EPIDEMIOLOGY AND MANAGEMENT OF CORYNESPORA LEAF FALL DISEASE OF RUBBER CAUSED BY Corynespora cassiicola (Berk & Curt.) Wei.

Transcription

1 EPIDEMIOLOGY AND MANAGEMENT OF CORYNESPORA LEAF FALL DISEASE OF RUBBER CAUSED BY Corynespora cassiicola (Berk & Curt.) Wei. Thesis submitted to the University of Agricultural Sciences, Dharwad in partial fulfillment of the requirements for the Degree of DOCTOR OF PHILOSOPHY IN PLANT PATHOLOGY By MANJU M. J. DEPARTMENT OF PLANT PATHOLOGY COLLEGE OF AGRICULTURE, DHARWAD UNIVERSITY OF AGRICULTURAL SCIENCES, DHARWAD JANUARY, 2011

2 ADVISORY COMMITTEE DHARWAD JANUARY, 2011 (V.I. BENAGI) MAJOR ADVISOR Approved by : Chairman: (V.I. BENAGI) Co-Chairman : (C. KURUVILLA JACOB) Members : 1. (V.B. NARGUND) 2. (P.V. PATIL) 3. (A.R.S. BHAT) 4. (J.C. MATHAD)

3 CONTENTS Sl. No. Chapter Particulars CERTIFICATE ACKNOWLEDGEMENT LIST OF TABLES LIST OF FIGURES LIST OF PLATES LIST OF APPENDICES 1. INTRODUCTION 2. REVIEW OF LITERATURE 2.1 Symptomatology 2.2 Distribution, Survey and surveillance 2.3 Morphological and Physiological studies 2.4 Genetic variability of pathogen 2.5 Epidemiological studies 2.6 Survival of the Pathogen 2.7 Host range of the pathogen 2.8 Screening of Hevea clones for resistance to Corynespora leaf fall disease 2.9 Disease management 3. MATERIAL AND METHODS 3.1 General laboratory procedures 3.2 Survey and surveillance for Corynespora leaf fall disease severity 3.3 Collection of diseased specimens, isolation and maintenance of culture 3.4 Cultural and physiological studies of Corynespora cassiicola 3.6 Genetic variability of C. cassiicola 3.7 Epidemiological studies 3. 8 Survival of Corynespora cassiicola 3.9 Screening of Hevea clones for Corynespora cassiicola resistance 3.10 Disease management Contd..

4 Sl. No. Chapter Particulars 4. EXPERIMENTAL RESULTS 4.1 Symptomatology 4.2 Survey for the incidence and severity of CLF disease 4.3 Cultural and physiological studies 4.4 Genetic variability of C. cassiicola 4. 5 Epidemiological studies 4. 6 Survival of Corynespora cassiicola 4.7 Screening of H. brasiliensis clones for C. cassiicola resistance 4. 8 Disease management 5. DISCUSSION 5.1 Symptomatology 5.2 Survey for the incidence and severity of disease 5.3 Cultural and physiological studies 5.4 Genetic variability of Corynespora cassiicola 5.5 Epidemiological studies 5.6 Survival of C. cassiicola 5.7 Screening of H. brasiliensis clones for C. cassiicola resistance 5.8 Disease management 5.9 Future line of work 6. SUMMARY AND CONCLUSIONS REFERENCES

5 LIST OF TABLES Table No. Title 1. Incidence of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years 2. Severity of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years 3. Distribution of CLF disease severity among the fields surveyed in Karnataka and Kerala during Effect of incubation period on growth of Corynespora cassiicola on potato dextrose broth 5. Effect of different solid media on radial growth and sporulation of C. cassiicola 6. Effect of different liquid media on dry mycelial weight and sporulation of C. cassiicola 7. Effect of temperature on growth and sporulation of C. cassiicola 8. Effect of relative humidity on growth and sporulation of C. cassiicola 9. Effect of ph on dry weight of mycelia and sporulation of C. cassiicola 10. Effect of light intensity on growth and sporulation of C. cassiicola 11. Source of isolates used in the study 12. Monthly average number of spore released during the disease period over the years 13. Effect of weather parameter on C. cassiicola spore load and CLF disease development during Effect of weather parameter on C. cassiicola spore load and CLF disease development during Effect of weather parameter on C. cassiicola spore load and CLF disease development during Correlation between fortnightly total spore load of C. cassiicola in relation to weather parameters 17. Correlation between fortnightly PDI of Corynespora leaf fall disease in relation to weather parameters Contd...

6 Table No. Title 18. Survival of C. cassiicola on leaf litters 19. Effect of seasonal variation on survival and severity of C. cassiicola in infected rubber plantation 20. Testing of different hosts for the presence of C. cassiicola 21. Cross inoculation studies of C. cassiicola of different host plants 22. Details of Hevea clones used in the study 23. Screening of Hevea genotypes in nursery and in field against CLF disease during Screening of Hevea genotypes in nursery and in field against CLF disease during Screening of Hevea genotypes in nursery and in field against CLF disease during Average per cent disease intensity in nursery and in field screening of Hevea genotypes 27. Overall reaction of H. brasiliensis genotypes for Corynespora leaf fall disease infection 28. Field susceptibility of H. brasiliensis clones for C. cassiicola infection over the years 29. Summary of cluster analysis on field and nursery data showing cluster member constitution 30. In-vitro evaluation of different fungicides against C. cassiicola 31. In-vitro evaluation of botanicals against C. cassiicola 32. In-vitro evaluation of bio agents against C. cassiicola 33. Effect of water-based fungicides in CLF disease management over the years

7 LIST OF FIGURES Figure No. Title 1. Locations included for Corynespora leaf fall disease survey in Karnataka and North Malabar region of Kerala 2. Incidence of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years 3. Severity of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years 4. Effect of incubation period on growth of C. cassiicola on potato dextrose broth 5. Effect of different solid media on radial growth and sporulation of C. cassiicola 6. Effect of different liquid media on dry mycelial weight and sporulation of C. cassiicola 7. Effect of temperature on growth and sporulation of C. cassiicola 8. Effect of relative humidity on growth and sporulation of C. cassiicola 9. Effect of ph on dry weight of mycelia and sporulation of C. cassiicola 10. Effect of light intensity on growth and sporulation of C. cassiicola 11. ERIC PCR profiles of C. cassiicola isolates (1 to 95) M- Marker 12. Dendrogram construct of ERIC PCR profiles of C. cassiicola isolates 13. Monthly average number of spore released during the disease period over the years 14. Effect of weather parameter on C. cassiicola spore load during Effect of weather parameter on CLF disease development during Effect of weather parameter on C. cassiicola spore load during Effect of weather parameter on CLF disease development during 2008 Contd..

8 Figure No. Title 18. Effect of weather parameter on C. cassiicola spore load during Effect of weather parameter on CLF disease development during Corynespora leaf fall disease progress in relation to fungal spore load over the years 21. Dendrograms showing relative grouping of clones based on susceptibility in nursery obtained by average clustering based on squared Euclidean distances 22. Dendrograms showing relative grouping of clones based on susceptibility in field obtained by average clustering based on squared Euclidean distances 23. In-vitro evaluation of different fungicides against C. cassiicola 24. In-vitro evaluation of botanicals against C. cassiicola 25. In-vitro evaluation of bio agents against C. cassiicola 26. Effect of water-based fungicides in CLF disease management over the years

9 LIST OF PLATES Plate No. Title 1. Symptoms of Corynespora leaf fall disease of rubber in nursery 2. Symptoms of Corynespora leaf fall disease of rubber in main field 3. Effect of different liquid media on dry mycelial weight of Corynespora cassiicola 4. Effect of temperature ( 0 C) on mycelial growth of Corynespora cassiicola 5. Effect of relative humidity (%) on mycelial growth of Corynespora cassiicola 6. Effect of ph on dry mycelial weight of Corynespora cassiicola 7. Effect of light intensity on mycelial growth of Corynespora cassiicola 8. The Burkard Volumetric Spore Trap installed on the spore trap stand in infected rubber plantation 9. Preparation of spore trap sampler for using in the field 10. Method of making slid and Counting of spore catch under the microscope 11. Corynespora cassiicola spores and mycelium caught in the spore trap 12. Survival Corynespora cassiicola in plant parts in rubber plantation 13. Corynespora leaf spot symptoms in different host plants 14. Field evaluation of different Heavea clones in nursery and field 15. In vivo evaluation of fungicides against Corynespora cassiicola in immature rubber plantation with HDP sprayer

10 LIST OF APPENDICES Appendix No. Title 1. Preparation of Vaseline wax 2. Preparation of Gelvatol permanent mountant 3. Conversion to Concentration (correction factors) 4. Different developmental stages of leaves and their approximate representation of canopy during different months of a year 5. Analysis of Variance for disease reactions showing type III sums of squares based on field and nursery data for four seasons 6. Spearman rank correlations of clonal susceptibility reactions across years for field and nursery data

11 1. INTRODUCTION Natural Rubber (NR) is one of the cell constituents of several plant species. Most of the rubber producing plants has latex, but in a few, tiny rubber particles are scattered in the tissues. Majority of the rubber bearing plants belong to a few plant families like Euphorbiaceae, Moraceae, Apocyanaceae and Asteraceae but the presence of latex is not an indication of any taxonomic relationship (Metcalfe, 1966). Of the several thousands lactiferous species in the plant kingdom only about 2000 contain rubber in their latex. Among those, 500 have been tried as sources of natural rubber (Bonner and Galston, 1947). Latex is synthesized by and contained in specialized cells or tissues which permeate bark, leaves and other parts of the plant. Rubber content may vary widely in different species which limits their consideration as sources of natural rubber. In species which are not laticiferous, rubber extraction has to be done by mechanical and chemical means. In laticiferous plants where the rubber content in latex is comparatively high, latex is obtained by specific wounding techniques and the rubber recovered by relatively simple methods. In many species rubber content is too little to consider it as a source of natural rubber (George and Panikkar, 2000). Hevea brasiliensis Muell. Arg., the para rubber tree is a perennial dicotyledonous species belonging to the family Euphorbiaceae, which is indigenous to the tropical rain forests of Central and South America. The crop, is only the commercial source of natural rubber (NR), is one of the most recently domesticated crop species in the world and was introduced into Asia by the British (Markham, 1876). Though the many alternate species of natural rubber is available H. brasiliensis accounts for 99 per cent of the worlds NR production (Thomas and Panicker, 2000). It is widely cultivated throughout the Asian countries, including India, Sri Lanka, Thailand, Indonesia, Malaysia, Vietnam and China. In India, its commercial cultivation was started during 1902 and rubber plantations had become well established by the first half of the 20 th century, which now occupies an area of 6.15 lakh ha with the annual production of 8.52 lakh tonnes. India is a fourth largest producer of natural rubber, i.e. 9.2 per cent of global output and more than 90 per cent of the natural rubber produced in India is from Kerala State. Natural Rubber is the most versatile industrial raw material and it was sourced by the civilized world in the early eighteenth century, the numerous uses of rubber have come up and now this plant product has become indispensable for civilization. The most important application of rubber is in human movement, from rubber chappals to automotive and aircraft tyres. Human movement in space and water are also supported by rubber components of the ships used. With the improvement in man s mobility the demand for rubber also increased (Jacob, 2006). It is predicted that the world demand for elastomer will be doubled in the next two decades. Due to shortage in petroleum reserves and increasing environmental awareness, the consumption of natural rubber is likely to increase vis-a-vis its synthetic alternatives (Budiman, 2002; Smit, 2005). However production is constrained by availability of suitable land and other abiotic and biotic stress that influence productivity of rubber plantations. Among the biotic constraints for improvement of productivity of rubber plantations the most important is the incidence of diseases that cause significant crop loss. Among them, abnormal leaf fall caused by Phytophthora sp., Colletotrichum leaf spot disease caused by Colletotrichum acutatum, powdery mildew caused by Oidium heveae and Corynespora leaf fall disease caused by Corynespora cassiicola appear regularly causing more damage to plant growth and yield. Abnormal leaf fall and Gloeosporium leaf spot disease appear during rainy season whereas, powdery mildew and Corynespora leaf fall diseases occur during dry season, just after the period of wintering. Abnormal leaf fall is reported to cause a yield loss of 30 to 50 percent (Pillay et al, 1980). A reduction in crop production of 7 to 45 percent due to Gloeosporium leaf disease also has been reported (IRRDB, 1994). Severe outbreak of powdery mildew was reported to cause an annual yield loss of 14 to 29 percent (Jacob et. al., 1992). Corynespora leaf fall disease was first reported from seedling nursery of Rubber Research Institute of India Farm during 1958 (Ramakrishnan and Pillai, 1961), although association of the fungus with rubber leaves was reported by Deighton (1936) from Sierra Leone.

12 The disease was mainly confined to the nurseries and young immature plants in the main field. Sporadic occurrence of disease on mature trees have been reported from Kodumon, Chittar, Shaliacary and Cheruvally in India during 1969 to 1976 (George and Edathil, 1980) but was not considered significant as the extent of plantation area affected was very limited. The epidemic form of the disease affecting mature tree and causing significant tree and crop loss was not known until 1980s. The severe out break of Corynespora leaf disease was reported in Sri Lanka during 1985, since then, the disease spread rapidly to all rubber growing regions of the island and devastated nearly 4000 ha by 1989 (Liyanage et al., 1989). In Malaysia, the disease was first noticed on field planted rubber in 1975 and subsequently large areas were affected (Tan, 1990). In Indonesia, the disease spread to nearly 1200 ha of which 400 ha had to be uprooted (Sinulingga et al., 1996). In India, severe out break of Corynespora leaf fall disease was observed in coastal Karnataka region and was found spreading towards traditional rubber growing regions in Kerala (Rajalakshmi and Kothandaraman, 1996). During 1999 the disease became very severe (50-70% disease intensity) in Karnataka and North Malabar regions of Kerala and a disease eradication campaign was launched in which more than 10, 000 hectares were sprayed using either copper or mancozeb fungicides with the aid from World Bank Assisted Rubber Project (Jacob and Idicula, 2004). Subsequent annual surveys in the disease endemic areas have revealed that intensity of the disease has remained moderate to severe in some locations (Manju et al., 2001). A number of management approaches viz., use of fungicides, cultural practices and integrated management of disease have been evaluated and recommended for the disease control in nursery, immature and mature rubber plantations. In spite of all these measures Corynespora leaf fall continues to be one of the major constraints in natural rubber production. Therefore, an investigations on important aspects of this pathogen behaviour and disease development was required to see effective management of disease. It is necessary to conduct a survey of the disease so that its distribution and extent of severity can be understood and hotspots can be located, which could also help in natural screening for host plant resistance. The estimation of genetic behavior and changes is an important aspect in order to advocate the control measures. Epidemiological studied plays an important role in developing prediction and forecasting models on disease progress in relation to disease severity and environmental factors. The pathogen survives in different forms during unfavorable environmental conditions. The methods of survival and spread of the pathogen need to be worked out to delink the infection chain at appropriate time in order to manage the disease effectively. Host plant resistance is considered as most practical, feasible and economical method of plant disease management. Estimation of biochemical constituents help in detecting their role in the resistance mechanism. Effective management of this disease using strategies like host plant resistance, plant extracts, bio agents and fungicides is necessary. Therefore, the present investigations were undertaken with the following objectives. 1. To survey Corynespora leaf fall disease incidence in major rubber growing regions of Karnataka and North Malabar region of Kerala. 2. To study on morphological and cultural variations of the pathogen. 3. To study the molecular variability of the pathogen 4. To study on survival of the pathogen. 5. To study on aerobiology and epidemiology of C. cassiicola causal agent of CLF disease 6. Screening of new Hevea clones for C. cassiicola resistance. 7. Management of Corynespora Leaf Fall disease.

13 2. REVIEW OF LITERATURE Natural Rubber is the most versatile industrial raw material produced by a para rubber trees (Hevea brasiliensis). However production is constrained by availability of suitable land and other abiotic and biotic stress that influence productivity of rubber plantations. Among the biotic several leaf diseases in different stages of its growth in nursery, immature and mature plantations. Abnormal leaf fall caused by Phytophthora sp., Colletotrichum leaf spot disease caused by Colletotrichum acutatum, powdery mildew caused by Oidium heveae and leaf fall disease caused by C. cassiicola (CLF) appear regularly causing more damage to plant growth and yield. Among them the CLF disease is a major leaf disease that causes threat to rubber cultivation in traditional and non-traditional rubber growing areas in South and South East Asia. Literature is available on Corynespora leaf disease caused by C. cassiicola of many field crops but little information is available on Corynespora leaf fall disease of plantation crop like rubber. The review of literature on C. cassiicola of different crop is as given hereunder. 2.1 Symptomatology The symptoms of Corynespora leaf fall disease of rubber incited by C. cassiicola in nurseries are usually circular, rarely irregular amphigynous and 1 to 8 mm in diameter. Each leaf spot shows a white/light brown papery centre with dark brown ring at the margin, surrounded by yellow halo. Disintegration of the central portion sometimes results in short hole formation. Young leaves show shrivelling at the leaf tips. Defoliation of the upper young leaves and drying of the terminal portion consequent to formation of several lesions are common during the dry weather (Ramakrishnan and Pillai, 1961). Ramakrishnan et al. (1961) observed the occurrence of Corynespora leaf spot disease of rubber for the first time in India during 1958, mostly in nurseries. Symptoms include circular, amphigenous spots on young leaf surface, 1-8 mm. diam, with a brown or whitish papery centre surrounded by a dark brown ring and a yellowish halo. Shot holes occur subsequently when the leaf matures and terminal shoots may wither leading to leaf fall. Rajalakshmy et al. (1981) described the symptoms of Corynespora leaf fall disease of rubber in the budded plants grown in polybags. The main symptoms are irregular or circular lesions of varying size delimited with wavy border. Radziah and Hashim (1990) described in details of symptoms caused C. cassiicola and Bipolaris heveae. The factors affecting disease development are outlined and disease management procedures including planting resistant clones, disease avoidance and chemical control are described. Tan (1990) described the symptoms of Corynespora leaf fall disease of Hevea caused by C. cassiicola, on leaves, leaf stalks and twigs and observed that it occur throughout the year and thus making chemical control uneconomic. Jacob (1997) stated that complete drying up of infected trees have been observed in a few plantations due to repeated defoliation by Corynespora leaf fall disease attack. The symptoms vary widely with clones and locality. The stage of the leaves when the infection sets in is another important factor affecting the symptoms. Jayasinghe (2000) observed the symptoms of Corynespora leaf fall disease of rubber incited by C. cassiicola, in nursery seedlings young flushes get infected and fall off. The process of repeated defoliation and refoliation adversely affects the growth of young plants. Infected seedlings in nurseries become retarded and do not achieve sufficient girth for budding at the right time Edathil et al. (2000) reported that C. cassiicola infection in semi matured rubber leaves lead to large lesions on the lamina appearing as blotches of light brown colour with dark brown margin and wide yellow surrounding areas. Concentric rings are sometimes seen in the central portion of the lesions.

14 Jayasinghe et al. (2005) observed the Corynespora leaf fall disease symptoms on leaves of mature rubber trees as irregular brown patches like those caused by powdery mildew and numerous spots like that of Birds eye spot diseased. In certain clones blackish lines were observed on primary and secondary veins. This also observed that on some clones like RRIM 600 and GT 1 the size of lesions are smaller compared to that on clones like RRII 105 and PB 260. Jacob (2006) also described in details of Corynespora leaf fall disease symptoms rubber in nursery, immature and mature plants. The symptoms are commonly observed in the nurseries when the infection is mild to moderate the severe form of disease causes complete blighting of the young leaves of plants both in seedling stage and the budded plants grown in polybag. In the bud wood nurseries leaf spots are more common although blighting of leaves are occasionally seen. On semi mature leaves infection leads to typical round or irregular lesions with papery centre brown margin and yellow halo. Jacob (2006) stated that the C. cassiicola infection on veins lead to distinct railway track symptoms varying from a few millimetres to several centimetres in length. Primary, secondary and tertiary veins get infected. If the petioles or main vein at the base of the leaflet get infected, defoliation follows within a couple of days. In other cases the leaflets survive for longer time and if infection is not severe, the leaves may hold on. Pu-JinJi et al. (2007) observed the symptoms of Corynespora leaf fall disease of rubber on leaves included fishbone, vein necrosis and leaf spots. 2.2 Distribution, Survey and surveillance The Corynespora leaf fall disease survey was carried out by Ramakrishnan and Pillai (1961) in major rubber growing regions in Kerala and reported the occurrence of Corynespora leaf fall disease of rubber caused by the fungal pathogen C. cassiicola in some places. The pathogen mostly attacks only young leaves of nursery plants and the disease was mainly confined to the nurseries and young immature plants. Newsam (1963) reported the occurrence of Corynespora leaf disease in budwood rubber nurseries in Malaysia during 1960 and the intensity was confined to plants which were weak due to iron deficiency. Awoderu (1969) observed the Corynespora leaf disease of rubber for the first time in Nigeria during the disease survey in 1966 in the Western, Mid western and Eastern States. George and Edathil (1980) reported that sporadic occurrence of Corynespora leaf fall disease on mature rubber trees in some locations in India during 1969 to 1976 but were not considered significant as the extent of plantation area affected was very limited. Soepena (1983) detected the Corynespora leaf fall disease of rubber caused by C. cassiicola for the first time during the disease survey in 1980 in the Sembawa experimental station, South Sumatra, Indonesia Liyanage et al. (1986) surveyed the epidemic occurrence of Corynespora leaf fall disease during 1985 to 1986 on mature rubber plantations in major rubber growing regions of Sri Lanka. The clone RRIC 103 one of the high yielding indigenous clone of the Rubber Research Institute of Sri Lanka (RRISL) recommended for large-scale replanting was severely infected with this disease. Soepena (1986) reported that the Corynespora leaf fall disease of rubber caused by C. cassiicola was spread to Central and West Java of Indonesia. Kajornchaiakul (1987) observed the Corynespora leaf fall disease incidence of rubber for the first time in Thailand during the disease survey in The disease was observed in clones RRIC 103 and KRS 21. Liyanage et al. (1989) carried out the Corynespora leaf fall disease survey in rubber growing regions of Sri lanka and reported severe form of Corynespora leaf disease during 1985 from Dartonfield Estae of the RRISL which spread to all the wet districts of Sri Lanka within two years and that more than 4000 hectares of plantation was affected.

15 Corynespora leaf fall disease survey was carried in major rubber growing regions in Malaysia during 1990 and it was reported that the disease was widely distributed in most of the rubber growing regions and incidence varied from 24 per cent in Selangor to 97 per cent in Johore and 35 of the 63 cultivated rubber clones grown were affected by the disease Tan (1990). Tan et al. (1992) studied the distribution, severity of secondary leaf fall of rubber caused by Colletotrichum gloeosporioides [Glomerella cingulata] or Oidium heveae, and Corynespora leaf fall caused by C. cassiicola in rubber growing regions of Malaysia. Corynespora lea fall disease was widely distributed in most of the rubber areas and severity varied among the regions surveyed. Mondal et al. (1994) reported in a survey report that, leaf diseases of rubber caused by C. cassiicola and Guignardia heveae (leaf spot); Bipolaris heveae (bird's eye spot); Colletotrichum gloeosporioides [Glomerella cingulata](leaf anthracnose); Oidium heveae and Gloeosporium alborubrum [G. cingulata] (secondary leaf fall) were recorded in all the plantations surveyed in Northeast India. Kamar (1994) carried out series of Corynespora leaf fall disease survey in rubber growing regions of Malaysia during 1993, which revealed high disease incidence in Johore and Terengganu region. There were some variations in the disease incidence in the different clones, although GT 1 and RRIM 600 rated as resistant continued to show symptoms. Sinulingga et al. (1996) studied the distribution of Corynespora leaf fall disease of rubber caused by C. cassiicola in Indonesia and revealed that CLF disease had spread to Aceh in 1990, Jambi, Riau and Lampung in 1992 East Java in 1993 and Kalimantan and most other rubber growing regions in During 1980s nearly 1200 ha was severely affected of which 400 ha had to be uprooted causing an economic loss of RP 200 billion Rajalakshmi and Kothandaraman (1996) reported the occurrence of epidemic form of Corynespora leaf disease for the fist time in the Rubber Research Institute of India (RRII), Hevea Breeding Sub Station at Nettana in South Karnataka during 1996 disease survey. Jacob (1997) described the two of the main diseases Corynespora leaf disease and South American leaf blight, affecting rubber (Hevea). Information was provided on epidemics in various countries, reports of the disease in India, symptoms, mechanisms of infection and disease development, susceptibility of clones, host range and control measures for Corynespora leaf disease caused by C. cassiicola and symptoms, distribution, causal organism of Microcyclus ulei, host range, life cycle, physiological races, physiology of plant resistance, possible behavior of M. ulei if introduced in Asia, management, crown budding, chemical control, prevention, quarantine agreements, phytosanitary arrangements in India and emergency eradication of South American leaf blight. Sujatno and Suhendry (2000) observed that the Corynespora leaf fall disease of rubber indicated that 70 per cent of rubber area in Indonesia shows varying degrees of CLF disease incidence. There was upto 2-year delay in infected young plants to reach maturity. Chanurag (2000) carried out the Corynespora leaf fall disease survey in major rubber growing regions of Thailand and reported that CLF disease was observed at Songkhla Rubber Research Centre and disease was also present in southern, eastern and northeastern regions of Thailand and the clones found susceptible include Songkhla 36, PR 255, PR 305 and RRIT 251. Idicula et al. (2000) reported that the moderate incidence of Corynespora leaf fall was noticed in some plantations in Karnataka and Kerala, the disease has remained fairly under control and significant tree or crop loss was reported only from very few plantations. The clone most widely cultivated in this region is RRII 105 and it was observed that this clone is susceptible and low disease incidence was observed in areas planted with GT 1. Dung and Hoan (2000) describes attempts that were made to eliminate the susceptible rubber trees in Vietnam. A total of 221 trees were removed from Laikhe experimental station, Vietnam. More than 3000 susceptible trees were also removed from different estates in Vietnam to avoid danger of disease spread of Corynespora leaf fall disease from affected trees.

16 Jean (2000) reported the incidence of Corynespora leaf disease in Hevea cultivated in Cote d Ivoire based on 1989 disease survey. The disease was particularly severe on clone RRIC 103 and this clone was completely eradicated immediately. Manju et al. (2001) carried out extensive Corynespora leaf fall disease survey in major rubber growing regions of Karnataka and North Malabar regions of Kerala, South India. It revealed that the epidemic was widespread in Subramanya, Sullia and Puttur and had extended upto Kanhangad region in Kerala, which adjoins South Karnataka. Jacob and Idicula (2004) reported that the Corynespora leaf fall disease became very severe (50-70% disease intensity) during 1999 in Subramanya, Sullia, Puthur, Madikeri and Kanhangad regions and a disease eradication campaign was launched in which more than 10, 000 hectares were sprayed using either copper or mancozeb fungicides with the aid from World Bank Assisted Rubber Project. Ahmed et al. (2008) reported that the C. cassiicola, which causes Corynespora leaf fall disease, is one of the most destructive and economically important fungal pathogens of Hevea rubber trees in Asian and African countries. This fungus was present in some Hevea rubber plantations and nurseries in Hainan and Yunnan provinces of South China. They tested the 32 leaf samples obtained from 28 Hevea rubber trees in 15 rubber plantations and nurseries of Hainan and Yunnan provinces, 21 tested positive for presence of C. cassiicola fungus. Ogbebor and Nicholas (2010) reported the status of common leaf diseases of Hevea brasiliensis, incidence of Corynespora leaf fall disease was highest with disease index ranging from , while Colletotrichum leaf fall incidence was least ( ). 2.3 Morphological and Physiological studies Morphological studies Morphology plays a significant role in taxonomy that facilitates identification of species and enables prediction of biological activity. Because each fungal disease of plants is usually caused by only one fungus, and there are more than one lakh different species of fungi, the identification of the fungus species on a diseased plant specimen or culture of a fungus means that all but one of all the known fungus species must be eliminated as being the fungus in question Growth of fungus on different media Almeida and Yamashita (1976) studied the growth and sporulation of C. cassiicola (Berk. & Curt.) Wei. in different culture media, growth and sporulation of the C. cassiicola was excellent on media supplemented with V-8 or Gerber's baby food consisting of various vegetables, when cultures were kept under continuous light. Almeida (1977) studied the effect of ph on growth and sporulation of C. cassiicola in potato-dextrose agar medium under different incubation periods. Duarte et al. (1983) studied the morphological and physiological characteristics of two C. cassiicola isolates, variations in length, width and number of septa of conidia and conidiophores were observed in two isolates from pawpaw and cocoa. Radial growth of the cocoa isolate was favoured by potato dextrose agar in continuous darkness, sporulation by PDA + 1% yeast extract in continuous light. Growth of the pawpaw isolate was best on Czapek Dox medium in continuous darkness, sporulation being good in both continuous light and continuous darkness. Symptoms on various hosts induced by the two isolates were different. Chee (1988) studied the sporulation and pathogenicity of C. cassiicola on rubber. Sporulation was best on potato sucrose agar and max. when cultures were incubated in the dark for 3 d followed by a daily 2 h exposure to UV light, or continuous light for 3-6 d. Field or single spore isolates varied greatly in cultural morphology and rate of sporulation, ranging from nil to 650 spores/cm agar surface. Conidia germinated within 4 hrs. germ tubes grew more often from the end cells of the spores. Leaves were most susceptible to infection for up to 4 weeks.

17 Anonymous (2000) reported that single spore cultures of C. cassiicola varied greatly in growth rate, aerial mycelium and coloration. The rate of sporulation varied from 0 to 650 spores/cm. Optimum sporulation was obtained by culture on potato sucrose agar in the dark for 3 days followed by a daily 2 hrs exposure to UV light for 3 days. Nguyen et al. (2008) studied morphological characters of the C. cassiicola isolates from the rubber plantation. Variations in colony and conidial morphology were observed not only among isolates but also within a single isolate with no inclination to either clonal or geographical origin of the isolates Physiological studies Boosalis and Hamilton (1957) based on the field surveys and experiments on Corynespora leaf fall disease, suggested that a soil temperature above C arrests the development of the CLF disease before it causes any appreciable damage. Onesirosan et al. (1974) reported that sporulation of C. cassiicola was greatly increased when the cultures were scraped after 3 days' growth and then grown for 3 days more in continuous light. Stan and Neamtu (1988) reported that infection by C. cassiicola in cucumbers is favoured by high temperature (25-30 O C) and by maximum atmospheric humidity. In greenhouses the temperature variation between day (15-30 O C) and night (13-15 O C) provides favourable conditions for a continuously high atmospheric humidity providing the drops of water necessary for conidial germination. Chee (1988) reported that a dark period of 3 days followed by 3 days continuous light at 26 0 C resulted in significantly more conidial sporulation of the isolates of C. cassiicola on rubber (Hevea brasiliensis) on PSA. When 18 isolates of C. cassiicola were grown on PSA they differed in their colony morphology. Sporulation was more with 2h daily exposure to UV light and progressively less with continuous light, alternate light and dark, 2h daily of fluorescent light and continuous dark. Yu et al. (1991) studied the pathogenicity in inoculation tests for C. cassiicola, growth in vitro was best at 27 O C and sporulation was abundant on potato dextrose-malt agar. Kumar and Jacob (2005) reported that C. cassiicola isolates prefer four hours of daily light exposure for 7 days for their maximum growth and 5 to 6 hours of light alternating with darkness for their maximum sporulation. Guan et al. (2006) studied the effects of temperature on growth and sporification of flue-cured tobacco leaf spot pathogen C. cassiicola was cultured on PDA (potato-dextrose agar), CDA (Candida diagnostic agar) and CYA (Czapek yeast autolysate) at O C. The pathogen had a highest growth rate and sporilation at to 30 O C. It produced no conidia at 10 O C and few conidia were produced at the temperature about 30 and less than 20 O C. The optimum temperature for sporilation conidial germination, infection and extension to plant tissue was O C. The lethal temperature for its conidia was 55 O C for 10 minutes. 2.4 Genetic variability of pathogen Silva et al. (1998) reported the genetic variability in isolates of C. cassiicola cultured from pawpaw using restriction fragment length polymorphism (RFLP) analysis of internal transcribed spacer (ITS) regions of ribosomal DNA and random amplified polymorphic DNA (RAPD) analysis of total fungal DNA. The ITS region of all isolates exhibited identical size and restriction endonuclease digestion pattern and RAPD profiles generated by 14 decamer primers of arbitrary sequence showing significant differences between some of the isolates. Cluster analysis of 218 amplified DNA fragments showed the isolates could be placed into 3 groups that corresponded with their host origin and morphological characteristics. Darmono (1996) studied the genetic variability of C. cassiicola infecting Hevea using RAPD. Based on a UPGMA analysis using 149 molecular characters generated with RAPD, except for 4 isolates, all isolates were more than 95% similar at the molecular level regardless of geographical and clonal origin.

18 Raina et al. (1997) stated that through molecular analysis of C. cassiicola in some cases the genetic proximity is related to their geographical origin, the data reveal that even among isolates from a single location there is a remarkable variability in DNA fingerprints. This suggests the lack of a general correlation among the geographical location and genetic similarity Saha et al. (2000) studied the existence of different genotype of C. cassiicola in South India, seven different genotypes of the pathogen were detected. Genotype may be considered as a newly evolved one and genetic relationships among the isolates showed wide divergence among the Kerala isolates, which may be attributed to the long history of rubber cultivation in Kerala compared to that of Karnataka. Saha et al. (2002) reported molecular characterization of 36 isolates of icola from 19 different locations of two rubber growing states of southern India viz., Kerala and Karnataka investigated using RAPD markers. RAPD analysis clearly indicated the existence of at least ten different genotypes of C. cassiicola. Atan and Hamid (2002) differentiated the races of C. cassiicola infecting Hevea using two molecular marker techniques. Nine isolates of C. cassiicola were analyzed using RAPD and the amplification of the ITS regions of ribosomal DNA. RAPD distinguished two groups of isolates, with one cluster containing isolates infectious to the clone RRIM 2020 and the other cluster containing isolates that infected RRIM 600 and other clones of Hevea. The ITS region of eight out of nine isolates were found to be monomorphic. Silva et al. (2003) attempted to find out a possible relationship between host origin and virulence of 42 isolates of C. cassiicola using RAPD analysis. Using eight random primers, five genetic groups were identified suggesting significant genetic variation among C. cassiicola isolates collected from different host plants. Romruensukharom et al. (2005) studied the genetic diversity among twenty-four isolates of C. cassiicola from rubber plantations in Thailand. According to the virulence reaction, the isolates were classified into eleven pathotypes. However, cluster analysis of RAPD data separated isolates into three groups and no correlation between different RAPD groups, pathotype or geographical region was detected. Analysis of the molecular variance revealed that 54.97% of total genetic diversity was due to variation among isolates within the regions and 45.03% came from variation between regions. Nguyen et al. (2008) studied inter simple sequence repeat (ISSR) markers analyses of C. cassiicola isolates from rubber plantations in Malaysia. ISSR analysis delineated the isolates into two distinct clusters. The dendrogram created from UPGMA analysis based on Nei and Li's coefficient showed that cluster 1 encompasses 12 isolates from the states of Johor and Selangor, while cluster 2 comprises of 9 isolates that were obtained from the other states. Detached leaf assay performed on selected Hevea clones showed that the pathogenicity of representative isolates from cluster 1 resembled that of race 1 and isolates in cluster 2 showed pathogenicity similar to race 2 of the fungus that was previously identified in Malaysia. Yanxiang et al. (2009) studied the inter simple sequence repeat (ISSR) molecular fingerprinting of 24 C. cassiicola isolates obtained from a lot of Hevea clones grown in most rubber nurseries and a few plantations in China. Among the 24 isolates 23 of the isolates were susceptible to RRIM 600 and were considered as race 1. ISSR analysis grouped 24 C. cassiicola isolates into four clusters (A, B, C, and D). The cluster A included 19 isolates from Hainan and Yunnan clusters B and C comprised of 1 isolates from Hainan, respectively, while cluster D encompassed 3 isolates from Hainan and Yunnan. These results should facilitate the development of rubber clones with enhanced resistance against all genetic clusters of C. cassiicola. 2.5 Epidemiological studies Aerobiology In many fungi diurnal periodicity of spore release appears to be influenced by environmental conditions triggering spore release mechanisms.

19 For Drechslera tureica, the causal agent of northern leaf blight of maize, copious release of the spores was brought about by water stress. Meredith (1963) observed the violent spore release in some fungi imperfecti, spore discharge that occurs in Alternaria tennism, Curvularia lunata, C. cassiicola and Zygophiala jamaicensis on transfer from a humid to dry atmosphere is described from the Banana Board Res. Dept., Jamaica. It is also suggested that at night the turgor of the spore apparatus is regained with disappearance of gas bubbles and that rapid decrease in vapour pressure the following morning triggers the various release mechanisms accounting for the observed periodicity in spore liberation. Chandrasekharan Nair and Raj (1966) studied the diurnal periodicity of spore liberation in C. cassiicola. Spores were liberated in an infected tomato crop in a pattern of diurnal periodicity, with a peak from 8 to 10 a.m. and few spores were trapped at night. Chee (1988) studied the epidemiology of C. cassiicola on rubber, spore trapping in the field showed that spore release began at h, attained a peak at h, fell to a very low level in the evening and remained low throughout the early hours of the morning. There was no clear-cut seasonal pattern of spore release in relation to rainfall, more spores were caught on fine days preceded by a day of wet weather implying that moisture may be important for spore release while wind may help dissemination. Raghuram and Mallaiah (1989) studied the air spora of a cotton field during Feb to Jan at Nagarjuna University using a Burkard spore trap. Of the 38 trapped fungi recorded only 4 (Alternaria macrospora, Cercospora gossypina, C. cassiicola and Ramularia gossypii) were pathogenic to cotton. The majority of the spores (29.24%) were of Cladosporium. The 4 pathogenic spore types contributed only 0.32% to the total air spora. C. cassiicola appeared throughout the year and the other 3 pathogens appeared only when the crop diseased. Four patterns of circadian variations were recorded. Spores were at their highest concentration when the crop was in full bloom or in senescent stages. Lee et al. (1990) studied the relationship between disease occurrence and dispersal of airborne conidia of C. cassiicola on sesame in field using a wind direction type spore trap. Number of conidia dispersed increased in the 4 th and 5 th 5-d period in July and peaked in the 5 th 5-d period in Aug. Most conidia were detected 15 cm up the side of the glass trap and the least were detected 90 cm up the slide glass. The disease progressed rapidly from the 3 rd day of a 5-d period in Aug. and reached 5.8% diseased leaf area by the 5 th day of the 5-d period in Aug A positive correlation was observed between the number of conidia and the diseased leaf area. Purwantara and Pawirosoemardjo (1991) reported the symptom development and spore dissemination of Corynespora leaf fall disease on Hevea rubber clone PPN 2058 in relation to rainfall, temperature and RH. Symptoms developed were on naturally infected leaves. Morning rainfall induced the incidence and development of disease symptoms on 2 to 53 days old leaves. Fallen leaves were marked with spots on the leaf midrib and/or the leaf stalk, leaf fall occurred 2 to 51 days after the spots emerged. The spores were disseminated during the day and night with a peak release at around midday. Radziah et al. (1996) studied the diurnal pattern of spore release of C. cassiicola in rubber plantations. Spore count was very small from midnight to about 7 AM and the number of spores caught continued to rise sharply after that, reaching a peak around mid-day, after which it dropped rapidly to a very low level by mid-night. Diurnal release of spores appears to be correlated to relative humidity, more spores being liberated during low humidity periods. High spore count in the infected rubber plantation is not as critical as the microclimate within the canopy for the initiation and development of the disease. Jayasinghe et al. (1996) reported that the Rubber Research Institute of Sri Lanka investigated the biology and epidemiology of Corynespora leaf fall disease, caused by C. cassiicola to develop proper management strategies. High variation was observed in spore morphology, sporulation intensity, symptomatology and the susceptibility of clones grown in the Eastern Hemisphere since the first detection. It is suggested that the only economic means of overcoming the problem is the use of resistant rubber varieties. This raises the urgent need for an understanding of the genetic variability present among isolates of C. cassiicola from rubber trees in Sri Lanka. Attempts have been made to identify whether different strains or races of C. cassiicola are involved in the attack on rubber plants and 3 strains of C. cassiicola have so far been identified using the RAPD-PCR technique.

20 2.5.2 Effect of environmental factors on leaf disease Epidemic of Corynespora leaf fall disease of rubber could be prevented by intervention in the factors involved in the disease triangle namely host, pathogen and environment. Environmental zoning will help in management using resistant clones. Such zoning is aimed at preventing economic loss caused by the disease either by growing susceptible varieties only in the regions where the weather is not favorable to pathogen development or where varieties are less likely to be attacked by the pathogen. In the regions with high risk of the disease resistant varieties should be planted. Conversely resistant varieties can be planted in location likely to favor the pathogen development and infection. Ho et al. (1974) stated that epidemic of C. cassiicola infecting rubber can be prevented either by environmax zoning i.e., planting rubber clones in areas where the environmental conditions are not encouraging for the development of pathogen or by management using resistant rubber clones i.e., planting polyclonal or multiclonal rubber seedlings in the regions with high risk of the disease. Humid or cloudy weather with moderate rainfall throughout the day and air temperature ranging from C are the climatic conditions favourable for the C. cassiicola. Serious attack occurred under the conditions of mean daily rainfall of 12.4 mm, with 27 rainy days with mean relative humidity of 89% and temperature of 27 0 C. It is also reported that attacks Corynespora leaf fall disease is severe in rubber trees grown in lower altitudes than higher altitudes. This can probably be attributed to inhibition in the development of the pathogen under the low temperature at high altitude (Situmorang et al., 1984). Pawirosoemardjo (1988) found that relative humidity of per cent, temperature of O C and full light or darkness are suitable for the germination of conidia of C. cassiicola. Under these conditions, tender leaves will be easily and quickly infected by the pathogen. Chee (1988) reported that Corynespora leaf fall disease incidence is observed to be severe in the regions with low rainfall compared to that with relatively higher rainfall. In the areas where rainfall is distributed throughout the year or under areas where there is a break between wet and dry seasons, the disease attack occurs but leaf fall does not occur throughout the year. Situmorang et al. (1996) studied the environmental factors favouring for the development of Corynespora leaf fall disease. High humidity, temperature ranging from 28 to 30 0 C, alternate light and dark periods during spore germination and fungal infection and humid air and/or cloudy weather with moderate rainfall occurring through the day as well as air temperature ranging from 26 to 29 0 C during the colonization of leaf tissues have more impact on the disease development. Corynespora leaf fall disease affected region in India possess a maximum temperature of 34 to 36 0 C and a minimum of 17 to 20 0 C, a morning humidity of more than 85 percent, an afternoon humidity of less than 40 percent with a mean sunshine duration of 8 hours/day were observed as essential pre-requisites for the triggering and progress of the disease (Sailajadevi et.al. 2005). 2.6 Survival of the Pathogen Boosalis and Hamilton (1957) observed that the C. cassiicola was found to cause root and stem rot of Soybean. The pathogen overwinters on infected roots and stems and can survive in infested unsterilized soil for at least 2 years. Incidence was highest in fields where soyabean had been planted for two successive years. Seaman and Shoemaker (1965) isolated the C. cassiicola from overwintered soyabean root debris, the roots of mature beans (Phaseolus vulgaris), and soyabean roots from soil not previously used for this crop. Sarma and Nayudu (1971) reported the Corynespora leaf spot of brinjal caused by C. cassiicola. Pathogen survived 4 and 10 months in infected leaves and stems, respectively, at O C and 11 months in stems stored at fluctuating temperature.

21 It was suggested that sclerotial bodies play an important part in survival. Alternative hosts reported are Croton sparsiflorus, Leucas aspera, Ocimum sanctum, Solanum nigrum, Digera arvensis and Capsicum. The last may be a primary source of infection in summer. Shukla et al. (1987) made studies on perpetuation of Corynespora blight of sesame C. cassiicola is both seed- and soil borne. The pathogen was carried over in plant debris from one season to another under field conditions for > 10 months and was then able to initiate primary infection. Secondary spread was through spores produced on diseased leaves and transmitted by air and water. Hansen et al. (1994) reported the survival of C. cassiicola in soybean roots, this pathogen represented 4 per cent of the 1863 fungal isolates tested from Red River Valley of Minnesota and North Dakota, USA, in and the pathogen was present in 57 of 705 of fields surveyed. Navas and Subero (1995) reported that the target spot of sesame (Sesamum indicum) caused by C. cassiicola is one of the most important diseases of this crop in Venezuela, particularly during the wet season. The pathogen is frequently found in seed and its transmission by seed is very effective. They also tested the survival of C. cassiicola in sesame seeds under two storage temperatures, infection decreased rapidly from 89.8 to 8% in 7 months. In 10 months, the fungus was completely inactive. In seed stored at 5+or-1 degrees and 60% RH, the percentage of infected seed decreased slowly, from 89.8 to 62% in 10 months. Seed germination in both storage conditions was 88 and 90% by the end of the experiment. Miyamoto et al. (2007) showed the role of conidium contaminated agricultural equipment and disease debris on the incidence of Corynespora target spot on cucumber. Kaur et al. (2007) reported that the C. cassiicola and Macrophamina phaseolina are pathogenic to Sesamum seed which survive on the seeds leading to loss in germinability of seeds. 2.7 Host range of the pathogen Laubert (1926) stated that leaf blotch of cucumbers caused by C. cassiicola is most serious leaf disease of greenhouse cucumbers in England and in Germany. Ramakrishnan and Pillai (1961) observed that C. cassiicola fungal pathogen was infecting Hevea rubber and causing leaf spot in young rubber. Jones (1961) reported the leaf spot of cotton caused by C. cassiicola. The fungus isolated proved pathogenic to both Gossypium hirsutum and G. barbadense and appears identical with the pathogen attacking soyabean and sesame in the same area. Shome and Mukherjee (1964) observed the leaf spot of Justicia gendamssa caused by C. cassiicola a new host for the pathogen. Karan (1966) reported that castor bean (Ricinus communis L.) was new host for Periconia byssoides and C. cassiicola which were found causing the leaf spots. Sobers (1966) reported that Azalea and Hydrangea are the new host for the C. cassiicola causing leaf spot disease. Wilson and Devi (1966) reported that C. cassiicola found to cause leaf spot of Eucalyptus grandis and producing the symptoms of small leaf-spots, sometimes coalescing to form irregular necrotic areas, with subsequent defoliation and twig dieback when the disease is severe. Massenot and Cassini (1967) distinguished the type of lesion caused by C. cassiicola on cotton. The morphology of C. cassiicola was described and its polyphagous nature was confirmed by inoculation experiments. Sarma and Nayudu (1971) recorded that C. cassiicola occurring on eggplant and tomato since 1965, has now been reported on chilli, Solanum nigrum, Ocimum sanctum, Leucas aspera, Croton sparsiflorus, cotton, Digera arvensis and Syzygium jambolana, these being new host records for India. Brief notes are given of the disease on each host.

22 Melendez and Pinero (1971) reported the Corynespora leaf spot of Papaya (Carica papaya L.) caused by C. cassiicola, is newly recorded in Puerto Rico, causing severe damage on Solo and Puerto Rican vars. and constituting a threat to the newly established papaw industry. Fazalnoor et al. (1971) reported the Corynespora leaf spot of Cow-peas (Vigna sinensis) a new host record in India. Pathogen was isolated from severely infected cowpea leaves in Dharwar. Symptoms of the disease and morphological characters of the fungus are described. Reddy et al. (1971) reported the target leaf-spot disease of Rauvolfia serpentina caused by C. cassiicola was isolated from severely diseased plants and its pathogenicity was proved by inoculation. Anahosur et al. (1971) reported the new leaf spot disease of Salvia leucantha from India caused by C. cassiicola. It was pathogenic to cowpea, Phaseolus mungo and soybean. Philip et al. (1972) reported leaf blight of Coccinia indica caused by C. cassiicola, a new host record. Fajola and Alasoadura (1973) observed the Corynespora leaf spot a new disease of tobacco (Nicotiana tabacum), was found to be affecting up to 15% of mature tobacco plants in S. Nigeria. Mc. Ritchie and Miller (1973) observed the Corynespora leaf spot of zebra plant was isolated from necrotic leaf spots on Aphelandra squarrosa. Pathogenicity was demonstrated only on wounded leaves. The isolate was not pathogenic to Hydrangea macrophylla and Ligustrum sinense. Philip (1973) reported that C. cassiicola causes leaf spot on Ipomoea carnea Jacq, a new host record. Miller and Alfieri (1974) stated that leaf spot of Ligustrum sinense was caused by C. cassiicola and characterized the symptoms as light brown spots with purple margins. Saksena and Singh (1975) reported premature defoliation and death of blighted sesame plants caused by C. cassiicola. The pathogen was also pathogenic to tomato and Dolichos lablab and was carried both on and within seed from affected plants and survives on host plant debris until the next crop season. Upadhyay and Bordoloi (1977) observed Corynespora blight of Solanum mammosum L, a new host record from India. Barman and Roy (1978) reported the Corynespora leaf spot of french bean and tomato caused by C. cassiicola. Pathogen causes spots mainly on leaves, but they may occasionally be found on the petioles and major branches of male inflorescences. Individual spots are small and inconspicuous but may become numerous enough to cause premature defoliation and reduction in yield and fruit quality. Castro (1979) reported leaf blight of cucumber (Cucumis sativus) caused by C. cassiicola, a new disease in the Valley of Culiacan, Sinaloa, Mexico, which was caused extensive damage in some cucumber fields. Sharma and Jain (1979) reported leaf-spot disease of 'Kapok' (Ceiba pentandra) caused by C. cassiicola a new host record. Devi et al. (1979) reported Corynespora leaf spot of sweet basil caused by C. cassiicola. The pathogen was identified on the basis of its morphology and pathogenicity and this was a new host record of the fungus in India. Addy and Hazarika (1980) reported new leaf spot of winged bean caused by C. cassiicola, a new host record. Puzari and Saikia (1981) reported that Amorphophallus campanulatus, a new host for C. cassiicola. Sattar et al. (1981) reported a new leaf spot disease of Japanese mint caused by C. cassiicola, a new host record.

23 Saikia and Sarbhoy (1981) observed Corynespora leaf spot of Eugenia caryophyllata, was newly recorded on clove in Assam, symptoms are described. Mishra (1981) reported the brown spots on sunn-hemp (Crotalaria juncea) caused by a C. cassiicola new host for the pathogen. Chaudhury and Ray (1981) reported the incidence of Corynespora leaf spot on tomato fruit caused by C. cassiicola in West Bengal. Rajak et al. (1982) observed a new leaf spot disease of Bombax ceiba caused by C. cassiicola is reported from Jabalpur. Mukherjee and Dasgupta (1982) observed the leaf blight and decline disease of papaya incited by C. cassiicola. It is caused severe leaf blight resulting in leaf drop and a per cent loss in fruit production. The symptoms are described and illustrated. Chase (1982) recorded Corynespora leaf spot of Aeschynanthus pulcher and related plants, pathogen caused a serious leaf spot of this ornamental plant and was pathogenic on Aphelandra squarrosa. Isolates from A. squarrosa were pathogenic on A. pulcher. Nematanthus sp., Columnea sp. and Aeschynanthus marmoratus were susceptible. Teoh (1983) reported the Corynespora leaf fall of Hevea in West Java, the disease caused by C. cassiicola was newly reported from Indonesia. A severe outbreak occurred in 1982 in Banten, W. Java, after a prolonged drought period. Chase (1984) reported the leaf spot disease of Ficus benjamina caused by C. cassiicola, a new host record. Gasparotto et al. (1985) reported the occurrence of C. cassiicola on rubber in Amazon State, symptoms induced by the fungus and newly recorded on rubber in Brazil, are described. Chaurasia and Singh (1985) reported the Corynespora leaf spot of Justicia simplex incited by C. cassiicola, constitutes a new host record. Vyas et al. (1985) observed new leaf blight diseases of groundnut caused by C. cassiicola a new host record for this pathogen. Florence and Sharma (1987) reported that the C. cassiicola a new leaf spot pathogen for Gmelina arborea in India. This pathogen was first recorded on 2-yr-old G. arborea during a disease survey in forest nurseries in Kerala. The disease occurred only during the monsoon and usually only affected the mature leaves. Jacqua and Gerion (1988) stated that C. cassiicola was the most prevalent pathogens on aerial parts of Aubergines. Leroy and Lourd (1989) recorded the new foliar disease of tomato caused by C. cassiicola in Manaus, morphological characteristics, typical symptoms (necroses on leaves, fruits, flowers and stems) and pathogenicity tests, C. cassiicola was identified as the main foliar pathogen of tomatoes in Manaus, Amazonas, Brazil. Parakhia et al. (1989) studied the new leaf spot disease of cotton caused by C. cassiicola. The disease usually appeared in September on plants 3-4 months old, the spots spreading rapidly under favourable weather conditions to form large necrotic patches on leaves and bolls. Lakshmanan et al. (1990) reported that boll rot of cotton caused by C. cassiicola, pathogenicity of this pathogen was tested on 14 other important crops and produced leaf spot and stem rot diseases on 8 and 6 host plants. Aloi and Garibaldi (1990) reported the presence of C. cassiicola on cucumber and description was given of a new fungal foliar disease of cucumber caused by C. cassiicola which is particularly severe in protected environments. Kusakari et al. (1991) observed the Corynespora leaf spot and decay of perilla (Perilla frutescens Britt.) caused by C. cassiicola.

24 Yu et al. (1991) reported a leaf spot of soybean caused by C. cassiicola, isolated C. cassiicola from red-brown spots on soybean leaves and proved to be pathogenic in inoculation tests. Holcomb and Fuller (1993) observed the leaf spots on Euphorbia pulcherrima plants, the causal organism was isolated and identified as C. cassiicola and its pathogenicity was confirmed. This is the first report of target spot of E. pulcherrima in Louisiana and the first report where the principal disease manifestation was leaf spots on immature plants rather than bract spots on more mature plants. Bala et al. (1993) reported the target spot disease of tomato, cucumber and cowpea in Trinidad caused by C. cassiicola. The pathogen, together with other established diseases contributes to severe necrosis and defoliation in tomato and cucumber crops. McGovern (1994) observed the numerous leaf spots and severe defoliation in Catharanthus roseus plants incited by C. cassiicola. Hyphae and conidia of C. cassiicola were detected in symptomatic leaf tissue and the fungus was consistently isolated from lesion margins on acidified PDA following disinfestation. Pathogenicity was confirmed and it was reisolated from symptomatic tissue. This is the first report of infection of C. roseus by C. cassiicola. McMillan and Graves (1995) reported Corynespora leaf spot of thyme in Florida for the first time, from a commercial shade house in Florida, USA. C. cassiicola was identified from the infected plants and this was thought to be the first report of C. cassiicola on thyme. Anonymous (2000) stated that Corynespora leaf spot disease of Hevea caused by C. cassiicola was first recorded in Malaysia in 1960, has frequently occurred since in rubber budwood nurseries. Oliveira et al. (2007) studied the pathogenicity of C. cassiicola isolates on different host plants. The isolates from cucumber showed the widest host range, infecting other hosts and isolates from Commelina benghalensis and lettuce showed the narrowest host range, since they infected their host of origin and only another host plant. Most of the isolates lacked host specificity. Pawpaw plant, which showed the greatest susceptibility to the C. cassiicola isolates, were colonized by 12 of the 15 isolates tested. In contrast, Vernonia sp. and Commelina benghalensis were susceptible to only two and three C. cassiicola isolates, respectively. Shimomoto et al. (2008) stated that C. cassiicola infect the sweet potato and sweet pepper. Pathogen was isolated from dark brown spots on leaves and fruits and from black blights on stems of sweet pepper plants in Kochi Prefecture, Japan. The isolated fungus was then used to inoculate sweet pepper plants and subsequently reisolated from the plants with dark brown spots and black blights, showing that C. cassiicola is a new pathogen causing Corynespora blight on sweet pepper plants. Furukawa et al. (2008) showed that the leaf spot disease of scarlet sage (Salvia splendens) was caused by C. cassiicola isolates of C. cassiicola from cucumber, green pepper, and hydrangea were also pathogenic to scarlet sage leaves. Although the isolates from cucumber, green pepper, and hydrangea were pathogenic to scarlet sage leaves, the scarlet sage isolate was not pathogenic to cucumber, green pepper, hydrangea, eggplant, tomato or soybean. 2.8 Screening of Hevea clones for resistance to Corynespora leaf fall disease Awoderu (1969) assessed the susceptibility of Hevea clones for Corynespora leaf fall disease at Rubber Research Instituteof Nigeria, Iyanomo, Nigeria. The clones NIG 800, NIG 801, NIG 802 and NIG 803 were reported to be susceptible for CLF disease. Gohet (1990) assessed the Corynespora leaf fall disease incidence on Hevea clones and severe occurrence was reported in the commercial cultivated clone PB 260, causing about 50 per cent defoliation.

25 Tan (1990) carried out genetic studies of disease resistance in Hevea to 3 leaf diseases (Colletotrichum gloeosporioides, C. cassiicola and Oidium Heveae) using 18 selected genotypes and 15 progenies from a 5-parent diallel cross. Colletotrichum and Corynespora resistance had moderate heritability estimates, whilst Oidium resistance had lower values. Reported that GCA effects were important in controlling resistance to all the 3 diseases and SCA effects were important in accounting for the variation in Corynespora and Oidium resistance. The relative magnitude of GCA over SCA was 37 (range: ) for Colletotrichum; 4.6 (range: ) for Corynespora and 2.0 (range: ) for Oidium resistance. Tan et al. (1992) reported that Corynespora leaf fall disease incidence was wide spread in different Hevea clones. The clone GT 1, PBIG, RRIM 605 and RRIM 701 are moderately infected and RRIM 600, RRIM 703 and RRIM 725 were severely infected. The clones like RRIM 937, RRIM 501 RRIM 905, RRIM 712, PB 86 and PB 213 were free from the disease infection. Kamar and Hidir (1996) carried out the detailed survey of Corynespora leaf fall disease in Malaysia and reported that the clone RRIM 901 increased in susceptibility from lightly infected in 1991 to moderately infected in The clones RRIM 703 and RRIM 725 which had been recorded as susceptible in 1991, was lightly infected in 1993 and the clones GT 1, PB IG and RRIM 701, which were moderately infected in 1991, were lightly infected in Clones PB 213, RRIM 628 and RRIM 937 remained free from disease infection. Garcia et al. (1995) illustrated that size and number of lesions, scopoletin accumulation, inoculation period, infection period, infection frequency, disease severity, stromatic generation period, deformation, development of fish bone symptom, development of mycelium on necrotic tissue and leaf fall are the main components to be considered for the assessment of Corynespora leaf fall disease resistance of Hevea clones. Situmorang et al. (1996) studied the variation in susceptibility of Hevea clones to Corynespora leaf fall disease with the emergence of new races of pathogen. They classified the clones screened into two groups, first group included RRIC 103, KRS 21, RRIM 725, PPN 2058, PPN 2444, PPN 2447, PR 263, PR 265, PR 266, LMS 3, FX 25 and RRIC 52 all are rated as susceptible before The second group included RRIM 600, BPM 24, GT 1, PB 260, RRIC 100, RRIC 110 and BPM 1 which are previously rated as resistant but attacked by a new race after They also opine that prevention of epidemic of C. cassiicola can also be achieved through genetic diversification by growing multiclonal or polyclonal rubber seedlings. Polyclonal seedlings can be developed by natural crossing between clones showing vertical or horizontal resistance. Jayasinghe and Silva (1996) reported the susceptibility of Hevea clones for Corynespora leaf fall disease in Sri Lanka, the clone RRIC 103, RRIC 104, RRIM 600, Tjir 1, RRIM 725, IAN 873 and Fx 25 are highly susceptible during initial disease epidemic. Later, RRIC 110, RRIC 131, RRIC 132 and RRIC 133 were also reported as susceptible although rated as resistant in the field. RRIC 100 was susceptible in polybag nurseries but show tolerance when transplanted in the field. Kamar and Hidir (1996) observed Corynespora leaf fall disease incidence on different Hevea clones, RRIM 600 was found severely infected and PB 217 was moderately infected, which were previously rated as resistant in the demarcated disease areas. Sinulingga et al. (1996) reported the susceptibility of Hevea clones for Corynespora leaf fall disease incidence, the trial clones RRIC 103, KRS 21and RRIM 725 were severely infected. The domestic clones like PPN 2658, PPN 2444, PPN 2447 and IAN 873 were reported to be highly prone to CLFD. Clone GT 1 and RRIM 600 were earlier categorized as resistant and planted on a large-scale. Wahounou et al. (1996) reported the occurrence of Corynespora leaf fall disease incidence on Hevea clones, IRCA clones, MDF 372, RRIC103, RRIC 110, PB 260, PB 28/59. IRCA clones were also found infected. Suwarto et al. (1996) studied the changes in the susceptibility of Hevea clones to Corynespora leaf fall disease, the clone GT 1 and RRIM 600 earlier rated as resistant became susceptible due to the new races developed.

26 Inoculation of eight isolates of C. cassiicola on three clones with different susceptibility (BPM 1 as resistant, GT 1 as moderate and RRIC 103 as susceptible) showed that resistance in GT 1 had been broken down by an isolate of C. cassiicola from South Sumatra, while all the three clones were very responsive to the other seven isolates. Rodesuchit and Kajornchaiyakul (1996) studied the reaction of host parasite relationship on Hevea clones to 24 isolates of C. cassiicola, in both laboratory and field trial. The clone KRS 21 and RRIC 52 were found to be most susceptible and clones RRIC 110, PB 311, KRS 232, GT 1, PR 261, KRS 233, RRIM 600, KRS 225, RRIC 121, KRS 218, BPM 24, KRS 214, KRS 205, PB 235 and PR 305 moderately susceptible. The clones RRIM 623, KRS 212, RRIM 703, KRS 226, PB 255, KRS 223, RRIM 712, PR 302, KRS 25, KRS 156, BPM 1, PB 217, RRIC 101, PR 255, KRS 210, PB 260, RRIM 717, PB 28/59 and RRIC 100 showed mild incidence or free from infection. On artificial inoculation of one-year- old budwood with a virulent isolate, the clones GT 1, RRIM 600, KRS 225, KRS 226, PR 305, KRS 25, KRS 223, RRIC 110 and PB 311 were very severely to moderately susceptible. Clones BPM 24, PB 255, KRS 218, PR 261, RRIM 623, KRS 156, RRIC 121, RRIM 703, PB 302, RRIC 100, RRIC 101, PB 235, RRIM 712, PB 217, PB 260, PB 28/59, PR 255, RRIM 717 and BPM 1 showed tolerance to CLF infection. Rajalakshmy and Kothandaraman (1996) reported the Corynespora leaf fall disease incidence on Hevea clones, initial out break of CLF disease was reported on RRIM 610, RRIM 622 which seedlings of Tjir 1 and RRIM 600 showed low disease incidence. Othman et al. (1996) reported allelic heterozygosity for Corynespora leaf fall disease resistance in Hevea. This was shown by crossed parentage of clones with light to severe infections. Most of the produced progenies have showed no infection to light infection in the selected clones of RRIM 901, RRIM 902, RRIM 903, RRIM 904, RRIM 908, RRIM 909, RRIM 915 and RRIM 937. But RRIM 600, which showed severe infection, parentage PB 86 (no infection) and GT 1 (light infection). Breton et al. (1997) studied the susceptibility of Hevea clones for Corynespora leaf fall disease in In-vitro by using conidial suspension and toxin. The clone PB 260 was highly susceptible and GT 1 showed resistance among the nine clones studied by using conidial suspension inoculation method. Similar results were reported by using the toxin for studying the susceptibility. The susceptibility of a clone seemed to depend on its ability to recognize and/or neutralize the toxin. It was also suggested that using the toxin for leaf applications can enable early classification of the R/S of clones in the field and antibodies could subsequently be used to establish the correlation between isolate virulence and toxin production. Jacob (1997) observed the Corynespora leaf fall disease incidence on Hevea clones, RRII 105 popular clone and widely planted in South India was found severely infected. He recorded the disease incidence in other clones in South India like, RRII 118, RRII 300, RRII 305, PR 107, PR 255, PR 261, PB 86, PB 235, PB 255, PB 260 and PB 311. Chee (1998) screened 91 Hevea clones and 47 Hevea germplasm materials to Corynespora leaf fall disease infection both in laboratory and field. Fifty clones and twentyfive germplasm materials were found free from infection and three clones and five germplasm materials were severely infected, remaining showed either light or moderate infections in laboratory test. In the field test, 67clones and 28 germplasm materials were found free from infection only two clones and four germplasm materials were severely infected. Sujatno and Suhendry (2000) studied the susceptibility of Hevea clones for Corynespora leaf fall disease, out of twenty Hevea clones of IRR 100 series observed in the field, ten showed slight infection. IRR 200 series also showed similar pattern and eight clones out of 20 in this series were slightly infected. Anonymous (2000) reported that Corynespora leaf spot disease caused by C. cassiicola was first recorded in Malaysia in 1960 and frequently occurred in rubber budwood nurseries on clones FX 25 and RRIC 52 at the Sungei Buloh experimental station. In the period upto 1975 defoliation was severe in a 5-year-old planting of RRIM 725 but other clones were unaffected. Moderate to severe infection was recorded in the clones RRIC 52, Nab 12, Nab 20, Lun N, RRIM 725, FB 3363, FX 25 and F 4506.

27 Dung and Hoan (2000) studied the Hevea clonal reactions to Corynespora leaf fall disease infection. The clone LH 88/372 RRIC 110, GV 1479, RRIC 103 and RRIC 104 were identified as highly susceptible and PB 235, RRIM 600, VM 515 and RRIC 110 were recorded light infection. Jean (2000) reported the susceptibility Hevea clones to Corynespora leaf fall disease, severe incidence on RRIC 103, mild infection was observed on other clones like RRIC 110, PB 260, PB 28/59 and some IRCA clones. Severe disease in RRIC 110 was observed in one location. In Gabon and Cameroon the disease was observed on the clone PB 260 causing 50 per cent defoliation. Some IRCA clones and MGF 372 were also attacked by CLF disease. Manju et al. (2001) reported the susceptibility and distribution of Corynespora leaf fall disease in South India, clone RRII 105 recorded higher susceptibility than other clones. While the clone PB 217, PB 235 and PB 260 showed moderate infection, the clone RRIM 600 and GT1 were observed to be less susceptible to CLF disease. Jayasinghe et al. (2005) mentioned the history of performance of outstanding clones cultivated across the world, classified the different Hevea clones based on their yield performance and disease tolerance. Ogbebor and Nicholas (2010) studied the susceptibility of Hevea brasiliensis clone for common leaf diseases in Nigeria. Colletotrichum leaf fall and Corynespora leaf fall were studied in six local clones (NIG 800, 801, 802, 803, 804, and 805) and three exotic clones (PR107, RRIM 707 and GT1). The clone RRIM 707 had highest disease incidence of Corynespora leaf fall and Bird s eye spot, while NIG 803 clone was severely affected by Colletotrichum leaf fall disease. 2.9 Disease management Evaluation of water-based fungicides in laboratory and field Ramakrishnan and Pillai (1961) recommended the fungicide spraying, Bordeaux mixture (1%) or Zineb (0.24%) two rounds at weekly interval for the control of Corynespora leaf spot disease in rubber nursery. Newsam (1963) developed disease control strategies for the control of Corynespora leaf spot of rubber depended mostly on nutrient management rather than fungicide spraying. Rajalakshimy et al. (1980) tested the water based fungicides for the control of Corynespora leaf spot of rubber in nursery, fortnightly application of carbendazim (0.1%) was recommended for effective disease control. Chee (1988) tested and recommended water based fungicides for the control of Corynespora leaf fall disease of rubber. The foliar application of water based fungicides such as chlorothalonil, thiademefon, tridemorph, mancozeb, orthocide and propineb are more effective in nursery. Gasparotto et al. (1988) reported the Corynespora leaf spot of rubber (H. brasiliensis) in Brazil and nursery infection was effectively controlled by spraying of fungicide benomyl at 0.075% a.i. Liyanage et al. (1989) stated that Corynespora leaf fall disease control by using fungicides was attempted in rubber plantations soon after the outbreak of CLF disease epidemic in Fungicides such as benomyl, mancozeb, orthocide and propineb were effective in disease control when sprayed regularly at close intervals of five days. However recurrence of disease was observed when fungicide application was stopped as the fungus was observed to infect leaves of all stages. Hashim et al. (1996) reported integrated disease management using both chemical and cultural methods including artificial defoliation and nutrient management for control of Corynespora leaf fall. A combination of benomyl (500 g/ha) and additional nitrogen manuring up to four times the normal dose improved leaf retention early in the disease season, there was no appreciable improvement in canopy retention. Artificial defoliation was also not effective for CLF disease control in rubber plantation.

28 Sinnulingga et al. (1996) reported that chemical control of Corynespora leaf fall disease in rubber plantation was advocated as a component of integrated pest management strategy. The fungicides recommended for disease control are carbendazim (0.2%), mancozeb (0.25%), carbendazim (0.2%) + mancozeb (0.2%), propineb (0.25), Chlorothalonil (0.2%) and captafol (0.95%). Jayasinghe (1997) stated that fungicide application for Corynespora leaf fall disease control in mature rubber plantation was not recommended as it was believed to be uneconomical. Jacob (1997) reported that two rounds of high volume spraying (2000 L/ha) with 0.2 per cent mancozeb, 0.05 per cent carbendazim or Bordeaux mixture (1%) at an interval of two to three weeks during refoliaiton period gave good control of Corynespora leaf fall in young rubber. Jayasinghe et al. (1999) evaluated twenty-three fungicides in the laboratory and in nursery against Corynespora leaf fall disease of rubber caused by C. cassiicola. Benomyl, mancozeb, propineb, thiophanate-methyl copperoxychloride (21%) + Mancozeb (20%), propineb (56%) + oxadixyl (10%) were observed to be effective when sprayed at six day intervals to polybag plants in the nursery. Sujatno and Suhendry (2000) reported that fogging of systemic fungicides like tridemorph was practiced in some rubber estates for control of Corynespora leaf fall disease. Spraying with mancozeb (500 g/ha) or chlorothalonil (500 g/ha) 4 to 6 rounds at weekly intervals was more effective and addition of tridemorph 75 EC (systemic fungicide) at the rate of 150 ml/ha to the contact fungicides was reported to improve the efficacy of disease control in rubber plantations. Chanurag (2000) studied water based fungicides for control of Corynespora leaf fall of rubber, two rounds of spraying at the immature stage of leaves with tridemorph (0.2%) or benomyl (0.3%) or prochloraz (0.2%) was recommended for disease control in bud wood nursery. Dung and Hoan (2000) reported that five rounds of foliar spraying with combination of benomyl (2.5%) + copper oxychloride (0.5%) was used as phytosanitary measure to kill the surviving fungal propagules of C. cassiicola in an infected area after removal of all the infected trees. Joseph and Manju (2002) evaluated different water based fungicides for the control of Corynespora leaf fall disease of rubber. Mancozeb (0.2%), carbendazim (0.5%) and a combination of metalaxyl + mancozeb (0.2%) were consistently found more effective in nurseries. Spraying of mancozeb at weekly intervals was recommended as it was the cheapest and effective fungicide available Evaluation of plant extracts Literature available on use of plant extracts for the control of Corynespora leaf fall disease of rubber caused by C. cassiicola is very meager, the information on use of plant extract control of c. cassiicola in other crops and other related pathogen is also given hereunder. Gupta et al. (1982) reported that conidial germination of C. capsici inhibited by Phytonoids of Allium cepa L., Allium sativum L., Azardiracta indica L., Ocimum basilicum L. and Leucas spp. Lakshmanan (1990) showed the antifungal activity of 10 plant extracts in in-vitro against C. cassiicola casual agent of cotton boll rot and reported that garlic and cloves extracts was the most effectively inhibiting mycelial growth by 95.8% and spore germination by 78.6%. Deraniyagala et al., 1998, reported that the leaf extract of Ficus racemosa inhibits the growth of several plant pathogens including C. cassiicola. Psoralon was identified as the active compound involved in inhibition process and it cab be potentially developed as a fungicide against plant pathogens.

29 Gomathi and Kannabiran (2000) screened aqueous leaf extracts of 23 wild plants against the anthracnose fungi, C. capsici and Gleosporium piperatum Ell. and E8 infecting Capsicum annuum L. The leaf extracts of Solanum tocum SW., Datura metel L. and Prosopis juliflora (SW.) DC were found effective in reducing conidial germination and mycelial growth of these fungi. Ogbebor and Adekunle (2005) evaluated twenty-one plants extracts for fungicidal effects on conidial germination and mycelial growth of Corynespora cassiicola. Out of these O. basilicum resulted the lowest mycelial growth at 100% extract concentration and disease index (D.I) of 43% which was significantly lower than the control 65% D.I at 5% level of probability. Garlic (60.13%), neem (57.14%) and eucalyptus oil (61.93%) were found most promising botanicals against C. truncatum, which showed higher inhibition of mycelial growth at 10 per cent concentration (Laxman, 2006) Evaluation of Bio agents Literature available on biological control of Corynespora leaf fall disease caused by C. cassiicola is very meager the information on biological control of other diseases of rubber is also given hereunder. Joseph et al (1991) showed that a soil actinomycete controlled the pink disease pathogen Corticium salmonicolor in rubber plants under laboratory as well as field conditions. Jacob et al (1991) isolated the three antagonistic fungi from soil which protected the rubber seedlings from the attack of the root pathogen Phellinus noxius and improved the plant growth. Kothandaraman et al (1991) reported that the rhizosphere of different Hevea clones harbours actinomycetes antagonistic to P. noxius. The fungal antagonist Trichoderma harzianum, T. hamatum and T. koningi were found to coil around the hyphae and penetrate the oospores of Phytophthora meadii and caused their lyses (Vanitha et al., 1994). The antagonistic principle released to the growth medium by Streptomyces lydicus is capable of inhibiting the growth of P. meadii under laboratory conditions (Joseph et al., 1994). Application of endophytic P. fluorescence (ENPE 2) through seedling dip and foliar application effectively reduced stem blight disease incidence in Phyllanthus amarus caused by C. cassicola and increase the dry matter production under pot culture and field condition. Application of endophyte also increased the defence related enzymes such as peroxidase, polyphenol oxidase, chitinase and β-1,3 glucanase in the plants upto 10 days after challenge inoculation with C. cassicola (Mathiyazhagam et al., 2004). Mushrif et al (2005) isolated five bacterial antagonists (two Bacillus spp. and three Pseudomonas spp.) isolated from the rhizosphere and phyllosphere of Hevea plants, which were antagonistic to Phytophthora and were compatible with fungicides carbendazim, mancozeb and metalaxyl MZ. Bacillus spp. showed higher efficacy in disease control when tested under laboratory and field conditions. Philip et al (2005) isolated endophytic bacteria from roots, stem, petiole, leaves, flowers etc of rubber plants and the selected isolates showed systemic resistance on challenge inoculation with C. cassiicola under glasshouse condition. Reginaldo et al (2010) reported that the numbers of lesions produced by the C. cassiicola on leaflets exposed to the bacterial supernatant were similar to those exposed to acibenzolar-s-methyl but fewer than in those treated with water and it is concluded that the supernatant contained protein which induced resistance in the tomato leaves against C. cassiicola.

30 3. MATERIAL AND METHODS The present investigations were carried out in the laboratory and field consecutively for three years during to All the field and part of laboratory experiments were conducted at the Rubber Research Institute of India, Hevea Breeding Sub-Station, Nettana, Dakshina Kannada, Karnataka, while part of laboratory experiments were undertaken at Plant Pathology Division, Rubber Research Institute of India, Kerala. Hevea Breeding Sub-Station, Nettana is situated in coastal region (Region V) of the major agro climatic regions of Karnataka at North latitude and ' East longitude and at an altitude of 120 m above mean sea level. This zone receives a well distributed rainfall ranging from 3000 to 5000 mm per annum, the mean daily minimum temperature varies from 12 0 C to 25 0 C and maximum temperature ranges from 21 0 C to 43 0 C. Southwest monsoon contributes the major part of the rain fall with July as the wettest month. The relative humidity on an average varies between 70 and 95 per cent. The materials used and methods followed in conducting the experiments are described in this chapter. 3.1 General laboratory procedures Glasswares cleaning For all laboratory experimental studies, Corning and Borosil glasswares were used. Wherever required, they were kept in the cleaning solution containing 60 g potassium dichromate (K 2 Cr 2 O 7 ) and 60 ml of concentrated sulphuric acid (H 2 SO 4 ) in one litre of water for a day. Then, they were cleaned by washing with detergent followed by rinsing several times in tap water and finally in distilled water Sterilization All glassware s, solid and liquid media were subjected to sterilization by autoclaving at 1.1 kg per cm 2 (121 0 C) for 20 minutes. The plant tissues were surface sterilized in 1:1000 mercuric chloride solution followed by three changes in sterile water. All cultural studies were conducted in aseptic condition under laminar flow. The tips of inoculation needle, forceps and cork borers were sterilized under flame. 3.2 Survey and surveillance for Corynespora leaf fall disease severity Roving method of survey was conducted consecutively for three disease season during 2007, 2008 and 2009 in eight major rubber growing regions of Karnataka spread over three districts such as Dkashina Kannada, Udupi and Coorg. Six rubber growing region in North Malabar of Kerala are included in the roving survey. The details of the places selected for the survey and number of plantations (sites) inspected are mentioned below. The plantation units, distributed over the selected locations were visited for disease assessment during peak disease period (March to April). For each selected unit, visual disease assessment was made for 25 plants.

31 Details of Locations included for Corynespora leaf fall disease survey in Karnataka and North Malabar region of Kerala Sl No. Karnataka Locations Number of plantations inspected Kerala 1 Thirthahalli Sagar Kundapur Belthangady Puttur Sullia Madikeri Subramanya Kasaragod Kanhangad Nileshwar Taliparamba Sreekantapuram Thalassery The Corynespora leaf fall disease severity was recorded by following 0 5 scale based on intensity of leaf spotting, lesions and leaf fall. Scale Category Description 0 No symptoms on leaves 1 Upto 5 spot on the leaves 2 6 to 10 spots on the leaves and 10 to 25% leaf fall 3 > 10 spots on the leaves and >25 to 50% leaf fall 4 Large leaf lesions and >50 to 75% leaf fall 5 Large leaf lesions and > 75% leaf fall Further, these scales were converted to per cent disease index (PDI) using the formula given by Wheeler (1969). PDI = Sum of individual disease ratings No. of observations assessed x 100 Maximum disease rating

32 Fig. 1 : Location included for Corynespora leaf fall disease survey in Karnataka and North Malabar region of Kerala

33 3.3 Collection of diseased specimens, isolation and maintenance of culture During the field survey carried out in 2009, a large number of Corynespora infected rubber leaf samples were collected from different places. Standard tissue isolation procedure was followed to isolate the causal fungal pathogen. The infected tissues of the leaves were cut into small bits of 1 to 2 mm size and surface sterilized in 1:1000 mercuric chloride (HgCl 2 ) solution for one minute and washed repeatedly twice in sterile distilled water to remove the traces of mercuric chloride before transferring them to sterile potato dextrose agar (PDA) slants under aseptic conditions. The slants were incubated at a temperature of C and observed for fungal growth. Further, the pure culture of the fungus was obtained by single spore isolation method Single spore isolation Ten ml of clear, filtered two per cent water agar was poured into sterile petriplates and allowed to solidify. Dilute spore suspension was prepared in sterilized distilled water from 15 days old culture. One ml of such suspension was spread uniformly on agar plate. These plates were incubated at C for 12 hr. Then such plates were examined under microscope to locate single isolated and germinated conidium and marked with ink on the surface of the plates. The growing hyphal tip portion was transferred to PDA slants with the help of cork borer under aseptic conditions and incubated at C. These culture tubes were used for further studies Maintenance of the cultures The fungus was sub-cultured on potato dextrose agar (PDA) slants and allowed to grow at C for 12 days, such slants were preserved in refrigerator at 5 0 C and maintained. Sub-culturing was done once in a month, such cultures were used throughout the study. 3.4 Cultural and physiological studies of Corynespora cassiicola Cultural studies Growth phase of C. cassiicola on liquid media Thirty ml of potato dextrose broth (PDB) was added into each of 150 ml conical flasks and sterilized. The flasks were then inoculated with 5 mm disc of Corynespora cassiicola from actively growing culture and incubated at C. The growth of the fungus was studied at 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 days of inoculation. Each treatment was replicated three times. Three flasks were harvested separately at a time, starting from the third day onwards up to 19 th day by leaving a gap of 48 h between the two successive harvests. The cultures were filtered through previously weighed Whatman No. 42 filter paper of 12.5 cm diameter, which were dried to constant weight at 60 0 C in an electric oven prior to filtration. The mycelial mat on the filter paper was thoroughly washed with sterile distilled water to get rid of the salts likely to be associated with the mycelial mass. The filter paper along with the mycelial mat were dried to constant weight at 60 0 C for 48 h, cooled in a desiccator and weighed immediately on an analytical balance. The difference between final and initial weight of filter paper were taken as the weight of the mycelia. The data were analysed statistically Growth of C. cassiicola on different solid media The cultural characters of the Corynespora cassiicola were studied on the following nine different solid media and the best media for the growth of fungus was identified.

34 Solid media used in the study 1. Potato dextrose agar 2. Oat meal agar 3. Czapek s agar 4. Malt extract agar 5. Sabouraud s agar 6. Yeast extract agar 7. Richard s agar 8. Potato carrot agar 9. Corn meal agar The composition and preparation of the above mentioned synthetic and non-synthetic media were obtained from Ainsworth and Bisby s Dictionary of the fungi (Hawksworth et al., 1983). The composition of the media is given below. 1) Potato dextrose agar (PDA) In most of the experimental studies, the potato dextrose agar (PDA) was used. The composition of PDA is as follows. Potato peeled Dextrose Agar-agar Distilled water 200 g 20 g 20 g 1000 ml (volume to make up) Two hundred gram of peeled potato was cut into small bits and boiled in distilled water and the extract was collected by filtering through muslin cloth. Dextrose 20.0 g and agar 20.0 g each were dissolved in the potato extract and the final volume was made upto 1000 ml with distilled water and sterilized as described earlier and preserved for further use. 2) Oat meal agar (OMA) Oat flakes Agar-agar Distilled water 30 g 20 g 1000 ml (volume to make up) Oat flakes were boiled in 500 ml distilled water for 30 min and filtered through muslin cloth. Agar was melted in 500 ml distilled water separately. Both the solutions were mixed thoroughly and the volume was made upto 1000 ml and was sterilized. 3) Czapek s agar Sucrose (C 6 H 12 O 6 ) Sodium nitrate (NaNO 3 ) Potassium dihydrogen phosphate (K 2 PO 4 ) Magnesium sulphate (MgSO 4-2H 2 O) Potassium chloride (KCl) Ferric chloride Agar-agar Distilled water 20 g 0.01 g 30 g 1.0 g 0.5 g 0.5 g 20 g 1000 ml (volume to make up)

35 Agar-agar was melted in 500 ml distilled water. Two solutions were mixed thoroughly and the volume was made upto 1000 ml and was sterilized. 4) Malt extract agar Malt extract Agar-agar Distilled water 20 g 20 g 1000 ml (volume to make up) All the ingredients were dissolved in 400 ml distilled water and agar was dissolved separately in 500 ml of distilled water and mixed with the above solution and the volume was made upto one litre. The medium was sterilized at 1.1 kg per cm 2 pressure for 15 minutes. 5) Sabouraud s agar Dextrose Peptone Agar-agar Distilled water 40 g 10 g 20 g 1000 ml (volume to make up) All the ingredients were dissolved one by one in 400 ml distilled water and agar was dissolved separately in 500 ml distilled water and mixed with the above solution and the volume was made upto one litre before sterilization. 6) Yeast extract agar Yeast extract Agar-agar Distilled water 20 g 20 g 1000 ml (volume to make up) Twenty gram of yeast extract was dissolved in 400 ml distilled water and in other 400 ml distilled water dissolved 20 gram agar-agar and both the solutions were mixed together. The volume was made upto 1000 ml and then subjected for sterilization. 7) Richard s agar Sucrose Potassium dihydrogen phosphate Potassium nitrate Magnesium sulphate Ferric chloride Agar agar Distilled water 0.02 g 50 g 5 g 10 g 2.5 g 20 g 1000 ml (volume to make up) All the above ingredients, except potassium dihydrogen phosphate and agar were dissolved in 450 ml of distilled water. Agar was melted separately in 500 ml of distilled water and was mixed with the above solution. The volume was made upto 950 ml. Potassium dihydrogen phosphate was dissolved in 50 ml of distilled water. The two solutions were autoclaved and subsequently mixed together. 8) Potato carrot agar Grated potato Grated carrot Agar agar Distilled water 20 g 20 g 20 g 1000 ml (volume to make up) Boiled grated vegetables for 1 hr. in the tap water. Strained through fine sieve, added agar. Boiled over water bath till agar dissolved and sterilize.

36 9) Corn meal agar Corn flakes Agar agar Distilled water 60 g 20 g 1000 ml (volume to make up) Sixty grams of dehydrated corn flakes were boiled for 15 min in 500 ml of distilled water and filtered. Twenty g of agar was melted separately and both the solutions were mixed. The volume was made upto 1000 ml. Twenty ml of each medium listed above was poured into 90 mm diameter Petri plates. After solidification, 5 mm discs of C. cassiicola from periphery of actively growing culture were cut using a cork borer and a single disc was placed upside down at the centre of Petri dish. Each set of experiment was replicated thrice and the plates were incubated at C. The measurements of the colony diameter were taken when the maximum growth was attained in any one of the media tested. Then cultural characters such as colony diameter, colony colour, type of margin and sporulation were also recorded. The sporulation was graded as follows. Sporulation grade Sl. No. Score Grade Description (conidia/ microscopic field (100 X) Excellent > Good 11 to Fair Poor No sporulation Growth of C. cassiicola on different liquid media The composition and preparation of different liquid media used were the same as that of solid media except that agar was not added. Twenty ml of different liquid media were added into each of 100 ml conical flasks. These flasks were then sterilized at 1.1 kg per cm 2 pressure for 20 min. The flasks were inoculated with 5 mm mycelial discs obtained from periphery of 10 days old culture and incubated at C for 15 days. Each treatment was replicated thrice. Dry mycelial weight and sporulation (under high power) in each treatment were recorded as described earlier Physiological studies Effect of temperature on the growth and sporulation of C. cassiicola The growth of C. cassiicola was tested at 10, 15, 20, 25, 30, 35 and 40 0 C. Potato dextrose agar was poured into 90 mm diameter Petriplates. After solidification, 5 mm disc from actively growing cultures were cut and inoculated to solidified Petriplates and incubated for 15 days in the incubators adjusted to required temperature levels. Each treatment was replicated thrice. After incubation period, radial growth and sporulation from solid media were recorded as described earlier.

37 Effect of relative humidity (RH) on growth and sporulation of C. cassiicola Five mm discs of ten day old culture of C. cassiicola were placed at the centre of petridish containing PDA media under aseptic condition and petridish were exposed to 50, 60, 70, 80, 90 and 100 per cent relative humidity levels maintained in desicators. Different levels of relative humidity were created by using different concentration solutions of H 2 SO 4. The desicators were kept at C with four replications. Observations of colony diameter and sporulation were recorded 13 days after incubation Effect of different ph on growth and sporulation of C. cassiicola Corynespora cassiicola was grown on 30 ml potato dextrose broth with selected ph range of 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, and 8.5. The ph levels were adjusted by adding 1 N alkali (NaOH) or acid (HCl). A seven day old five mm mycelial disc from actively growing culture was inoculated separately into conical flasks containing 30 ml medium at different ph levels. Three replications were maintained for each ph level. These flasks were incubated at C for 10 days. The mycelial growth was harvested and dried in hot air oven and the dry weights were recorded by using electronic digital balance and sporulation was recorded as described earlier Effect of light intensities on growth and sporulation of C. cassiicola The effect of light intensities on the growth and sporulation of C. cassiicola was studied by exposing the culture to following treatments. 1) Alternate period of 12 h light under day light tubes and 12 h darkness. 2) Continuous light under day light tubes. 3) Continuous darkness. Twenty one petridishes were prepared with 20 ml of potato dextrose agar medium in each. The petridishes were inoculated aseptically with 5 mm mycelial disc from ten days old culture. Seven replications were maintained for each treatment. The petridishes of each treatment were exposed to alternate period of 12 h light under day light tubes and 12 hr of darkness, continuous light under day light tubes and continuous darkness for eight days. Observations on fungal growth and sporulation were recorded. 3.6 Genetic variability of C. cassiicola Pathogen isolation and genomic DNA extraction Leaves of Hevea brasiliensis showing typical symptoms of C. cassiicola were collected from different location during the disease survey. Isolation of pathogen and maintaining the single spore culture was done as explained in 3.3, and Total DNA was extracted from the cultures grown on potato dextrose broth for 3 to 4 days at 28 0 C. The mycelium was harvested by filtering through a plastic sieve. About 2g of mycelium was harvested from each isolate for DNA isolation. The mycelium was further washed thrice with double distilled water, dried and powdered with liquid nitrogen. The total genomic DNA was extracted by modified CTAB method (Doyle and Doyle, 1990). The re-extraction of the sample with the chloroform isoamyl alcohol (24:1) was repeated thrice in order to remove polysaccharides. Purity of DNA was estimated spectrophotometrically. Diluted DNA was stored at 4 O c for assays. ERIC PCR protocol was carried out as described by Louws et al., (1994) using the primers ERIC IR (5 ATGGTAAGCTCCTGGGGATTCAC -3 ) (synthesized by Sigma Genosis, UK). The reaction mixture contained 50 ng of template genomic DNA, 2.5 mm of each dntps, 2.5 mmtaq DNA polymerase and 1 mg/ml Bovine Serum Albumin (Sigma) and 50 pmol each of the primers. Amplification were performed with a DNA thermal cycler with the following temperature profile: 1 cycle at 95 0 C for 7 minutes for denaturing 30 cycles at 94 0 C for two minutes, 52 0 C for one minutes and 65 0 C for eight minutes for annealing followed by extension with two cycles at 65 0 C for fifteen minutes. In order to ensure reproducibility, all PCR reactions were conducted in triplicate for each isolate.

38 ERIC PCR products were separated by electrophoresis on 1.5% agarose gels in 0.5 XTBE buffer (2 mm EDTA, 0.1 M tris HCl, 0.1 M Boric acid ph 8.0). The stained gels were visualized along with a size marker on all gels. Amplification products were scored on the basis of their presence or absence of the band. A dendrogram was prepared using Quality 1 programme. 3.7 Epidemiological studies Aerobiology Aerobiological studies were carried out to trap the conidia of C. cassiicola present in the air current during 2007, 2008 and For this, Burkard seven day recording volumetric spore trap was installed in infected rubber plantation of Hevea Breeding Sub-Station, Nettana, Karnataka (Plate 8). Spore sampler was kept on the spore trap stand at a height of mid canopy level to sample the airborne fungal spores. The flow rate of the sampler was checked every 3 months by using a specially adapted flow meter provided by the manufacturer and was found to be stable Sampling Period of Sampling The study period covered the years 2007, 2008 and The data were extracted for the months January to December representing the 3 different seasons of winter, summer and rainy season. These seasonal months were chosen to achieve one of the aims of this research which was to investigate the spore dispersal pattern Preparing the Drum Airborne spores were impacted on to a rotating drum driven by clockwork, in the trap. The drum carried on its outer rim a strip of clear plastic film (Melinex) which, once coated with Vaseline wax (Appendix I), acted as a trapping surface. The drum was prepared in the following manner. It was first mounted on a bracket with a roller assembly and the rim of the drum was cleaned thoroughly with a dry tissue. The Melinex was held in place by a strip of double-sided sticky tape, placed across the rim of the drum at a distance of 1 cm, which is first attached to the drum between two marks already present Once the tape was securely attached, the Melinex was placed around the drum so that the ends of the Melinex were held in place by the sticky strip. Ensuring that the sticky strip, and hence the Melinex, were correctly aligned to the marks on the drum meant that the Melinex tape was lined up with the sampling orifice of the trap at the start of the week s sampling Once the clear Melinex was on the drum it was coated with liquid Vaseline wax, heated until it melted prior to application. It was then applied to the Melinex tape with an artist's flat brush by rotating the drum while holding the brush to the surface of the Melinex. Care was taken to ensure that the entire tape was uniformly covered with as thin a layer of adhesive as possible, by smoothing the applied Vaseline wax with a flexible wallpaper metal strip, cut to the width of the drum. The drum was rotated, with the metal strip pressed against it, to remove excess wax, until the wax cooled and set in a thin even layer. The drum was also warmed before being coated in order to promote a more uniform and even finish of the coating material. After coating, the prepared drum was immediately placed into a clean container, holding it from the screw side so as to avoid any contamination by finger grease or from the work surface (Plate 9) Changing the Drum in the Trap The drums carrying the trapping trace were changed at 11:00 hrs every Monday. In summer, the time was measured as Indian Summer Time. For loading a new drum in the trap, at the start of the sampling period, the drum running before was taken out. For this, first a mark was made at the end of sampling on that drum by inserting a dissecting needle into the orifice at the front of the trap and making a horizontal mark on the Vaseline layer and the tape by running the needle along the top of the orifice. The clock and the drum assembly were then taken out of the spore trap by swinging out the locking bar on the top of the trap. The locking nut present on the lid assembly was unscrewed and kept aside. The existing drum was then removed and placed in a clean, airtight, container. The clock was wound to set it running for the week.

39 The prepared (new) drum was then taken out of the container and placed over the clock mechanism of the sampler in such a way that the red mark on the drum was in line with the pointer on the lid assembly. This ensured that the start of the Melinex tape was in line with the orifice of the trap. The locking nut was tightened to secure the drum in place, and the lid assembly was placed back into the trap. The start of sampling was marked in the same way as it was made at the end as described above Mounting the tape from the drum and preparing the slides The exposed tape was removed from the drum with the help of a dissecting needle by peeling the starting end of the Melinex tape and lifting it from the drum along with the doublesided sticky tape ensuring that the orientation of the tape was correct. The tape was placed on a cutting block/perspex template, the start of the tape was positioned at the start of the Perspex block aligning the mark at the start of the tape at the edge of the first segment The template was marked off in daily intervals by slight grooves. The end mark on the tape should align with the last edge on the seventh day of the cutting block. Using a thin pair of scissors, the tape was cut along the grooves on the template into 48 mm or 24 hour long segments. Care was taken to make cuts as straight as possible. The microscope slides to be prepared were made ready before mounting the tape from the drum by writing the start date and time of each daily section of Melinex tape and the location of the sampler on to a sticky label, which was attached to one end of the slide. A drop of distilled water was laid over the centre of the slide with the help of a small pipette. This worked as an adhesive to hold the tape on the slide. The exposed segment of tape was then gently placed onto the slide with distilled water in such a way that the Vaseline coated surface, with trapped airborne materials, was uppermost. This was done using fine pointed forceps, taking care not to get air bubbles under the tape. Once in place, the tape could be readjusted to make sure it was mounted perfectly straight, so that the long edges of the tape were parallel with the long edges of the slide, otherwise this would lead to errors in identifying the times of spore and pollen capture. The starting ends of the tape sections were consistently placed at the labelled end of the slide. Mounting of the coverslip was done by using a permanent mountant, Gelvatol (Appendix II). A bead of 5 7 drops of Gelvatol at room temperature was laid down the centre of a 50 x 22 mm cover slip, which was then gently inverted onto the exposed tape. The weight of the coverslip spreads the mountant evenly. Applying pressure to the coverslip was avoided as this could move the particles trapped underneath and make the results unreliable. The prepared slides were allowed to dry for one week at room temperature. No stain was used on the slides, as this can obscure the identifying features of spores and pollens. Also, natural colour is one of the identifying characteristics for the identification of spores and pollens. The first slide made from the first segment of the 7-day trace started at the starting time of the drum change each week, and the trace ended exactly after 7 x 24 hours (Plate 9) Microscopy A research grade compound light (binocular) microscope (Ortholux Germany, Leitz Wetzlar) with a stage Vernier scale was used for the analysis of spores. As is standard in most aerobiological studies, a magnification of 400x was used for counting and identifying spores. A stage micrometer and an eyepiece micrometer (graticule), calibrated with the stage micrometer, was used for counting the fungal spore. Initially, the field view of the microscope at each magnification was determined using a stage micrometer and eyepiece graticule containing a grid of squares (Plate Fig. 3.9). Precautions were taken while counting one part of the stage micrometer, especially at high magnification, to ensure that the spores were counted consistently from the starting edge of the marked line to the starting edge of the next one Identification of Spores Spores were visually (microscopically) identified on the basis of their morphological features. The task of visual identification is not simple though, due to lack of an all- inclusive source of information that can be used. The visual identification of spores was based on colour, shape, size, number of cellular partitions, presence or absence of germ pores and types of septations.

40 3.7.7 Counting Technique for counting fugal spores The standard counting convention used by The British Aerobiology Federation (Anonymous, 1994) using twelve bi-hourly transverse traverses has been used for counting the spores. This method is sufficient to estimate the daily mean concentration of fungal spores at a magnification of 400x. Counting is done by the following method. To begin with, the position of the edge of the Melinex strip (the beginning corner is noted using the vernier scales on the microscope s mechanical stage. This corresponds to the start time of sampling for the day. The first traverse (on the slide/tape) can be made by moving the tape 3 mm for the first segment (which corresponded to Mondays, when the trace begins) and 2 mm for rest of the segments from the starting point owing to the nature of the deposit of the spores and pollens on the trapping surface, starting from the first moment of trapping. By definition, the width of the traverse equals the width of the eyepiece graticule, irrespective of the magnification. In the microscope used for the study, the width of the traverse was 300 µm. As one 24 hour tape section is equal to 48 mm (Fig. 3.10), a distance of 4 mm on the slide corresponds to 2 hours (Plate 10). With this convention, 12 traverses were made on the slide, each one being 4 mm (= 2 hours) apart. The traverses were made on the slides so that they correspond to 00:00, 02:00, 04:00, 06:00 hrs and so on till 22:00 hrs. This is possible as the end of a section tape continues with the start of the next one. The spores included in these traverses are identified and counted. Counting conventions regarding master (leading) and slave (trailing) edges of the graticule in the field of view have been followed as per BAF standard protocols. The master edge is the beginning line at the one side of the traverse and the slave edge is the ending line at the other. The spores counted were converted into concentrations as numbers/m3/24 hr by applying a correction factor calculated following British Aerobiology Federation Protocols (BAF, 1994). The method of conversion is given in Appendix V Weather Data There was a continuous monitoring of weather factors, such as rainfall, maximum and minimum temperature and relative humidity in the study location. Values of rainfall, relative humidity, mean minimum and maximum temperature have been used extensively in this research. The information obtained from these observations were studied in relation to weather factors viz., minimum and maximum temperature, rainfall and relative humidity (morning and evening) prevailed during the crop period by following standard statistical methods. The multiple regression equation was developed for estimation of spore load and PDI by taking weather parameters as input variables Data Analyses Correlation Tests Karl Pearson s Correlation Coefficient test is based on the rank or the order of the variables, in this case spores and the weather factors. The individuals in the samples are arranged in the order of merit (magnitudes) and ranks are assigned to them accordingly. If the rank assigned to the individuals range from 1 to N, then the correlation coefficient between the two series of ranks, called the Rank correlation coefficient,? or rs, is given by the formula: Where, r = x and y are two variables x y r : Mean of x : Mean of y n (x i x) (y i y) i = 1 n (xi x) 2 n (yi y) 2 i = 1 i = 1 : Karl Pearson s correlation coefficient

41 3. 8 Survival of Corynespora cassiicola Survival on infected leaf litters The present investigation on survival of Corynespora cassiicola was undertaken during at Hevea Breeding Sub-Station, Nettana, Karnataka to obtain information about the perpetuation of pathogen during the off-season. The Corynespora leaf fall disease infected fallen leaves of rubber were collected and stored in the nylon basket under field condition. The viability of the pathogen was studied by isolating the pathogen regularly for every alternate day Seasonal variation on survival of pathogen in infected leaves intact with plants Study on seasonal variation on survival and severity of C. cassiicola on infected rubber tress was undertaken for a period of 12 months. Periodic observations on disease progress were recorded from the demarcated plants at fortnightly interval. From the each selected plant, five leaflets from randomly selected four twigs were scored for the disease symptoms and intensity. Severity of the disease assessed on a 0 to 5 scale based on the intensity of spotting, leaf deformation and leaf fall. In addition to disease assessment isolated the pathogen regularly from the infected leaves intact with the plants Survival in infected dried twigs The Corynespora leaf fall disease infected twigs of rubber plants were collected from the field. The collected twigs were sectioned using microtome carefully as well as teased and observed under the microscope for the presence of the pathogen C. cassiicola in dormant or inactive stage. The viability of the pathogen was studied by isolating the pathogen by plating dormant mycelia on PDA plates Host range studies The objective of this study was to identify the collateral hosts of C. cassiicola other than rubber. Different plants showing the similar symptoms of Corynespora leaf fall disease were collected in and around the infected rubber plantations and isolated the pathogen. C. cassiicola was identified by using morphological character like spore, septation and spore colour. C. cassiicola positive culture/conidial suspension were cross inoculated to health rubber and then to respective host plant. Observations for infection were then recorded to know the cross inoculable nature of the pathogen. Different host used for host range and cross inoculation studies Sl. No. Common name Botanical name 1. Clerodendron Clerodendran infortunatum 2. Soybean Glycine max 3. Mango Mangefera indica 4. Cashew Anacardium occidentale 5. Papaya Carica papaya 6. Ficus Ficus benjamina 7. Geranium Geranium maculatum 8. Hydrangea Hydrangea macrophylla

42 3.9 Screening of Hevea clones for Corynespora cassiicola resistance Experiments were carried out at Hevea Breeding Sub-Station, Rubber Research Institute of India, Nettana, Dakshina Kannada district of Karnataka. Hevea clones were screened for Corynespora leaf fall disease resistance in nursery and in field by exposing Hevea clones to natural infection for three consecutive years. Ten plants were selected in bud wood nursery for each clone and demarcated for the disease assessment. Ten plants per clone in field were also selected separately for the disease assessment. Severity of the disease was recorded during the peak disease period on the demarcated plants. Calculated the per cent disease intensity (PDI) by using disease assessment frequency score by using formula as mentioned in 3.2. The clone categorization was done based on PDI. Genotypes Hevea clones Category PDI Reactions 0 0 Immune 1 5 Resistant 2 > 5 10 Moderately resistant 3 >10 25 Moderately susceptible 4 >25 50 Susceptible 5 > 50 Highly susceptible Data were subjected to statistical analysis to partition the component of variation to clone, year, clone x year factors. Spearman rank correlation was estimated in the ranks of the data value to see the whether response pattern of clones within each year is constant. Further, data was subjected to cluster analysis following average linkage method using squared Euclidean distance Disease management In vitro evaluation of fungicides against Corynespora cassiicola Thirteen water-based fungicides were tested against C. cassiicola on the potato dextrose agar media using poison food technique under in vitro condition. The fungicides were tried at 25, 50, 75, 250 and 500 ppm concentrations. The list of fungicides used along with their chemical and trade names are given below.

43 Fungicides tested against C. cassiicola Sl. No. Common Name Chemical Name Trade Name 1. Carbendazim Methyl 2 benzimidazole carbamate Bavistin 50 WP 2. Hexaconazole RS-2-(2, 4-D)-1-(1H-1, 2, 4 trizole-1-yl) hezan 2-ol Contaf 5% EC 3. Tridemorph 2,6-dimethyl-4-tridecylmorpholine Calixin 75%EC 4. Metalaxyl MZ (Metalaxyl 8% + Mancozeb 64%) Methyl N- (2-methoxyacetyle)-N (methoxyacetly) Dl- elaminate & 1,2ethanediyl bis (carbamodithioato) 2-zinc Ridomil MZ 72 WP 5. Phosphorus acid Tris-o-ethylphophonate Phose Jet 6. Mancozeb Manganese ethylene bis dithiocarbonate plus zinc Indofil M WP 7. Copper oxychloride Copper oxychloride Fytolon 50 WP 8. Thiram Tetramethylthioperoxyficarbonic diamide Thiram 75 WP 9. Carbendazim 12% + Mancozeb 63% Methyl 1H-benzimidazole-2yl- carbomate + manganesethyl lene bis dithiocarbmate plus zinc Saaf 75 WP 10. Difenconazole Cis, trans-3-chloro-4(4-methyl-2-(1h-1, 2, 4- traizole-1-y1, methyl)-1, 3-dioxolan-2-y1) phenyl 4-chlorophenyl ether Score 25 EC 11. Hexaconazole + Captan (R-S)-2 (2,4 dichlorophenyl)-1-(h-1,2,4- triazol-1-y1)hexan-2-01 Contaf + captan 12. Iprodian 3-(3,5-dichlorophenyl)-N-(-1methylephynyl) 2-4- dioxo-1-imodozolidine) 13. Propiconazole 1-(2-(2, 4-D)-4-propyl-1,3 diozolan- 2yl methyl) IH-1, 2, 4 triazole Rovrol 50 WP Tilt 25% EC Poison food technique The poison food technique (Shravelle, 1961) was followed to evaluate the efficacy of fungicides in inhibiting the mycelial growth of C. cassiicola. The fungus was grown on PDA medium for eight days prior to setting up the experiment. The fungicidal suspension was added to the melten media to obtain the required concentrations. About 20 ml of poisoned medium was poured in each sterilized petriplates. Suitable check was maintained without addition of fungicides. Five mm mycelial disc taken from the periphery of eight days old colony was placed in the centre of petriplate and incubated at C for 15 days. Three replications were maintained for each treatment. The diameter of the colony was measured when maximum growth in control plates occurred. The per cent inhibition was calculated by using the formula of Vincent (1947).

44 Where, I C T (C T) I = 100 C : Per cent inhibition : Mycelial growth in control : Mycelial growth in treatment In vitro evaluation of botanicals The present investigation was carried out to evaluate the extracts of different plant species to know the possible presence of fungi toxicant properties against C. cassiicola Preparation of plant extracts Fifty grams of fresh healthy plant parts (leaves/root/bulbs) collected from field were washed with distilled water and air-dried and crushed in 50 ml of sterile water. The crushed product was filtered through muslin cloth and collected the filtrate. The prepared solution gave 100 per cent, which was further diluted to required concentrations of 5.0, 7.5 and 10.0 per cent. The extracts were tested against C. cassiicola on the cultural media using poison food technique under in vitro condition. Details of the botanicals and part used are given below. Botanicals Sl. No. Plant (common name) Scientific name Plant part used 1. Neem Azadirachta indica Seed kernel 2. Datura Datura stramonikora Leaves 3. Onion Allium cepa Bulb 4. Garlic Allium sativum Bulb 5. Ginger Zingiber officinale Rhizome In vitro evaluation of bioagents Antagonistic microorganisms like Bacillus subtilis, Pseudomonas fluorescens, Trichoderma harzianum, and T. viride were evaluated for their antagonistic properties against C. cassiicola by dual culture technique Dual culture test Bioagents were evaluated for their efficacy through dual culture technique. The bioagents and the test fungus were inoculated side by side on a single petridish containing solidified PDA medium. Three replications were maintained for each treatment with one control by maintaining only pathogen and bioagent separately. Inoculated plates were incubated at C for eight days. The diameter of the colony of both bioagents and the pathogen was measured in two directions and average was recorded. Per cent inhibition of growth of the test fungus was calculated by using the formula of Vincent (1947) Statistical analysis and interpretation The data obtained from the laboratory and field experiments were statistically analyzed by following the standard procedures (Panse and Sukhatme, 1967). The percentage values were converted to arcsine values wherever required.

45 4. EXPERIMENTAL RESULTS The para rubber (Hevea brasitiensis Muell. Arg.) plants affected by several leaf diseases in different stages of its growth in nursery, immature and mature plantations. Among them the Corynespora Leaf Fall (CLF) disease caused by C. cassiicola is one of the major leaf diseases and it is a threat to rubber cultivation in most of the rubber growing countries. Incidence of this disease causes repeated post wintering defoliation that adversely affect the tree growth, resulting in reduced production and crop loss of more than 45 per cent. The present investigations on epidemiology and management of Corynespora leaf fall disease of rubber were carried out in the laboratory and field, consecutively for three years at University of Agricultural Sciences, Plant Pathology Division, Dharwad, Karnataka, Rubber Research Institute of India, Hevea Breeding Sub-Station, Nettana, Dakshina Kannada, Karnataka and Plant Pathology Division, Rubber Research Institute of India, Kerala. The results thus obtained are presented hereunder. 4.1 Symptomatology The disease was observed for the first time during November 1958 in the rubber nurseries of the Rubber Research Institute of India (RRII) Farm at Kottayam in Kerala State. The disease was later observed in nurseries at Mundakkayam, Kanjirappally, Thodupuzha, Chalakkudy and Trichur in Kerala and at Kaliyal in Kanyakumari District of Tamil Nadu, India. The symptoms obtained in the present study in various growth stages of the host are in general similar to these described by Jacob (2006) Nursery plants The symptoms observed in the nurseries are usually circular, rarely irregular amphigynous and 1 to 8 mm in diameter. Each leaf spot shows a white/light brown papery centre with dark brown ring at the margin, surrounded by yellow halo. Disintegration of the central portion sometimes results in shoot hole formation. Young leaves show shrivelling at the leaf tips. Defoliation of the upper young leaves and drying of the terminal portion consequent to formation of several lesions are common during the dry weather. It has been observed that although the leaf spot symptoms described are commonly observed in the nurseries when the infection is mild to moderate the severe form of disease causes complete blighting of the young leaves both in seedling stage and the budded plants grown in polybag. The infection is seen during the brown pendulous stage to early light green pendulous stage and the blighting follows within a few days if the weather remains dry and sunny. All the leaflets of infected leaves turn dry if the infection occur on petiole or base of leaflets. Such blighted leaves remain on the plant for few days before they fall off. The dry pendulous papery leaves are visible even from a distance and severely affected plants can easily be identified in the nurseries. In the bud wood grafted nurseries leaf spots are more common although blighting of leaves were occasionally seen. On semi mature leaves, infection leads to typical round or irregular lesions with papery centre brown margin and yellow halo. Even mature leaves were affected but the size of lesions formed on mature leaves is very small, slightly larger than a pinhead Besides the lesions and blighting of lamina the most common foliar symptom is the brownish discolouration of the leaf veins described as railway track appearance due to its similarity to railway tracks depicted on country maps. The symptom is also described as fish bone due to the similarity to the bones of small fish. This symptom is due to the production of toxin at the infection locus, which spreads along the veins discolouring them in the gradation of the concentration of the toxin within the tissue. As the toxin spreads, the tissue is damaged, thus restricting further fungal growth. If the infection is on the main vein blighting of the leaflet and abscission follows. If the infection is on secondary or tertiary veins the leaflets survive depending on the extent of infection and the railway track symptom will be evident.

46 Leasson symptoms and leaf defoliation in nursery Plate 1: Symptoms of Corynespora leaf fall disease of rubber in nursery

47 Plate 2: Symptoms of Corynespora leaf fall disease of rubber in main field

48 Severe infection in the nursery also cause shoot tip die back. The shoot tips at the brown stage are more vulnerable. The light green shoot tips are also sometimes affected but once the shoots are dark green or brown and mature, infection is less and often limited to spots. However, progress of fungal spread to such regions from infected younger portions are common. Infected nursery plants remain weak and stunted. Fresh growth is put up from below the affected portion if sufficient soil moisture is available. Otherwise the re-growth is delayed up to next rains. Very severely affected plants may not have sufficient nutrient reserves for refoliation and hence dry off (Plate 1) Mature trees On mature trees, all the symptoms described earlier for nurseries are observed. During the disease season, in the infected areas the plantation floor is covered with dry young leaves with numerous circular lesions. The trees may show partial to full defoliation. The disease season starts with the appearance of numerous circular or irregular spots on young light green leaves that develop after wintering. The appearance of severe disease follows almost within a fortnight if the weather is conducive. Severe disease is noticed first on the roadside trees or those near to open areas or gaps in the plantation. Often the branches exposed to sunlight are very severely affected and the leaves show a burned appearance and turn papery and pale brown. Such dry leaves remain on the branches for some time before they are shed. Leaves fall with or without the petiole. However, the petioles do not stay for long on the trees once the leaflets are shed. If there are sufficient nutrient reserves in the trees they refoliate within a month, though the canopy will be sparse. The refoliated branches get re-infection unless adequately protected. Infection of semi mature leaves lead to large lesions on the lamina appearing as blotches of light brown colour with dark brown margin and wide yellow surrounding areas. Concentric rings are sometimes seen in the central portion of the lesions. The infection of veins lead to distinct railway track symptoms varying from a few millimeters to several centimeters in length. Primary, secondary and tertiary veins get infected. If the petioles, petiolules or the main vein at the base of the leaflet get infected, defoliation follows within a couple of days. In other cases the leaflets survive for longer time and if the infection is not severe, may hold on. When mature leaves are infected the predominant symptom is the leaf spot although appearance of railway track symptom is common. In severe disease incidence numerous spot are produced and the leaves become yellow and later turn to copper brown and may finally fall off. Some distorted leaves with shot hole lesions stay for longer period and eventually fall off. Mature leaves with few pinhead lesions often survive till next wintering. Besides the leaf lamina the infection on leaf petioles and shoot tips are very often observed on mature trees. On the petioles the lesions appear as brown streaks of varying length and width. On the green portions of stem the fungus infects and causes splitting of the bark. Severely infected shoots dry up. The dried shoots remain on the trees and the fungus is observed to survive on such shoots till the next year to start new infection during refoliation. The broken stem portion fallen on the ground are also sources of inoculum for subsequent season (Plate 2). Complete drying up of infected trees have been observed in a few plantations due to repeated defoliation (Jacob, 1997). The trees near to exposed areas and receiving abundant sunlight were observed to be more prone to such severe disease incidence. Proximity to forests was another factor observed in areas of severe disease incidence. Trees with an open type canopy permits more sunlight penetration and are hence more prone to attack. 4.2 Survey for the incidence and severity of CLF disease Roving survey was conducted consecutively for three disease seasons during 2007, 2008 and 2009 in major rubber growing regions of Karnataka and North Malabar region of Kerala. The location wise disease incidence, intensity and disease severity distribution among the regions surveyed has been presented in Table 1 and Fig. 2.

49 Table 1: Incidence of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years Location Per cent disease incidence Mean Karnataka Belthangady Kundapura Madikere Puttur Sagar Subramanya Sullia Thirthahalli Kerala Kanhangod Kasaragod Nileshwar Sreekantapuram Taliparamba Thalassery

50 Per cent disease incidence Belthangady Kundapura Madikere Puttur Sagar Subramanya Sullia Thirthahalli Kanhangod Kasaragod Nileshwar Sreekantapuram Taliparamba Thalassery Karnataka Location Kerala Fig. 2: Incidence of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years Fig. 2: Incidence of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years

51 Table 2: Severity of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years Location Per cent Disease Index Mean Karnataka Belthangady Kundapura Madikere Puttur Sagar Subramanya Sullia Thirthahalli Kerala Kanhangod Kasaragod Nileshwar Sreekantapuram Taliparamba Thalassery CD at 5%

52 Per cent Disease Index Belthangady Kundapura Madikere Puttur Sagar Subramanya Sullia Thirthahalli Kanhangod Kasaragod Nileshwar Sreekantapuram Taliparamba Thalassery Karnataka Location Kerala Fig. 3: Severity of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years Fig. 3: Severity of Corynespora leaf fall disease in different locations in Karnataka and Kerala over the years

53 The data pertaining to incidence of Corynespora leaf fall disease during 2007 indicated that, the CLF disease was detected in large estates as well as in small holdings in all the locations surveyed in Karnataka and North Malabar region of Kerala and incidence of CLF disease ranging from to per cent. A total of 54 fields (75%) recorded presence of disease out of 72 field s surveyed in Karnataka region. Maximum (100%) disease incidence was recorded in Sullia and Subrahmanya regions. The minimum disease incidence was recorded at Thirthahalli (22.20%) and Sagar (28.57%) regions. Other locations recorded the disease incidence of per cent at Kundapura region followed by Belthangady (80.00%), Madikere (87.50%) and Puttur (88.88%). The CLF disease incidence varied from to per cent in North Malabar region of Kerala. Maximum disease incidence of per cent was noticed in Kanhangad followed by Kasaragod (87.50%), Taliparamba (87.50%), Thalassery (87.50%), Nileshwar (85.71%) and minimum incidence was recorded at Sreekantapuram (80.00%). The CLF disease incidence during 2008 disease season ranging from to Per cent and 50 fields (84.74%) noticed the presence of disease out of 59 fields s surveyed in Karnataka region. Maximum (100%) disease incidence was recorded in Sullia Subrahmanya and Puttur regions. The minimum disease incidence was recorded at Thirthahalli (16.66%) and Sagar (20.00%) regions. Remaining locations recorded the disease incidence of per cent at Kundapura region followed by Belthangady (83.33%) and Madikere (87.50%). In North Malabar region of Kerala, CLF disease incidence varied from to per cent. Maximum disease incidence of per cent was noticed in Kanhangad and minimum per cent was noticed at Nileshwar and Sreekantapuram. Other locations in Kasaragod and Taliparamba regions recorded the disease incidence of 88 per cent followed by Thalassery (85.71%). During 2009 the disease incidence was noticed with a range of to per cent in Karanataka regions. A total of 43 fields (76.78%) recorded presence of disease out of 56 field s surveyed in Karnataka region. Maximum (100%) disease incidence was recorded in Sullia, Puttur and Subrahmanya regions. The minimum disease incidence was recorded at Thirthahalli (16.660%) and Sagar (20.00%) regions. Other locations recorded the disease incidence of per cent at Kundapura and Madikere region followed by Belthangady (80.00%). The CLF disease incidence varied from to per cent in North Malabar region of Kerala. Maximum disease incidence of per cent was noticed in Kanhangad and Kasaragod followed by Taliparamba (88.88%), Thalassery and Nileshwar (80.00%) and minimum incidence was recorded at Sreekantapuram (75.00%). The consolidated location-wise CLF disease incidence indicated that, the disease incidence appeared to be high in Sullia, Puttur and Subramanya and it was very less in Sagar and Thirthahalli of Karnataka. The disease incidence was of almost similar trend in locations surveyed in North Malabar regions of Kerala, Kasaragod and Kanhangad regions are very adjacent to Karnataka and recorded slightly higher disease incidence when compared to other regions in Kerala. Corynespora leaf fall disease intensity recorded during 2007 to 2009 disease season in different locations is presented in Table 2 and Fig. 3. The results of 2007 indicated the significant differences among the locations. In Karnataka, CLF disease intensity ranging from 4.00 to per cent, low disease intensity was noticed in Thirthahalli (4.00%) and Sagar (5.55%). Comparatively high disease intensity was recorded at Sullia (30.00%) region followed by Subrahmanya (28.20%), Belthangady (27.50%), Puttur (26.00%), Kundapura (23.00%) and Madikere (21.14%). In North Malabar region, disease intensity ranging from to per cent, Sreekantapuram (17.50) region recorded low disease intensity, while it was high at Kanhangad (29.55%) region. Similar trend of high disease intensity was noticed at Kasaragod (26.28%) followed by Nileshwar (22.00%), Taliparamba (20.00%) and Thalassery (19.42%). During 2008 disease season, the disease intensity was noticed with a range of 3.00 to per cent at locations surveyed in Karnataka. Less disease intensity was recorded in Thirthahalli (3.00%) and Sagar (4.00%), while it was more at Kundapura (36.80%). Comparatively more disease intensity was observed at Subrahmanya (33.40%), followed by Belthangady (29.42%), Puttur (29.00%), Sullia (27.33%) and Madikere (26.28%).

54 Table 3: Distribution of CLF disease severity among the fields surveyed in Karnataka and Kerala during Disease score grade in fields surveyed (%) Location Nil Trace Low Moderate Severe Very severe Nil Trace Low Moderate Severe Very severe Nil Trace Low Moderate Severe Very severe Karnataka Belthangady Kundapura Madikere Puttur Sagar Subramanya Sullia Thirthahalli Kerala Kanhangod Kasaragod Nileshwar Sreekantapuram Taliparamba Thalassery

55 The CLF disease intensity ranging from to per cent in the locations surveyed in the North Malabar region of Kerala. Less disease intensity of per cent was recorded at Sreekantapuram, while it was high at Kanhangad (28.00%) region. Other locations, Kasaragod recorded the disease intensity of 23.75% followed by Nileshwar (21.80%), Taliparamba (20.25%) and Thalassery (19.33%). The data pertaining to CLF disease intensity recorded during 2009 disease season in different locations revealed that, In Karnataka, CLF disease intensity ranged from 2.00 to per cent. Low disease intensity was noticed in Thirthahalli (2.00%) and Sagar (3.00%). High disease intensity was recorded at Puttur (32.00%), similar range of intensity was recorded at Kundapura (30.80%), followed by Subrahmanya (30.40%), Belthangady (28.47%), Sullia (27.50%) and Madikere (20.50%) region. In North Malabar region, disease intensity ranging from to per cent, low disease intensity of per cent was recorded at Nileshwar region, while it was high at Kanhangad (24.00%) region followed by Kasaragod (22.40%), Sreekantapuram (20.00%), Taliparamba (19.25%) and Thalassery (19.00%) regions. The distribution of disease severity among the fields surveyed during 2007, 2008 and 2009 in different locations is presented in Table 3. In Karnataka, frequency of disease free rubber plantations (fields) and plantations with very low disease intensity was more in Thirthahalli and Sagar locations. However, disease intensity ranged between very low to severer in Kundapura and Madikere regions and it ranged between low to very severe at Belthangady, Puttur, Sullia and Subrahmanya regions. Most of the plantations surveyed in North Malabar region of Kerala, the disease intensity ranged between very light to very severe, except for the Thalassery region where it ranged between very light to severe. During 2008 disease season, in Karnataka, most of the plantations surveyed in Sagar and Thirthahalli region were found free from the infection and only 20 per cent of plantations recorded very light intensity. The disease intensity ranged between very low to severe at Puttur, Sullia, Madikere and Subrahmanya region. In Belthangady it was between very light to moderate. In North Malabar region of Kerala, the disease intensity remained severe in most of the locations surveyed except for the Kasaragod and Kanhangad, where the more than10 per cent of the plantations recorded very severe infection. Data pertaining to distribution of disease severity among the fields surveyed in Karnataka during 2009 indicated that, frequency of disease free rubber plantations and plantations with very low disease intensity was more in Thirthahalli and Sagar locations. The plantations surveyed in Kundapura, Belthangady and Sullia showed very light to severe intensity, while disease intensity remained moderate at Madikere region. Plantations at Puttur and Subrahmanya regions recorded very severe infection. In most of the plantations surveyed in North Malabar regions of Kerala, the disease intensity ranged between very light to severe, except for the Sreekantapuram and Thalassery regions, where it ranged between very light to moderate infection. 4.3 Cultural and physiological studies Cultural studies Growth of C. cassiicola on potato dextrose broth at different incubation period. The experiment was conducted to ascertain the number of days required for maximum growth of the fungus by monitoring the dry mycelial weight. The results are presented in Table 4 and Fig. 4. C. cassiicola fungal growth on PDA media showed significant difference among the incubation periods. The dry mycelial weight of C. cassiicola gradually increased from third day (94.50 mg) and reached maximum on 15 th day ( mg) and was significantly superior over all other incubation periods. Further, it gradually declining trend from 17 th days onwards Growth and sporulation of C. cassiicola on different solid media The cultural and morphological characters of C. cassiicola were studied on nine solid media in laboratory at room temperature ( C).

56 Table 4: Effect of incubation period on growth of Corynespora cassiicola on potato dextrose broth Sl. No. Days after inoculation Dry mycelial weight (mg) SEm CD (P 0.01) 2.67

57 Dry mycelial weight (mg) Days after inoculation Fig. 4: Effect of incubation period on growth of C. cassiicola on potato dextrose broth Fig. 4: Effect of incubation period on growth of C. cassiicola on potato dextrose broth

58 Table 5: Effect of different solid media on radial growth and sporulation of C. cassiicola Sl. No. Media Growth character Radial growth (mm) Sporulation 1. Potato dextrose agar Good and fast growth mycelia Black grey in colour 2. Oat meal agar Good growth, mycelia light grey colour and smooth margin Czapeks agar Good growth with thick mycelia Sabourauds agar Reduced growth with mycelia slightly irregular 5. Richards agar Good growth, mycelia with rough margin 6. Potato carrot agar Slow growth and thin mycelia with regular margin 7. Malt extract agar Slow growth with thin flat mycelia and regular margin 8. Yeast extract agar Slow growth mycelia with irregular margin 9. Corn meal agar Deprived mycelia growth with irregular margin SEm CD (P 0.01) 1.98

59 Radial growth (mm) Potato dextrose agar Oat meal agar Czapeks agar Sabourauds agar Richards agar Potato carrot agar Malt extract agar Yeast extract agar Corn meal agar Media Fig. 5: Effect of different solid media on radial growth and sporulation of C. cassiicola Fig. 5: Effect of different solid media on radial growth and sporulation of C. cassiicola

60 Table 6: Effect of different liquid media on dry mycelial weight and sporulation of C. cassiicola Sl. No. Media Dry mycelial weight (mg) Sporulation 1. Potato dextrose broth Oat meal medium Czapeks medium Sabourauds medium Richards medium Potato carrot medium Malt extract medium Yeast extract medium Corn meal medium SEm CD (P 0.01) 2.60

61 Dry mycelial weight (mg) Potato dextrose broth Oat meal medium Czapeks medium Sabourauds medium Richards medium Potato carrot medium Malt extract medium Yeast extract medium Corn meal medium Media Fig. 6: Effect of different liquid media on dry mycelial weight and sporulation of C. cassiicola Fig. 6: Effect of different liquid media on dry mycelial weight and sporulation of C. cassiicola

62 Table 7: Effect of temperature on growth and sporulation of C. cassiicola Sl. No. Temperature ( 0 C) Mean radial growth (mm) Sporulation SEm CD (P 0.01) 2.30

63 Mean radial growth (mm) Temperature ( 0 C) Fig. 7: Effect of temperature on growth and sporulation of C. cassiicola Fig. 7: Effect of temperature on growth and sporulation of C. cassiicola

64 Plate 3: Effect of different liquid media on dry mycelial weight of Corynespora cassiicola Plate 4: Effect of temperature ( 0 C) on mycelial growth of Corynespora cassiicola The radial growth of the fungus and sporulation were recorded when it attained the maximum growth in all the media tested. Observations on fungal mycelial colony characters were recorded. The results obtained are presented in the Table 5 and Fig. 5. The pathogen performed better growth in PDA media, recorded maximum growth (90.00 mm) and it was found significantly superior to other solid media tested. Similar trend of fungal growth was recorded in Czapeks agar (81.34 mm) and Oat meal agar (80.30 mm) media. Minimum fungal growth was observed in malt extract agar (50.40 mm) media. The pathogen showed variation in the sporulation on different solid media tested, maximum sporulation was found in potato dextrose agar, oat meal agar, Czapeks agar and Richards s agar media. With respect to mycelial colour, it varied from dull gray to light grey. The growth varied from flat to fluffy with smooth to irregular margins. The fungus showed light gray colored with smooth margin mycelia on potato dextrose agar with excellent sporulation. Similar trend of sporulation was recorded in Czapeks and oat meal agar media. Minimum and very poor sporulation was observed on potato carrot agar, malt extract agar and corn meal agar media Growth and sporulation of C. cassiicola on different liquid media The mycelial dry weight and sporulation capacity of C. cassiicola on different liquid media were studied under laboratory conditions and data are presented in Table 6 and Fig. 6.

65 Table 8: Effect of relative humidity on growth and sporulation of C. cassiicola Sl. No. Relative humidity (%) Mean radial growth (mm) Sporulation SEm CD (P 0.01) 2.34 The results of the study indicated that, there was significant difference in the growth between the liquid media tested. Potato dextrose broth supported maximum growth ( mg) and was significantly superior to other media followed by Czapeks agar ( mg), Oat meal agar ( mg) and Richards agar ( mg). The minimum dry mycelial weight ranged from to mg was observed in Potato carrot agar, Malt extract agar Yeast extract agar and Corn meal agar (Plate 3). Profuse sporulation was observed in potato dextrose broth, Czapeks agar, oat meal agar and Richards s agar media. Poor sporulation was noticed in malt extract agar, Potato carrot agar and Corn meal agar media, while sporulation was moderate on yeast extract agar and Sabourauds agar medium Physiological studies Effect of temperature on the growth and sporulation of C. cassiicola The fungus C. cassiicola was grown on potato dextrose agar medium at different temperature viz., 10, 15, 20, 25, 30, 35, 40 and 45 0 C to understand the most suitable temperature required for pathogen growth and development as well as sporulation. The results obtained are presented in Table 7 and illustrated in Fig. 7, revealed that mean colony diameter of fungus was maximum at 30 0 C (80.50 mm) and 25 0 C (79.87 mm) which were significantly superior to all other temperatures tested. The growth of the fungus was found very minimum at 10 to 20 0 C and it was also found decreased at the temperature behind 40 0 C (Plate 4). Excellent sporulation was observed at both 25 and 30 0 C and moderate or fair sporulation was recorded at 35 0 C. The sporulation was not observed at the 10 and 15 0 C, while it was very poor at 40 and 45 0 C.

66 Mean radial growth (mm) Relative humidity (%) Fig. 8: Effect of relative humidity on growth and sporulation of C. cassiicola Fig. 8: Effect of relative humidity on growth and sporulation of C. cassiicola

67 Table 9: Effect of ph on dry weight of mycelia and sporulation of C. cassiicola Sl. No. ph Mean mycelial dry weight (mg) Sporulation SEm CD (P 0.01) 2.43

68 Mean mycelial dry weight (mg) Fig. 9: Effect of ph on dry weight of mycelia and sporulation of C. cassiicola ph Fig. 9: Effect of ph on dry weight of mycelia and sporulation of C. cassiicola

69 Plate 5: Effect of relative humidity (%) on mycelial growth of Corynespora cassiicola Plate 6: Effect of ph on dry mycelial weight of Corynespora cassiicola Table 10: Effect of light intensity on growth and sporulation of C. cassiicola Sl. No. Light duration Mean radial growth (mm) Sporulation 1. Continuous dark Continuous light Alternate dark and light SEm CD (P 0.01) 1.43

70 Mean radial growth (mm) Continuous dark Continuous light Alternate dark and light Light duration Fig. 10: Effect of light intensity on growth and sporulation of C. cassiicola Fig. 10: Effect of light intensity on growth and sporulation of C. cassiicola

71 Plate 7: Effect of light intensity on mycelial growth of Corynespora cassiicola Plate 8: The Burkard Volumetric Spore Trap installed on the spore trap stand in infected rubber plantation Effect of relative humidity on growth and sporulation of C. cassiicola Effect of RH on growth and sporulation was studied in laboratory condition, the fungus was grown on potato dextrose agar medium at different relative humidity viz., 50, 60, 70, 80, 90, 100 per cent. The results presented in Table 8 and in Fig. 8, revealed that radial growth and sporulation of the fungus was maximum at 90 per cent relative humidity (88.50 mm), followed by at 80 per cent relative humidity (85.87 mm). Lowest mean radial growth and fair sporulation of the fungus was observed at 50, 60, 70 and 100 per cent relative humidity (Plate 5) Effect of ph on growth and sporulation of C. cassiicola The fungus was grown in medium at different ph level and observations on dry mycelial weight and sporulation was taken as described in Material and Methods and data obtained are presented in Table 9 and illustrated in Fig. 9. Data reveled that C. cassiicola grew well with good sporulation at 6.50 and 7.00 levels of hydrogen ion concentration (ph) with maximum dry mycelial weight of and mg respectively. The dry mycelial weight was maximum at ph level 7 and found significantly superior to other ph levels tested. Growth and sporulation recorded at 5.5 ( mg), 6.0 ( mg) was only fair and it declined at ph level behind 8.0. The pathogen showed low response to the ph levels 4.0 (48.30 mg) and 4.5 (58.00 mg) with poor sporulation (Plate 6).

72 Table 11: Source of isolates used in the study Sl. No. Code Location State 1. Cc 1 to Cc 2 Sagar Karnataka 2. Cc 3 to Cc 5 Thirthahalli Karnataka 3. Cc 6 to Cc 12 Kundapura Karnataka 4. Cc 13 to Cc 21 Belthangady Karnataka 5. Cc 22 to Cc 29 Puttur Karnataka 6. Cc 30 to Cc 39 Sullia Karnataka 7. Cc 40 to Cc 49 Madikere Karnataka 8. Cc 50 to Cc 62 Subrahmanya Karnataka 9. Cc 63 to Cc 68 Kasaragod Kerala 10. Cc 69 to Cc 75 Kanhangod Kerala 11. Cc 76 to Cc 79 Nileshwar Kerala 12. Cc 80 to Cc 84 Taliparamba Kerala 14. Cc 85 to Cc 90 Sreekantapuram Kerala 15. Cc 91 to Cc 95 Thalassery Kerala

73 Fig. 11: ERIC PCR profiles of C. cassiicola isolates (1 to 95) M-Marker

74 Fig. 12: Dendrogram construct of ERIC PCR profiles of C. cassiicola isolates Effect of light intensities on growth and sporulation of C. cassiicola Effect of light intensity on the fungal growth and sporulation was studied in laboratory condition. The results obtained are presented in the Table 10 and illustrated in Fig. 10. The data reveled that all the treatments differed significantly, maximum mean radial growth (85.50 mm) and excellent sporulation were observed when petridishes are exposed to alternate cycle of 12 hr light and 12 hr darkness. Exposure of petridishes to continuous light resulted in production of mean colony diameter of mm with good sporulation. The lowest mean colony diameter of mm was observed in the petridishes which were exposed to continuous darkness with good sporulation (Plate 7). 4.4 Genetic variability of C. cassiicola Variability of C. cassiicola isolates from different locations The ERIC PCR (enterobacterial repetitive intergenic consensus sequence polymerase chain reaction) was carried to study the variability among the C. cassiicola isolates from different (Table 11) location as explained in materials and methods and results are presented in Fig. 11 and Fig. 12. The results revealed that ERIC PCR of genomic DNA from C. cassiicola isolates generated a total of 16 bands ranging from 200 to 2000bp. Visual comparison of ERIC PCR banding pattern revealed four distinct profiles among the C. cassiicola isolates tested. There was a high degree of similarity in ERIC PCR profiles of all the isolates except, Cc 50, Cc 56 collected from Subramanya of Karnataka and Cc 75 from Kanhangad location of Kerala. Cluster analysis using Quality 1 program produced a dendrogram in which the 95 isolates resolved into four major clusters. One C. cassiicola isolate from Subramanya location showed maximum dissimilarity followed by two isolates from Kanhangad and all other isolates showed similarity in the distinct ERIC PCR profiles.

75 4. 5 Epidemiological studies Aerobiology The investigation on aerobiology of C. cassiicola such as trapping of airborne fugal spore and conidia was carried out in infected rubber plantation throughout the year, which was aimed primarily to understand the epidemiology of the disease. Air sampling was done by mounting the Burkard volumetric spore trap at mid canopy level in the rubber plantation (Plate 8). In addition to air borne spore catch, study on detection of first appearance of spores and disease symptoms, spore dispersal pattern, build up of spore load disease progress and impact of weather parameters were carried out in three consecutive disease periods and the results are furnished below. The aerobiological study of the C. cassiicola revealed the variation in spore release. In general, maximum number of spores catch was recorded during the cool climate in morning 8 AM and continued up to noon 12 and reduced during evening. Almost similar spore release pattern was observed during the study (Table 12 and Fig. 13) Effect of weather factors on spore load of C. cassiicola The result of the aerobiological study with weather parameters during 2007 disease season presented in Table 13 and also weather impact illustrated in Fig. 14, revealed that the first spore catch of C. cassiicola fungal spore was recorded during second fortnight of January. The spore load increased gradually after first fortnight of February. The highest peak spore load of 1496 spores/m 3 was observed during the first fortnight of April. During that period, the mean minimum temperature ranged from 19 to 21 0 C and mean maximum temperature ranged from 35 to 37 0 C, RH ranged from 89 to 90 per cent and there was very little rainfall. The atmospheric fungal spore load was decreased considerably to spores/m 3 during the month of May, after receiving the first pre monsoon showers (200 mm). The mean minimum temperature ranged from 17 to 19 0 C, maximum temperature ranged between 34 to 35 0 C and more than 95 per cent RH prevailed during that period. Negligible spore movement was recorded during the month of July August and there was no spore catch during the month of September to December (Plate 9 and 10). The impact of atmospheric condition and weather parameters on spore release of C. cassiicola during 2008 disease season is presented in Table 14 and illustrated in Fig. 16. The first appearance of C. cassiicola fungal spore was recorded during first fortnight of January and spore load gradually increased from 5 to 1479 spores/m 3. The minimum 5 spores/m 3 was recorded during first fortnight of January, with minimum temperature ranging from 11 to 16 0 C, maximum temperature from 30 to 33 0 C with 85 to 89 per cent RH. The spore catch was maximum 1479 spores/m 3 during the first fortnight of April. During that period, the mean minimum temperature ranged from 20 to 23 0 C and mean maximum temperature from 33 to 36 0 C. The RH ranged from 89 to 90 per cent and very little rain fall (3.3 mm). The spore catch reduced drastically to 120 spores/m 3 during second fortnight of May with a 129 mm. scanty spore movement was recorded during the month of July to December (Plate 11). The data pertaining to aerobiological study during 2009 presented in Table 15 and illustrated in Fig. 18, revealed that the first appearance of C. cassiicola spore was recorded during second fortnight of January. The spore load increased gradually after the first fortnight of February and reached its highest peak during second fortnight of March (1423 spores/m 3 ). At that period, the mean minimum temperature ranged from 20 to 21 0 C and mean maximum temperature from 35 to 36 0 C. The RH ranged from 89 to 90 per cent and there was scattered rain fall of 11 mm. The atmospheric fungal spore catch was reduced considerably during the month of May (119 spores/m 3 ), when the mean minimum temperature ranged from 22 to 23 0 C and maximum temperature between 26 to 28 0 C with more than 95 per cent RH. Very little spore catch was recorded during the month of July to September and no spore catch during October to December Effect of weather factors on per cent disease index of C. cassiicola The per cent disease intensity (Index) with weather parameters during 2007 disease season is presented in Table 13 and Fig. 15. Results of the study indicated that disease persists in the rubber plantation throughout the year and intensity varies from period to period. Fresh infection was noticed during first fortnight of February after the annual leaf fall.

76 Plate 9: Preparation of spore trap sampler for using in the field

77 Table 12: Monthly average number of spore released during the disease period over the years Month Time (hrs) February March April May Jun February March April May Jun February March April May Jun

78 February March April May Jun Average No. of spore release Time Fig. 13a: Monthly average number of spore released during the disease period over the years February March April May Jun Average No. of spore release Fig. 13b: Monthly average number of spore released during the disease period over the years Time February March April May Jun Average No. of spore release Fig. 13c: Monthly average number of spore released during the disease period over the years Time Fig. 13: Monthly average number of spore released during the disease period over the years

79 Table 13: Effect of weather parameter on C. cassiicola spore load and CLF disease development during 2007 Month Average Temperature ( o C) Maximum Minimum Average relative humidity (%) Total rain fall (mm) Total spore load/m 3 of air Per cent disease intensity I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN January February March April May June July August September October November December

80 Total spore load I FN Total spore load II FN Total rainfall I FN Total rainfall II FN Max. Temp. I FN Max. Temp. II FN Min. Temp. I FN Min. Temp. II FN Relative humidity I FN Relative humidity II FN RH (%) and Temperature ( 0 C) Rainfall (mm) and Spore catch/m 3 0 January February March April May June July August September October November December Month Fig. 14: Effect of weather parameter on C. cassiicola spore load and CLF disease development during Fig. 14: Effect of weather parameter on C. cassiicola spore load and CLF disease development during 2007

81 PDI I FN PDI II FN Total rainfall I FN Total rainfall II FN Max. Temp. I FN Max. Temp. II FN Min. Temp. I FN Min. Temp. II FN Relative humidity I FN Relative humidity II FN PDI, RH (%) and Temperature ( 0 C) Rainfall (mm) 0 January February March April May June July August September October November December Month Fig. 15: Effect of weather parameter on CLF disease development during Fig. 15: Effect of weather parameter on CLF disease development during 2007

82 Plate 10: Method of making slid and Counting of spore catch under the microscope

83 Table 14: Effect of weather parameter on C. cassiicola spore load and CLF disease development during 2008 Months Average Temperature ( o C) Maximum Minimum Average relative humidity (%) Total rain fall (mm) Total spore load/m 3 of air Per cent disease intensity I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN January February March April May June July August September October November December

84 Total spore load I FN Total spore load II FN Total rainfall I FN Total rainfall II FN Max. Temp. I FN Max. Temp. II FN Min. Temp. I FN Min. Temp. II FN Relative humidity I FN Relative humidity II FN RH (%) and Temperature ( 0 C) Rainfall (mm) and Spore catch/m 3 0 January February March April May June July August September October November December Month Fig. 16: Effect of weather parameter on C. cassiicola spore load and CLF disease development during Fig. 16: Effect of weather parameter on C. cassiicola spore load and CLF disease development during 2008

85 PDI I FN PDI II FN Total rainfall I FN Total rainfall II FN Max. Temp. I FN Max. Temp. II FN Min. Temp. I FN Min. Temp. II FN Relative humidity I FN Relative humidity II FN PDI, RH (%) and Temperature ( 0 C) Rainfall (mm) 0 January February March April May June July August September October November December Month Fig. 17: Effect of weather parameter on CLF disease development during Fig. 17: Effect of weather parameter on CLF disease development during 2008

86 Table 15: Effect of weather parameter on C. cassiicola spore load and CLF disease development during 2009 Months Average Temperature ( o C) Maximum Minimum Average relative humidity (%) Total rain fall (mm) Total spore load/m 3 of air Per cent disease intensity I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN January February March April May June July August September October November December

87 Total spore load I FN Total spore load II FN Total rainfall I FN Total rainfall II FN Max. Temp. I FN Max. Temp. II FN Min. Temp. I FN Min. Temp. II FN Relative humidity I FN Relative humidity II FN RH (%) and Temperature ( 0 C) Rainfall (mm) and Spore catch/m 3 0 January February March April May June July August September October November December Month Fig. 18: Effect of weather parameter on C. cassiicola spore load and CLF disease development during Fig. 18: Effect of weather parameter on C. cassiicola spore load and CLF disease development during 2009

88 PDI I FN PDI II FN Total rainfall I FN Total rainfall II FN Max. Temp. I FN Max. Temp. II FN Min. Temp. I FN Min. Temp. II FN Relative humidity I FN Relative humidity II FN PDI, RH (%) and Temperature ( 0 C) Rainfall (mm) 0 January February March April May June July August September October November December Month Fig. 19: Effect of weather parameter on CLF disease development during Fig. 19: Effect of weather parameter on CLF disease development during 2009

89 Higher intensity of disease was observed from first fortnight of March (31.00%) to second fortnight of May (34.40%), with the maximum disease intensity of per cent recorded during first fortnight of April. During this period the mean minimum temperature ranged from 20 to 21 0 C and mean maximum temperature from 35 to 36 0 C, RH ranged from 89 to 90 per cent and there was very little rainfall. The disease intensity gradually subsided after the onset of monsoon and it was minimum or mild throughout the rainy and wet months. The mean minimum temperature ranged from 22 to 23 0 C, maximum temperature between 26 to 28 o C and 85 to 95 per cent RH was observed during these months. Data on Corynespora leaf fall disease progress and the weather parameters recorded during 2008 disease season is presented in Table 14 and Fig. 17, revealed the similar trend as observed in 2007 disease season. Fresh infection of CLF disease was observed during second fortnight of February and comparatively larger disease intensity was observed from first fortnight of March (33.20%) to first fortnight of May (27.00%), with the maximum disease intensity of per cent recorded during first fortnight of April. The weather parameters recorded during this period showed the minimum temperature ranged from 11 to 16 0 C and maximum temperature ranged from 30 to 33 O C, RH ranging from 85 to 89 per cent with scattered rain fall of 11 mm. The disease intensity was minimum after the onset of monsoon when minimum temperature ranged from 22 to 23 0 C, maximum temperature between 26 to 28 o C and 85 to 95 per cent RH. Corynespora leaf fall disease intensity and weather parameters observed during 2009 disease season is presented in Table 15 and Fig. 19. Results revealed that disease followed similar trend as observed in previous seasons. First fresh infection was noticed during second fortnight of January after the annual leaf fall. Higher intensity of disease was observed from second fortnight of March (58.00%) to first fortnight of May (30.72%), with the maximum disease intensity of per cent recorded during first fortnight of April. During this period the mean minimum temperature ranged from 20 to 21 0 C, mean maximum temperature from 35 to 36 0 C and RH ranged from 89 to 90 per cent and there was very little rainfall. The disease intensity gradually subsided after the onset of monsoon and it was mild throughout the rainy as well as wet months. The mean minimum temperature ranged from 22 to 23 0 C, maximum temperature between 26 to 28 0 C with 85 to 95 per cent RH Effect of spore load of C. cassiicola on CLF disease development The pattern of CLF disease development in three consecutive disease seasons in relation to spore release is illustrated in Fig. 20. In general, spore catch was fist noticed during second fortnight of January. The spore catch increased gradually and reached its maximum during the second fortnight of March to second fortnight of April and it was reduced during the rainy season from May to July. Very negligible spore catch was observed during August to December. Fresh disease symptoms were seen during second fortnight of January or first fortnight of February depending upon refoliation. The disease intensity was maximum during April and reduced after the receipt of pre-monsoon showers and remained very low during the wet months Correlation analysis between fungal spore load of C. cassiicola in relation to weather parameters An attempt was made to establish the relationship between weather factors viz., minimum and maximum temperature, relative humidity and rain fall with fortnightly total spore catch of C. cassiicola through correlation analysis. The correlation coefficients for all the disease seasons are presented in Table 16. The relationship between spore load of C. cassiicola and weather factors during the first disease season indicated a positive correlation between maximum and minimum temperature with correlation coefficient of and respectively. While, Relative humidity (-0.214) and rainfall (-0.331) the spore catches was negatively correlated. Similar correlation was observed in second disease season with maximum and minimum temperature positively correlated with fortnightly spore load. Relative humidity was positively and rain fall negatively correlated with spore load. Almost similar correlation was observed in third season, maximum and minimum temperature positively correlated and RH and rainfall negatively correlated with fortnightly spore load.

90 Per cent disease index Spore load/cu m I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN I FN II FN Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 PDI 2008 PDI 2009 PDI 2007 Spore load 2008 Spore load 2009 Spore load 0.00 Fig. 20: Corynespora leaf fall disease progress in relation to fungal spore load over the years Fig. 20: Corynespora leaf fall disease progress in relation to fungal spore load over the years

91 Table 16: Correlation between fortnightly total spore load of C. cassiicola in relation to weather parameters Sl. No. Weather parameter Correlation coefficient ( r ) Maximum temperature 0.574** 0.450* 0.414* 2. Minimum temperature Relative humidity Total rain fall ** - Significant at 5% level * - Significant at 1% level Table 17: Correlation between fortnightly PDI of Corynespora leaf fall disease in relation to weather parameters Sl. No. Weather parameter Correlation coefficient ( r ) Maximum temperature 0.542** 0.427* 0.423* 2. Minimum temperature Relative humidity Total rain fall ** - Significant at 5% level * - Significant at 1% level

92 Plate 11:Corynespora cassiicola spores and mycelium caught in the spore trap Plate 12: Survival Corynespora cassiicola in plant parts in rubber plantation

93 Correlation analysis between severity of Corynespora leaf fall disease in relation to weather parameters The analysis was made to establish the relationship between weather factors viz., maximum and minimum temperature, relative humidity and rain fall with per cent disease intensity of Corynespora leaf fall disease in infected rubber plantation through correlation analysis. The relationship between PDI and weather factors during 2007 disease season (Table 17) indicated that significant positive correlation between maximum and minimum temperature with a correlation coefficient of and respectively. Relative humidity and rain fall negatively correlated with a correlation coefficient of and respectively. Similarly during 2008 disease season PDI was positively correlated with both maximum (0.427) and minimum (0.267) temperature and relative humidity (0.245), the total rain fall were negatively correlated with a correlation coefficient of Correlation study during 2009 disease season indicated a similar trend as observed in first disease season with maximum and minimum temperature positively correlated and relative humidity as well as rain fall negatively correlated with the PDI. Table 18: Survival of C. cassiicola on leaf litters Sl. No. Storage period (days) Isolation and growth of pathogen on PDA media = isolated fungus grows well, - = not isolated and no growth

94 Table 19: Effect of seasonal variation on survival and severity of C. cassiicola in infected rubber plantation Months Growth of pathogen on PDA I FN PDI II FN January Positive February Positive March Positive April Positive May Positive June Positive July Positive August Positive September Positive October Positive November Positive December Positive FN Fortnight

95 4. 6 Survival of Corynespora cassiicola Survival on infected leaf litters The survival of pathogen on infected fallen leaves was studied by storing the leaf litter in basket and studying the viability of the pathogen by isolating the pathogen regularly on every alternate day. The results furnished in Table 18, reveled that pathogen survived up to 11 days in infected leaf litter as it showed growth on PDA media. On 13 and 15 th days after storing the leaf litter in field condition, the pathogen could not be isolated (Plate 12) Seasonal variation on survival of pathogen in infected rubber plants Seasonal variation on survival of and severity of C. cassiicola on infected rubber plants was assessed for a period of 12 months by recording the disease progress in infected rubber plantation at fortnightly interval as well as periodic isolation of pathogen from the infected leaves that remained on the plants. The results generated are presented in Table 19. Pathogen C. cassiicola was found to survive on infected rubber trees throughout the year at varying intensity. Fresh infection observed after the refoliation during the month of February and greater disease intensity was observed during March and April. The disease remained mild during rainy season and there was no leaf fall during the rainy as well as wet months. Further, pathogen isolated from detached infected leaves showed good mycelial growth on PDA medium throughout the year (Plate 12) Survival in infected twigs The survivability of the C. cassiicola on infected rubber plant parts and debris was studied by sectioning and direct observation under microscope. The viability was also tested by plating the dormant mycelia on PDA plates. Results indicated that the pathogen was able to survive on infected plant debris from one season to the next as thick dark brown dormant mycelium under the bark of infected twigs. The dormant mycelia showed good growth on PDA medium Host range studies The possibility of existence of alternative hosts for C. cassiicola was studied by isolating pathogen from the hosts that showed similar symptoms as noticed on rubber. The C. cassiicola isolated from different hosts were examined for their cross infectivity on rubber. The details are given in Table 20 and Plate 13. The results of the host range studies indicated that the C. cassiicola was isolated from other infected plants viz., Clerodendran, Soyabean, Mango, Papaya, Ficus sp. and Geranium (Table 21). Although C. cassiicola infection was suspected on Cashew, the pathogen isolated was different. The cross inoculation studies indicated that pathogen isolated from different hosts are host specific showed negative reaction to rubber. 4.7 Screening of H. brasiliensis clones for C. cassiicola resistance Sixty two cultivated Hevea clones were evaluated under natural infection in nursery and in field conditions (Table 22 and Plate 14). Screening study during first (2007) disease season indicated that four clones in bud wood nursery viz., RRIM 600, GT 1, AVROS 225 and IAN 5/873 and 10 clones in main field viz., PB 312, PB 213, PB 242, PB 252, RRIM 600, CH 4, GT 1, AVROS 225, Haiken 1 and IAN 5/873 were found free from the CLF disease infection (Table 23). The clone RRII 105, PB 28/59, PR 255 and PR 261 have recorded higher disease intensity (>50 per cent) both in nursery as well as in the main field. Remaining clones showed the disease intensity ranging from 5 to 46 per cent. During second season (2008) of screening the clones showed differential reactions (Table 24). The clones RRII 5, RRII 208, RRII 3, RRII 6, PB 255, PB 310, PB 215, PB 86, RRIM 600, GL 1, CH 26, CH 2, GT 1, AVROS 225, LCB 1320, SCATC 93/114, SCATC 88/13, Haiken 1, RRIC 100, KRS 25, KRS 128, KRS 163, NAB 17 and Mil 3/2 recorded less than 10 per cent disease intensity.

96 Table 20: Testing of different hosts for the presence of C. cassiicola Sl. No. Common name Botanical name Infection by C. cassiicola 1. Clerodendron Clerodendran infortunatum Positive 2. Soybean Glycine max Positive 3. Mango Mangefera indica Positive 4. Cashew Anacardium occidentale Negative 5. Papaya Carica papaya Positive 6. Ficus sp. Ficus benjamina Positive 7. Geranium Geranium maculatum Positive 8. Hydrangea Hydrangea macrophylla Positive Table 21: Cross inoculation studies of C. cassiicola of different host plants Sl. No. Common name Botanical name Reaction to rubber 1. Clerodendron Clerodendran infortunatum Negative 2. Soybean Glycine max Negative 3. Mango Mangefera indica Negative 4. Papaya Carica papaya Negative 5. Ficus sp. Ficus benjamina Negative 6. Geranium Geranium maculatum Negative 7. Hydrangea Hydrangea macrophylla Negative

97 Plate 13: Corynespora leaf spot symptoms in different host plants Plate 14: Field evaluation of different Heavea clones in nursery and field

98 Table 22: Details of Hevea clones used in the study Sl. No. Clone Parentage Source Sl. No. Clone Parentage Source 1 RRII 3 PRIMARY India 32 RRIM 703 RRIM 600 x RRIM 600 Malaysia 2 RRII 5 PRIMARY India 33 Gl 1 PRIMARY Malaysia 3 RRII 6 PRIMARY India 34 Pil B 84 PRIMARY Malaysia 4 RRII 105 Tjir 1 x GL 1 India 35 CH 2 PRIMARY Malaysia 5 RRII 118 Mil 3/2 x Hil 28 India 36 CH 3 PRIMARY Malaysia 6 RRII 203 PB 86 x Mil 3/2 India 37 CH 4 PRIMARY Malaysia 7 RRII 208 Mil 3/2 x AVROS 225 India 38 CH 26 BR 2 x BR 2 Malaysia 8 RRII 300 Tjir 1 x PR 107 India 39 AVORS 49 PRIMARY Indonesia 9 RRII 308 GL 1 x PB 6/50 India 40 AVROS 225 PRIMARY Indonesia 10 AVT 73 PRIMARY India 41 AVROS 352 PRIMARY Indonesia 11 PB 5/51 PB 86 x PB 24 Malaysia 42 Tjir 1 PRIMARY Indonesia 12 PB 28/59 PRIMARY Malaysia 43 PR 255 Tjir 1 x PR 107 Indonesia 13 PB 28/83 PRIMARY Malaysia 44 PR 261 Tjir 1 x PR 107 Indonesia 14 PB 86 PRIMARY Malaysia 45 LCB 1320 PRIMARY Indonesia 15 PB 213 PB 56 x PB 86 Malaysia 46 GT 1 PRIMARY Indonesia 16 PB 215 PRIMARY Malaysia 47 SCATC 8/13 RRIM 600 x PilB 84 China 17 PB 217 PB 5/51 x PB 6/9 Malaysia 48 SCATC 93/114 TR 31/45 x Heck /11 China 18 PB 235 PB 5/51 x PB 5/78 Malaysia 49 Haiken 1 PRIMARY China 19 PB 242 PB 5/51 x PB 32/36 Malaysia 50 RRIC 36 PB 86 x PR 107 Srilanka 20 PB 252 PB 86 x PB 32 Malaysia 51 RRIC 45 RRIC 52 x Tjir 1 Srilanka 21 PB 255 PB 5/51 x PB 32/36 Malaysia 52 RRIC 100 RRIC 52 x PB 86 Srilanka 22 PB 260 PB 5/51 x PB 49 Malaysia 53 RRIC 102 RRIC 52 x RRIC 7 Srilanka 23 PB 280 PRIMARY Malaysia 54 RRIC 104 RRIC 52 x Tjir 1 Srilanka 24 PB 310 PB 5/51x RRIM 600 Malaysia 55 RRIC 105 RRIC 52 x Tjir 1 Srilanka 25 PB 311 RRIM 600 x PB 235 Malaysia 56 Mil 3/2 PRIMARY Sri Lanka 26 PB 312 RRIM 600 x PB 235 Malaysia 57 NAB 17 PRIMARY Sri Lanka 27 PB 314 RRIM 600 x PB 235 Malaysia 58 WARRING 4 PRIMARY Srilanka 28 RRIM 501 Pil A 44 x Pil B 84 Malaysia 59 IAN 45/873 PB 86 x F1717 Brazil 29 RRIM 600 Tjir 1 x PB 86 Malaysia 60 KRS 25 PRIMARY Thailand 30 RRIM 605 Tjir 1 x PB 49 Malaysia 61 KRS 128 PB 5/63 x KRS 13 Thailand 31 RRIM /553 x RRIM 501 Malaysia 62 KRS 163 PB 5/63 x RRIM 501 Thailand

99 Table 23: Screening of Hevea genotypes in nursery and in field against CLF disease during 2007 Sl. No Clone Per cent Disease Index Nursery Field Sl. No Clone Per cent Disease Index Nursery Field 1 RRII RRIM RRII GL RRII Pil B RRII CH RRII CH RRII CH RRII CH RRII AVROS RRII AVROS AVT AVROS PB 5/ Tjir PB 28/ PR PB 28/ PR PB LCB PB GT PB SCATC 88/ PB SCATC 93/ PB Haiken PB RRIC PB RRIC PB RRIC PB RRIC PB RRIC PB RRIC PB Mil 3/ PB NAB PB WARRING RRIM IAN 45/ RRIM KRS RRIM KRS RRIM KRS

100 Table 24: Screening of Hevea genotypes in nursery and in field against CLF disease during 2008 Sl. No Clone Per cent Disease Index Nursery Field Sl. No Clone Per cent Disease Index Nursery Field 1 RRII RRIM RRII GL RRII Pil B RRII CH RRII CH RRII CH RRII CH RRII AVROS RRII AVROS AVT AVROS PB 5/ Tjir PB 28/ PR PB 28/ PR PB LCB PB GT PB SCATC 88/ PB SCATC 93/ PB Haiken PB RRIC PB RRIC PB RRIC PB RRIC PB RRIC PB RRIC PB Mil 3/ PB NAB PB WARRING RRIM IAN 45/ RRIM KRS RRIM KRS RRIM KRS

101 Table 25: Screening of Hevea genotypes in nursery and in field against CLF disease during 2009 Sl. No Clone Per cent Disease Index Nursery Field Sl. No Clone Per cent Disease Index Nursery Field 1 RRII RRIM RRII GL RRII Pil B RRII CH RRII CH RRII CH RRII CH RRII AVROS RRII AVROS AVT AVROS PB 5/ Tjir PB 28/ PR PB 28/ PR PB LCB PB GT PB SCATC 88/ PB SCATC 93/ PB Haiken PB RRIC PB RRIC PB RRIC PB RRIC PB RRIC PB RRIC PB Mil 3/ PB NAB PB WARRING RRIM IAN 45/ RRIM KRS RRIM KRS RRIM KRS

102 The popular high yielding and widely cultivated clone RRII recorded higher disease intensity of per cent in main field and per cent in nursery. Disease intensity of more than 50 per cent was observed in the clones PB 28/59, PR 255 and PR 261. Other clones recorded the less than 50 per cent disease intensity. The results of screening study during the third disease season (2009) presented in Table 25, indicated similar trend of disease intensity as found in second disease season (2008) and no clones were free from the infection. The popularly cultivated clones GT 1 (3.33% in field & 8.67% in nursery) and RRIM 600 (3.40% in field & 5.17% in nursery) recorded very low disease intensity, while RRII 105 recorded very high intensity of per cent in nursery and per cent in main field. Consolidated results pertaining to reaction of H. brasiliensis clones to CLF disease infection in nursery and in main field over the years is presented in Table 26. In general, all the clones showed more disease intensity in nursery compared to main field. Out of sixty two clones screened sixteen clones recorded less than 10 per cent disease intensity, twenty eight clones showed less than 25 per cent, nine clones recorded less than 50 percent and remaining nine clones showed more than 50 per cent disease intensity in the nursery. In the main 32 clones showed less than 10 per cent disease intensity out of sixty two clones. Seventeen clones recorded less than 25 per cent, ten clones less than 50 per cent and only three clones recorded more than 50 per cent disease intensity. Susceptibility of H. brasiliensis clones was further grouped into five groups based on their performance in main field. The clones RRII 105, PR 261, PR 255 and PB 28/83 (>50 PDI) were found to be severely infected and grouped as highly susceptible. Among other popular clones, GT 1 and RRIM 600 with very light (trace) infection (<5 PDI) were grouped as resistant. Clones RRII 6, RRII 3, AVT 73, PB 310, PB 255, PB 242, PB 213, PB 252, PB 215, RRIM 701, CH 3, CH 26, AVROS 49, LCB 1320, SCATC 93/114, SCATC 88/13, Haiken 1, RRIC 100, Mil 3/2, NAB 17 and KRS 128 showed even then 10 PDI and were grouped as moderately susceptible. The clones RRII 308, RRII 118, RRII 300, PB 312, PB 28/59, PB 5/51, PB 314, PB 311, PB 280, RRIM 703, Pil 84. CH 4, AVROS 352, Tjir 1, RRIC 104, RRIC 45 and WARRING 4 recorded PDI between 10 to 25 and were grouped as moderately susceptible. Other remaining clones RRII 203, PB 235, PB 217, PB 260, RRIM 501, RRIM605, RRIC 105, RRIC 102 and RRIC 36 showed 25 to less than 50 PDI and were grouped as susceptible clones (Table 27 and 28). The data was further subjected to analysis of variance which revealed a significant variation between the disease infection among the clones, year and clone x year interaction components. Spearman rank correlation, however showed a significant association of ranks of the clones across years and suggesting that the ranking pattern did not fluctuate much between the clones with individual years. Based on estimated Euclidean distances, clones were grouped into five distinct natural clusters for the reaction to CLF disease in nursery (Fig. 21) and in field (Fig. 22). Summary of cluster analysis (Table 29) revealed that 68 % of the clones in the field and 63% in nursery were in the first group as resistant to CLF disease. About 6% of clones screened were in the fifth group and were susceptible. Remaining clones fell in tolerant and less susceptible cluster. However, some of the clones from these clusters never matched the five grades of classification on PDI except for the last cluster. The first and the fourth clusters however showed a gradual increase in level of susceptibility irrespective of their position. The clonal compositions also remained almost a constant except for 10 clones in field and 4 clones in nursery tests which had shown a shift in the reaction to CLF disease Disease management In vitro evaluation of fungicides against C. cassiicola Eight water-based fungicides were tested at five different concentrations (ppm) against C. cassiicola through poisoned food technique in the laboratory. The data are presented in Table 30 and Fig. 23. The result revealed that, there was a significant difference between chemicals tested. Among the thirteen water-based fungicides tested in the laboratory, four viz., Carbendazim, Carbendazim + Mancozeb, Hexaconazole, Mancozeb and Difenconazole were found more effective against C. cassiicola. The lowest concentration tested. Carbendazim + Mancozeb and Mancozeb also showed complete inhibition of mycelial growth at 250 ppm.

103 Table 26: Average per cent disease intensity in nursery and in field screening of Hevea genotypes Sl. No Clone Average Per cent Disease Index Nursery Field Sl. No Clone Average Per cent Disease Index Nursery Field 1 RRII RRIM RRII GL RRII Pil B RRII CH RRII CH RRII CH RRII CH RRII AVROS RRII AVROS AVT AVROS PB 5/ Tjir PB 28/ PR PB 28/ PR PB LCB PB GT PB SCATC 88/ PB SCATC 93/ PB Haiken PB RRIC PB RRIC PB RRIC PB RRIC PB RRIC PB RRIC PB Mil 3/ PB NAB PB WARRING RRIM IAN 45/ RRIM KRS RRIM KRS RRIM KRS

104 Table 27: Overall reaction of H. brasiliensis genotypes for Corynespora leaf fall disease infection Screening test Year Number of clones Nil VL L M S VS Nursery test Field test Disease score: No disease = Nil Trace (Very light) = Up to 5 per cent PDI Low (Light) = 5.1 to 10 per cent PDI Moderate = 10.1 to 25 per cent PDI Severe = 25.1 to 50 per cent PDI Very severe = > 50 per cent PDI

105 Table 28: Field susceptibility of H. brasiliensis clones for C. cassiicola infection over the years Susceptibility Resistant (Up to 5 PDI) Moderately resistant (5.1 to 10 PDI) Moderately susceptible (10.1 to 25 PDI) Susceptible (25.1 to 50 PDI) Highly susceptible (> 50 PDI) Clones RRII 5, RRII 208, PB 86, RRIM 600, AVROS 225, GL 1, CH 2, GT 1, IAN 45/873, KRS 163 and KRS 25 RRII 3, RRII 6, AVT 73, PB 310, PB 255, PB 242, PB 213, PB 252, PB 215, RRIM 701, CH 3, CH 26, AVROS 49, LCB 1320, SCATC 93/114, SCATC 88/13, Haiken 1, RRIC 100, Mil 3/2, NAB 17 and KRS 128 RRII 118, RRII 300, RRII 308, PB 5/51, PB 28/59, PB 311, PB 312, PB 314, PB 280, RRIM 703, Pil 84. CH 4, AVROS 352, Tjir 1, RRIC 104, RRIC 45 and WARRING 4 RRII 203, PB 217, PB 235, PB 260, RRIM 501, RRIM 605, RRIC 36, RRIC 102 and RRIC 105 RRII 105, PB 28/83, PR 255 and PR 261 Table 29: Summary of cluster analysis on field and nursery data showing cluster member constitution Field Nursery Cluster Member Percentage Member Percentage I II III IV V

106 Nursery susceptibility Average distance GT1 RRIM600 IAN45/873 AVROS225 GL1 PB86 KRS163 RRII208 RRII5 RRII3 RRII6 SCATC88/13 Mil3/2 PB215 RRIM701 RRIC100 PB310 PB255 CH3 CH26 KRS128 LCB1320 PB242 PB213 Haiken1 SCATC93/114 KRS25 PB280 AVT73 AVROS49 PB5/51 NAB17 CH2 PilB84 Tjir1 AVROS352 PB311 PB252 CH4 RRII118 PB314 RRIC45 RRIM703 PB312 RRII308 WARRING4 RRIC104 RRII300 PB28/59 RRIC102 PB235 PB217 RRIC105 RRII203 PB260 RRIM501 RRIC36 RRIM605 Average distance PR255 PR261 PB28/83 RRII105 Fig. 21: Dendrograms showing relative grouping of clones based on susceptibility in nursery obtained by average clustering based on squared Euclidean distances

107 Field susceptibilty Average distance GT1 IAN45/873 AVROS225 RRIM600 KRS163 GL1 PB86 RRII5 RRII208 KRS25 SCATC93/114 CH2 RRII3 SCATC88/13 RRII6 Mil3/2 PB215 PB255 AVROS49 CH3 CH26 KRS128 LCB1320 RRIC100 PB310 RRIM701 PB280 AVT73 NAB17 PB242 PB213 Haiken1 PB252 RRII118 PB5/51 Tjir1 PB311 PilB84 AVROS352 PB314 RRIC45 RRIM703 Average distance RRII308 WARRING4 PB28/59 RRIC104 RRII300 RRIC102 PB235 PB217 RRIC105 CH4 PB312 RRII203 RRIM501 RRIM605 RRIC36 PB260 PR255 PB28/83 PR261 RRII105 Fig. 22: Dendrograms showing relative grouping of clones based on susceptibility in field obtained by average clustering based on squared Euclidean distances

108 Table 30: In-vitro evaluation of different fungicides against C. cassiicola Fungicides Per cent inhibition 250 ppm 500 ppm Carbendazim 50 WP Hexaconazole 5 EC Tridemorph 80 EC Metalaxyl MZ 72 WP Phosphorous acid 40 EC Mancozeb 75 WP Copper oxychloride 50 WP Thiram 75 WP Carbendazim 12% + Mancozeb 63% Difenconazole 25 EC Hexaconazol + captan Rovarol 50 WP Propiconazole 25 EC LSD at (0.01%) Fungicide (F) 0.57 Concentration (C) 0.46 F C 0.94

109 Per cent inhibition Carbendazim 50 wp Tridemorph 80 EC Phosphorous acid 40 EC Copper oxychloride 50 wp Carbendazim 12% + Mancozeb 63% Hexaconazol + captan Propiconazole 25 EC Fungicides Fig. 23: In-vitro evaluation of different fungicides against C. cassiicola Fig. 23: In-vitro evaluation of different fungicides against C. cassiicola

110 Table 31: In-vitro evaluation of botanicals against C. cassiicola Sl. No. Botanicals Per cent inhibition over control 5% 7.50% 10% 1 Neem seed kernel extract Datura leaf extract Onion bulb extract Garlic bulb extract Ginger rhizome extract LSD at (0.01%) Botanicals (B) 0.68 Concentrations (C) 0.32 B C 0.92 Table 32: In-vitro evaluation of bio agents against C. cassiicola Sl. No. Bio agents Per cent inhibition over control 1. Pseudomonas fluorescens Bacillus subtillis Trichoderma viridae Trichoderma harzianum SEm LSD at (0.01%) 0.75

111 70 60 Per cent inhibition over control Neem seed kernel extract Datura leaf extract Onion bulb extract Garlic bulb extract Ginger rhizome extract Botanicals Fig. 24: In-vitro evaluation of botanicals against C. cassiicola Fig. 24: In-vitro evaluation of botanicals against C. cassiicola

112 70 60 Per cent inhibition over control Pseudomonas fluorescens Bacillus subtillis Trichoderma viridae Trichoderma harzianum Bioagents Fig. 25: In-vitro evaluation of bio agents against C. cassiicola Fig. 25: In-vitro evaluation of bio agents against C. cassiicola

113 Table 33: Effect of water-based fungicides in CLF disease management over the years Treatments Trade name Dosage (%) Per cent disease index Mean Mancozeb + carbendazim Saaf Carbendazim Bavistin Hexaconazol + captan Contaf + Captan Difenconazole Score Mancozeb Indofil M Control Unsprayed SEm LSD at (0.05%)

114 Per cent disease index Mancozeb + carbendazim Carbendazim Hexaconazol + captan Difenconazole Mancozeb Control Chemicals Fig. 26: Effect of water-based fungicides in CLF disease management over the years Fig. 26: Effect of water-based fungicides in CLF disease management over the years

115 Plate 15: In vivo evaluation of fungicides against Corynespora cassiicola in immature rubber plantation with HDP sprayer The fungicides Difenconazole and Hexaconazole + Captan showed only 90 to 93 per cent inhibition of mycelial growth. Other fungicides recorded above 70% inhibition in the highest concentration (500 ppm) tried In vitro evaluation of botanicals against C. cassiicola Five plant extracts were evaluated at three different concentrations in the laboratory for their efficacy against C. cassiicola through poisoned food technique and the data are presented in Table 31 and Fig. 24. Among them garlic bulb extract was found to be the best in inhibiting the mycelial growth (60.50%) at 10 per cent concentration and found superior to all other plant extracts tested. Neem seed kernel and onion bulb extracts also gave positive response by inhibiting the mycelial growth more than 50 per cent over control. Datura leaf and ginger rhizome extracts recorded only and per cent inhibition of mycelial growth respectively.