the putative ligand CHALLAH
RESEARCH ARTICLE 447 Development 137, 447-455 (2010) doi:10.1242/dev.040931 2010. Published by The Company of Biologists Ltd Regional specification of stomatal production by the putative ligand CHALLAH
More informationMaking Holes in Leaves: Promoting Cell State Transitions in Stomatal Development
The Plant Cell, Vol. 19: 1140 1143, April 2007, www.plantcell.org ª 2007 American Society of Plant Biologists Making Holes in Leaves: Promoting Cell State Transitions in Stomatal Development The leaves
More informationEPFL signals in the boundary region of the SAM restrict its size and promote leaf initiation.
Plant Physiology Preview. Published on November 8, 2018, as DOI:10.1104/pp.18.00714 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 EPFL signals in the boundary region
More informationPlant and Cell Physiology Advance Access published May 1, 2008
Plant and Cell Physiology Advance Access published May 1, 2008 Running title MUTE controls stomata cell-lineage transition Author of Correspondence Keiko U. Torii, Ph. D. (ktorii@u.washington.edu) Department
More informationEthylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis
Ethylene is critical to the maintenance of primary root growth and Fe homeostasis under Fe stress in Arabidopsis Guangjie Li, Weifeng Xu, Herbert J. Kronzucker, Weiming Shi * Supplementary Data Supplementary
More informationTable S1 List of primers used for genotyping and qrt-pcr.
Table S1 List of primers used for genotyping and qrt-pcr. genotyping! allele! ligomer*! 5'-sequence-3'! rice! d10-2! F! TTGGCTTTGCCTCGTTTC!!! R! AGCCTCCACTTGTACTGTG! Arabidopsis! max2-3, max2-4! F! ACTCTCTCCGACCTCCCTGACG!!!
More informationNature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.
Supplementary Figure 1 The phenotypes of PI 159925, BR121, and Harosoy under short-day conditions. (a) Plant height. (b) Number of branches. (c) Average internode length. (d) Number of nodes. (e) Pods
More informationCryptochromes, Phytochromes, and COP1 Regulate Light-Controlled Stomatal Development in Arabidopsis W
The Plant Cell, Vol. 21: 2624 2641, September 2009, www.plantcell.org ã 2009 American Society of Plant Biologists Cryptochromes, Phytochromes, and COP1 Regulate Light-Controlled Stomatal Development in
More informationGFP GAL bp 3964 bp
Supplemental Data. Møller et al. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-specific alteration of Na + transport in Arabidopsis Supplemental Figure 1. Salt-sensitive
More informationStomatal Development and Patterning Are Regulated by Environmentally Responsive Mitogen-Activated Protein Kinases in Arabidopsis W
The Plant Cell, Vol. 19: 63 73, January 2007, www.plantcell.org ª 2007 American Society of Plant Biologists Stomatal Development and Patterning Are Regulated by Environmentally Responsive Mitogen-Activated
More informationA new loss-of-function allele 28y reveals a role of ARGONAUTE1 in limiting. asymmetric division of stomatal lineage ground cell
Research Article A new loss-of-function allele 28y reveals a role of ARGONAUTE1 in limiting asymmetric division of stomatal lineage ground cell Running title: AGO1 and stomatal spacing division Kezhen
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/452/ra106/dc1 Supplementary Materials for Stem-piped light activates phytochrome B to trigger light responses in Arabidopsis thaliana roots Hyo-Jun Lee, Jun-Ho
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12791 Supplementary Figure 1 (1/3) WWW.NATURE.COM/NATURE 1 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 1 (2/3) 2 WWW.NATURE.COM/NATURE SUPPLEMENTARY
More informationSupplemental Data. Perrella et al. (2013). Plant Cell /tpc
Intensity Intensity Intensity Intensity Intensity Intensity 150 50 150 0 10 20 50 C 150 0 10 20 50 D 0 10 20 Distance (μm) 50 20 40 E 50 F 0 10 20 50 0 15 30 Distance (μm) Supplemental Figure 1: Co-localization
More informationResearch article. Summary. Introduction. Elena D. Shpak 1, Chris T. Berthiaume 1, Emi J. Hill 1 and Keiko U. Torii 1,2, *
Research article 1491 Synergistic interaction of three ERECTA-family receptor-like kinases controls Arabidopsis organ growth and flower development by promoting cell proliferation Elena D. Shpak 1, Chris
More informationFigure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated
Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated form by recombinant UGT74E2. The naturally occurring auxin
More informationDysregulation of cell-to-cell connectivity and stomatal patterning by loss-of-function mutation in Arabidopsis CHORUS (GLUCAN SYNTHASE-LIKE 8)
RESEARCH ARTICLE 1731 Development 137, 1731-1741 (2010) doi:10.1242/dev.049197 2010. Published by The Company of Biologists Ltd Dysregulation of cell-to-cell connectivity and stomatal patterning by loss-of-function
More informationPlants and animals both have a layer of tissue called the epidermal layer. This is the layer of cells on the outside of the organism.
Name Date Period Lab Number Counting Stomata Lab Introduction Plants and animals both have a layer of tissue called the epidermal layer. This is the layer of cells on the outside of the organism. Plants
More information** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.
Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Ca 2+ ug g -1 DW Supplemental Data. Fu et al. Plant Cell. (213). 1.115/tpc.113.113886 A 5 4 3 * Col- cau1 B 4 3 2 Col- cau1 ** * * ** C 2 1 25 2 15 1 5 Shoots Roots *
More informationTransitivity-dependent and transitivity-independent cell-to-cell movement of RNA
Himber et al. Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA silencing SUPPLEMENTAL MATERIAL Supplemental material 1. Short-range movement of GFP silencing affects a nearly
More informationGENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL
GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL Kelsey Hoth 1 Dr. Maria Ivanchenko 2 Bioresourse Research 1, Department of Botany and Plant Physiology 2, Oregon State University, Corvallis,
More informationBASL Controls Asymmetric Cell Division in Arabidopsis
BASL Controls Asymmetric Cell Division in Arabidopsis Juan Dong, 1 Cora A. MacAlister, 1 and Dominique C. Bergmann 1, * 1 Department of Biology, Stanford University, Stanford, CA 94305-5020, USA *Correspondence:
More informationHistidine Kinase Homologs That Act as Cytokinin Receptors Possess Overlapping Functions in the Regulation of Shoot and Root Growth in Arabidopsis
The Plant Cell, Vol. 16, 1365 1377, June 2004, www.plantcell.org ª 2004 American Society of Plant Biologists RESEARCH ARTICLES Histidine Kinase Homologs That Act as Cytokinin Receptors Possess Overlapping
More informationSupplemental Data. Chen and Thelen (2010). Plant Cell /tpc
Supplemental Data. Chen and Thelen (2010). Plant Cell 10.1105/tpc.109.071837 1 C Total 5 kg 20 kg 100 kg Transmission Image 100 kg soluble pdtpi-gfp Plastid (PDH-alpha) Mito (PDH-alpha) GFP Image vector
More informationSupplemental Data. Hou et al. (2016). Plant Cell /tpc
Supplemental Data. Hou et al. (216). Plant Cell 1.115/tpc.16.295 A Distance to 1 st nt of start codon Distance to 1 st nt of stop codon B Normalized PARE abundance 8 14 nt 17 nt Frame1 Arabidopsis inflorescence
More informationThe Arabidopsis D-Type Cyclin CYCD4 Controls Cell Division in the Stomatal Lineage of the Hypocotyl Epidermis W
The Plant Cell, Vol. 19: 1265 1277, April 2007, www.plantcell.org ª 2007 American Society of Plant Biologists The Arabidopsis D-Type Cyclin CYCD4 Controls Cell Division in the Stomatal Lineage of the Hypocotyl
More informationCHAPTER Introduction
27 CHAPTER 2 2.1 Introduction Pharmacognosy as a subject of pharmaceutical curriculum focused on those natural products employed in the allopathic system of medicine. Coincident with the increasing attractiveness
More informationEXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA
EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA Item Type text; Electronic Thesis Authors Bergstrand, Lauren Janel Publisher The University of Arizona. Rights Copyright is held by the author. Digital
More informationSUPPLEMENTARY INFORMATION
reverse 3175 3175 F L C 318 318 3185 3185 319 319 3195 3195 315 8 1 315 3155 315 317 Supplementary Figure 3. Stability of expression of the GFP sensor constructs return to warm conditions. Semi-quantitative
More informationLab 3: Transpiration. 1 Purpose. BIO124 Plant Science Lab 3 Transpiration 1
1 Purpose The goals of this lab are to (1) observe water movement against gravity from stems to leaves of plants and (2) investigate environmental factors that regulate the rate of transpiration. Introduction
More informationSupplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.
Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field. A, Phenotypes of 30-day old wild-type (WT) and abci8 mutant plants grown in a paddy field under normal sunny
More informationCell cycle regulates cell type in the Arabidopsis sepal
4416 Development 139, 4416-4427 (2012) doi:10.1242/dev.082925 2012. Published by The Company of Biologists Ltd Cell cycle regulates cell type in the Arabidopsis sepal Adrienne H. K. Roeder 1,2, *,, Alexandre
More informationERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE1 expression
Research ERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE expression Hanyang Cai, Lihua Zhao, Lulu Wang, Man Zhang, Zhenxia Su, Yan Cheng, Heming
More informationSupplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed
Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed using the Geneious software. Accession numbers of the
More informationSupplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc
Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation
More informationNRPB3, the Third Largest Subunit of RNA Polymerase II, Is Essential for Stomatal Patterning and Differentiation in Arabidopsis
First posted online on 17 March 2016 as 10.1242/dev.129098 Access the most recent version at http://dev.biologists.org/lookup/doi/10.1242/dev.129098 NRPB3, the Third Largest Subunit of RNA Polymerase II,
More informationCambridge International Examinations Cambridge International Advanced Subsidiary and Advanced Level
Cambridge International Examinations Cambridge International Advanced Subsidiary and Advanced Level *5818991458* BIOLOGY 9700/51 Paper 5 Planning, Analysis and Evaluation October/November 2016 1 hour 15
More informationTansley Influence of environmental factors on stomatal development
Review Blackwell Oxford, NPH New 0028-646X December 0??? Original Tansley Phytologist review UK Articles Publishing 2007 Ltd The Authors (2008). Journal compilation New Phytologist (2008) Tansley Influence
More informationTapetal cell fate, lineage and proliferation in the Arabidopsis anther
RESEARCH ARTICLE 2409 Development 137, 2409-2416 (2010) doi:10.1242/dev.049320 2010. Published by The Company of Biologists Ltd Tapetal cell fate, lineage and proliferation in the Arabidopsis anther Xiaoqi
More informationHow drought stress and CO2 concentration influence stomatal conductance and photosynthesis? Abstract. Introduction
How drought stress and CO2 concentration influence stomatal conductance and photosynthesis? Simon Keck 1, Julian Müller 1, Dominik Guttschick 1, Kaisa Pajusalu 2, Elodie Quer 3, Maria Majekova 4 1 University
More informationSupplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2
Supplemental Figure 1: Increased Fe deficiency gene expression in roots of nas4x-2 IRT1, FRO2 and FIT expression levels in roots of the wild-type, nas4x- 1 and nas4x-2, showing that in both nas mutants
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1121356/dc1 Supporting Online Material for Polar PIN Localization Directs Auxin Flow in Plants Justyna Wiśniewska, Jian Xu, Daniela Seifertová, Philip B. Brewer, Kamil
More informationMicrotubule arrays and Arabidopsis stomatal development
Journal of Experimental Botany, Vol. 57, No. 1, pp. 71 79, 2006 doi:10.1093/jxb/erj017 Advance Access publication 22 November, 2005 FOCUS PAPER Microtubule arrays and Arabidopsis stomatal development Jessica
More informationScience, Stanford, CA 94305, USA; 3 Department of Biology, Stanford University, Stanford, CA 94305, USA; 4 HHMI, Stanford
Research Disruption of stomatal lineage signaling or transcriptional regulators has differential effects on mesophyll development, but maintains coordination of gas exchange Author for correspondence:
More informationStomatal Development in Arabidopsis
Stomatal Development in Arabidopsis Author(s): Lynn Jo Pillitteri, and Juan Dong Source: The Arabidopsis Book, Published By: The American Society of Plant Biologists https://doi.org/10.1199/tab.0162 URL:
More informationSupplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure1: Mock and NPA-treated tomato plants. (A) NPA treated tomato (cv. Moneymaker) developed a pin-like inflorescence (arrowhead). (B) Comparison of first and second leaves from mock and
More informationTRANSPIRATION. An important regulator of transpiration is the stomatal complex composed of the opening or
BIOL 1134 1 TRANSPIRATION LEARNING OBJECTIVES After completing this exercise, students should be able to: Describe the process of and principles behind transpiration. Describe how stomata, guard cells,
More informationBiological Roles of Cytokinins
Direct Control of Shoot Meristem Activity by a Cytokinin-Activating Enzyme By Kurakawa et. Al. Published in Nature Presented by Boyana Grigorova Biological Roles of Cytokinins Cytokinins are positive regulators
More informationOrgan specific effects of brassinosteroids on stomatal production coordinate with the action of TOO MANY MOUTHS
JIPB Journal of Integrative Plant Biology Organ specific effects of brassinosteroids on stomatal production coordinate with the action of TOO MANY MOUTHS Ming Wang 1,2, Kezhen Yang 1 and Jie Le 1 * 1 Key
More informationLETTER. Carbonic anhydrases, EPF2 and a novel protease mediate CO 2 control of stomatal development
doi:10.1038/nature13452 Carbonic anhydrases, EPF2 and a novel protease mediate CO 2 control of stomatal development Cawas B. Engineer 1, Majid Ghassemian 2, Jeffrey C. Anderson 3, Scott C. Peck 3, Honghong
More information. Supplementary Information
. Supplementary Information Supplementary Figure S1. Mature embryo sac observations. Supplementary Figure S2. STT observations. Supplementary Figure S3. Comparison of the PTB1 cdna with that of the mutant.
More informationDevelopmental Biology
Developmental Biology 324 (2008) 68 75 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology Heterotrimeric G protein α and β subunits
More informationIllegitimate translation causes unexpected gene expression from on-target out-of-frame alleles
Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9 Shigeru Makino, Ryutaro Fukumura, Yoichi Gondo* Mutagenesis and Genomics Team, RIKEN
More informationSupplementary Figure 1. Phenotype of the HI strain.
Supplementary Figure 1. Phenotype of the HI strain. (A) Phenotype of the HI and wild type plant after flowering (~1month). Wild type plant is tall with well elongated inflorescence. All four HI plants
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationSupplemental material
Supplemental material Table 1- Segregation analysis of sgt1a sgt1b double mutant plants Parental genotype No. of lines Normal seeds Phenotype Abnormal seeds Ratio of abnormal seeds (%) WT 3 171 2 1.16
More informationSupplementary information
Supplementary information Statistical organelle dissection of Arabidopsis guard cells using image database LIPS Takumi Higaki *, Natsumaro Kutsuna, Yoichiroh Hosokawa, Kae Akita, Kazuo Ebine, Takashi Ueda,
More information13.2 The Vascular Plant Body (textbook p )
13.2 The Vascular Plant Body (textbook p544 550) Learning Goal: Label and explain the anatomy of the Vascular Plant and it's Tissue Types Plants are classified into two main groups: and. Vascular plants
More informationGFP WxTP-GFP WxTP-GFP. stromules. DsRed WxTP-DsRed WxTP-DsRed. stromules
Supplemental Data. Kitajima et al. (2009). The rice -amylase glycoprotein is targeted from the Golgi apparatus through the secretory pathway to the plastids. A GFP WxTP-GFP WxTP-GFP stromules stromules
More informationNature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.
Supplementary Figure 1 ssp mutant phenotypes in a functional SP background. (a,b) Statistical comparisons of primary and sympodial shoot flowering times as determined by mean values for leaf number on
More informationWOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation
2224 Development 140, 2224-2234 (2013) doi:10.1242/dev.091314 2013. Published by The Company of Biologists Ltd WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation
More informationSupplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT
Supplemental Figures Clades RSH1 TP - HYD TGS ACT Rsh1[HS] RSH2 TP HYD SYN TGS Rsh2[HS] RSH3 TP HYD SYN TGS CRSH TP - SYN EFh Rsh4[HS] Supplemental Figure 1. Arabidopsis RSH domain structure. Schematic
More informationThe too many mouths and four lips Mutations Affect Stomatal Pnoduction in Arabidopsis
The Plant Gell, Vol. 7, 2227-2239, December 1995 O 1995 American Society of Plant Physiologists The too many mouths and four lips Mutations Affect Stomatal Pnoduction in Arabidopsis Ming Yang and Fred
More informationFiltering Microfluidic Bubble Trains at a Symmetric Junction. Electronic Supplementary Information
Filtering Microfluidic Bubble Trains at a Symmetric Junction. Electronic Supplementary Information Pravien Parthiban Department of Chemical and Biomolecular Engineering, National University of Singapore,
More informationRECEPTOR-like kinases (RLKs) are a major component of
INVESTIGATION An Allelic Series of bak1 Mutations Differentially Alter bir1 Cell Death, Immune Response, Growth, and Root Development Phenotypes in Arabidopsis thaliana Michael P. Wierzba* and Frans E.
More informationHOW DO CELLS KNOW WHAT THEY WANT TO
Annu. Rev. Plant Biol. 2003. 54:403 30 doi: 10.1146/annurev.arplant.54.031902.134823 Copyright c 2003 by Annual Reviews. All rights reserved HOW DO CELLS KNOW WHAT THEY WANT TO BE WHEN THEY GROW UP? Lessons
More informationROLES OF THE AF AND TL GENES IN PEA LEAF
American Journal of Botany 84(10): 1323 1336. 1997. ROLES OF THE AF AND TL GENES IN PEA LEAF MORPHOGENESIS: CHARACTERIZATION OF THE DOUBLE MUTANT (AFAFTLTL) 1 PHILIP J. VILLANI 2 AND DARLEEN A. DEMASON
More informationGenetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity
Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity Shih-Heng Su, Maria Cristina Suarez-Rodriguez, Patrick Krysan
More informationPhotoreceptor Regulation of Constans Protein in Photoperiodic Flowering
Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering by Valverde et. Al Published in Science 2004 Presented by Boyana Grigorova CBMG 688R Feb. 12, 2007 Circadian Rhythms: The Clock Within
More informationSMALL AUXIN UP RNA (SAUR) genes are the largest class of primary auxin (growth
Abstract SMALL AUXIN UP RNA (SAUR) genes are the largest class of primary auxin (growth hormone) responsive genes in all land plants, many of which are expressed in actively growing plant tissues. This
More informationStomatal development: a plant s perspective on cell polarity, cell fate transitions and intercellular communication
PRIMER SERIES PRIMER 3683 Development 139, 3683-3692 (2012) doi:10.1242/dev.080523 2012. Published by The Company of Biologists Ltd Stomatal development: a plant s perspective on cell polarity, cell fate
More informationDigitized single scattering nanoparticles for probing molecular binding
Electronic Supplementary Information (ESI) Digitized single scattering nanoparticles for probing molecular binding Yue Liu a, Cheng Zhi Huang a,b* a Education Ministry Key Laboratory on Luminescence and
More informationMICROSCOPE AND USE ANSWERS PRODUCTS MANUAL ARCHIVE
03 May, 2018 MICROSCOPE AND USE ANSWERS PRODUCTS MANUAL ARCHIVE Document Filetype: PDF 405.93 KB 0 MICROSCOPE AND USE ANSWERS PRODUCTS MANUAL ARCHIVE What are the coolest photos from electron microscopes?
More informationBring Your Text to Lab!!!
Bring Your Text to Lab!!! Vascular Plant Anatomy: Flowering Plants Objectives: 1. To observe what the basic structure of vascular plants is, and how and where this form originates. 2. To begin to understand
More informationVariability in the Control of Cell Division Underlies Sepal Epidermal Patterning in Arabidopsis thaliana
Variability in the Control of Cell Division Underlies Sepal Epidermal Patterning in Arabidopsis thaliana Adrienne H. K. Roeder 1,2., Vijay Chickarmane 1., Alexandre Cunha 2,3, Boguslaw Obara 4,B.S. Manjunath
More informationHeterosis and inbreeding depression of epigenetic Arabidopsis hybrids
Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids Plant growth conditions The soil was a 1:1 v/v mixture of loamy soil and organic compost. Initial soil water content was determined
More informationDiverse Roles of ERECTA Family Genes in Plant Development
Journal of Integrative Plant Biology 2013, 55 (12): 1238 1250 Diverse Roles of ERECTA Family Genes in Plant Development Invited Expert Review Elena D. Shpak* Department of Biochemistry, Cellular and Molecular
More informationPractical course 1. Microscopy
Cellular and Molecular Biology Practicum 1 Practical course 1. Microscopy Name and surname Exercise 1. Prepare a part of plant tissue, for example a part of the leaf of Elodea canadensis by putting it
More informationCROSS SECTION OF A LEAF INTRODUCTION
CROSS SECTION OF A LEAF INTRODUCTION The leaf is an organ in a plant consisting of many different tissues. The primary function of a leaf is to make (synthesize) food through a chemical reaction called.
More informationBulk Transport. Active Transport. cell drinking. Highly specific! cell eating
Bulk Transport cell eating cell drinking Active Transport Highly specific! Bulk transport is the active intracellular membrane transport of large numbers of solute particles or a large volume of solution
More informationThe Hidden Geometries of the Arabidopsis thaliana Epidermis
The Hidden Geometries of the Arabidopsis thaliana Epidermis Lee Staff 1, Patricia Hurd 1, Lara Reale 2, Cathal Seoighe 3, Alyn Rockwood 1, Chris Gehring 4 * 1 Geometric Modeling and Scientific Visualization
More informationQUANTIFICATION OF EMBOLI BY VISUALIZATION OF AIR FILLED XYLEM VESSELS
QUANTIFICATION OF EMBOLI BY VISUALIZATION OF AIR FILLED XYLEM VESSELS J. Nijsse and U. van Meeteren Wageningen University Plant Sciences Horticultural Production Chains Marijkeweg 22 6709 PG Wageningen
More informationVisualization of green and red leaf structures in flowering pear Pyrus calleryana using integrated microscopy
Journal of Plant Sciences 2013; 1(3): 28-32 Published online October 20, 2013 (http://www.sciencepublishinggroup.com/j/jps) doi: 10.11648/j.jps.20130103.12 Visualization of green and red leaf structures
More informationStomata and water fluxes through plants
Stomata and water fluxes through plants Bill Davies The Lancaster Environment Centre, UK Summary Stomata and responses to the environment Conductance, a function of frequency and aperture Measuring/estimating
More informationRegulation of Phosphate Homeostasis by microrna in Plants
Regulation of Phosphate Homeostasis by microrna in Plants Tzyy-Jen Chiou 1 *, Kyaw Aung 1,2, Shu-I Lin 1,3, Chia-Chune Wu 1, Su-Fen Chiang 1, and Chun-Lin Su 1 Abstract Upon phosphate (Pi) starvation,
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. HSP21 expression in 35S:HSP21 and hsp21 knockdown plants. (a) Since no T- DNA insertion line for HSP21 is available in the publicly available T-DNA collections,
More informationSupplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice Supplementary Figure 2.
Supplementary Figure 1. Markedly decreased numbers of marginal zone B cells in DOCK8 mutant mice. Percentage of marginal zone B cells in the spleen of wild-type mice (+/+), mice homozygous for cpm or pri
More informationPenghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao
New Phytologist Supporting Information Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bhlh transcription factor MtTT8 Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang
More informationAutomatic Counting of Stomata in Epidermis Microscopic Images
Automatic Counting of Stomata in Epidermis Microscopic Images Marcos William da Silva Oliveira, Núbia Rosa da Silva, Dalcimar Casanova, Luiz Felipe Souza Pinheiro, Rosana Marta Kolb and Odemir Martinez
More informationBiology Sample work program. March 2013
Biology 2004 Sample work program March 2013 Biology 2004 Sample work program Compiled by the Queensland Studies Authority March 2013 A work program is the school s plan of how the course will be delivered
More informationAnswer Marks Guidance 1 (a) 1 mutation ;
Question Answer Marks Guidance 1 (a) 1 mutation ; 1 CREDI in context of gene or chromosome mutation ACCEPT a suitable description e.g. change in DNA base sequence / non-disjunction meiosis ; DO NOT CREDIT
More informationThe mode of development in animals and plants is different
The mode of development in animals and plants is different Outcome of animal embryogenesis is a mini edition of the adult Outcome of plant embryogenesis is a simple structure with -root apical meristem
More informationSupp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate
Supplemental Data. Simpson et al. (009). n rabidopsis GPI-anchor plasmodesmal neck protein with callosebinding activity and potential to regulate cell-to-cell trafficking. 5 0 stack Supp- Figure Confocal
More informationPOTASSIUM IN PLANT GROWTH AND YIELD. by Ismail Cakmak Sabanci University Istanbul, Turkey
POTASSIUM IN PLANT GROWTH AND YIELD by Ismail Cakmak Sabanci University Istanbul, Turkey Low K High K High K Low K Low K High K Low K High K Control K Deficiency Cakmak et al., 1994, J. Experimental Bot.
More information** LCA LCN PCA
% of wild type value % of wild type value a 12 1 8 2 b 12 1 8 2 LCA LCN PCA Col- sod3-1 Supplementary Figure 1 sod3-1 influences cell proliferation. (a) Fifth leaf cell area (LCA) and leaf cell number
More information