Identification of polyhydroxyalkanoate (PHA)-producing Bacillus spp. using the polymerase chain reaction (PCR)

Transcription

1 Journal of Applied Microbiology 00, 94, 9 74 Identification of polyhydroxyalkanoate (PHA)-producing Bacillus spp. using the polymerase chain reaction (PCR) T.R. Shamala, A. Chandrashekar, S.V.N. Vijayendra and L. Kshama Department of Food Microbiology, Central Food Technological Research Institute, Mysore, Karnataka, India. 00/1: revised 5 June 00, revised 17 October 00 and accepted 9 October 00 ABSTRACT T. R. S H A M A LA, A. C H A N D R A S H E K A R, S. V. N. V IJAYENDRA A N D L. K S H A M A. 00. Aims: The aim of the work was to develop efficient method to identify polyhydroxyalkanoate (PHA)-producing species of Bacillus from numerous soil isolates of bacteria. Identification of the isolates and characterization of the PHA produced by strains positive on the polymerase chain reaction (PCR) was envisaged. Methods and Results: Different bacteria isolated from soil were screened by PCR using two sets of primers designed for Bacillus megaterium. Amongst isolates examined, the DNA of 1 isolates reacted positively with the primers giving amplicons identical in size to that obtained from B. megaterium. The isolates which were identified as strains of B. sphaericus, B. circulans, B. brevis and B. licheniformis, produced 11 41% of PHA in biomass, in sucrosecontaining medium, over a growth period of 4 7 h. The nature of the PHA thus produced was analyzed by Fourier transform infrared spectroscopy, gas chromatography and by nuclear magnetic resonance (NMR) and found to contain polyhydroxy butyrate and polyhydroxyvalerate. Conclusions: The results indicate that most of our isolates from different species contained the B. megaterium type of PHA synthase. Bacillus licheniformis appeared to belong to another group as it did not react with both sets of primers. Significance and Impact of the Study: This study shows the universality of the B. megaterium type of PHA synthase in soil isolates of Bacillus. Some variations were also found. Keywords: Bacillus spp., identification, PCR, polyhydroxyalkanoates. INTRODUCTION Polyhydroxyalkanoates (PHAs) are biodegradable polyesters which are synthesized by many bacteria. They are accumulated intracellularly as carbon and energy reserves under certain nutrient-depleted conditions in the presence of excess carbon source (Ramsay et al. 1990; Steinbuchel and Schlegel 1991). Various phenotypic detection methods such as Sudan black B staining (Schlegel et al. 1970), Nile blue A (Ostle and Holt 198) and Nile red (Gorenflo et al. 1999; Spiekermann et al. 1999) have been widely used to isolate bacterial PHA producers. In these methods PHA granules are stained and viewed under phase contrast or fluorescent Correspondence to: T.R. Shamala, Department of Food Microbiology, Central Food Technological Research Institute, Mysore , Karnataka, India ( shamala_trs@yahoo.co.uk). microscope. Sudan black B is non-specific to PHA as it also stains other lipid bodies. Nile blue A and Nile red are reported to be more specific than Sudan black B for detection. Moreover, prior to identification and isolation of PHA-producing bacteria by phenotypic methods, it is necessary to provide appropriate nutrient limitation conditions to the bacterial cells to support PHA accumulation. This is a laborious process and hence alternative methods have been developed for the rapid detection of PHAproducing bacteria where one method is based on Fourier transform infrared (FTIR) spectroscopy of intact cells (Hong et al. 1999; Misra et al. 000) and the other on genotypic method, namely polymerase chain reaction (PCR) technique (Sheu et al. 000; Solaiman et al. 000). Chen et al. (1991) reported that many species of Bacillus produce PHA and since then the gene for PHA synthesis has ª 00 The Society for Applied Microbiology

2 70 T.R. SHAMALA ET AL. been cloned from B. megaterium. It was of interest to see whether primers based on that PHA synthase sequence could enable the identifications of other PHA-producing Bacillus of a type similar to that present in B. megaterium. In this communication we report the specific detection of Bacillus type of PHA synthase gene using the PCR. The PHA produced by these different Bacillus species have been quantified after fermentative production and characterized. MATERIALS AND METHODS Bacteria Different standard species of Bacillus namely, B. laterosporous, B. circulans, B. subtilis, B. cereus, B. brevis, were obtained from the bacterial cultures maintained at the Department of Food Microbiology, CFTRI, Mysore, India. Bacillus megaterium and B. amylovorans were obtained from the laboratory of Prof. Karl Entian, Department of Microbiology, Goethe University of Frankfurt, Germany. Pseudomonas oleovorans (ATTCC 947) and Alcaligenes eutrophus (Dr M. Zinn, Swiss Federal Institute for Environmental Science and Technology, Switzerland) were also used as standard PHA strains. Various bacteria were isolated from different local soil samples by surface plating on nutrient agar and purified. Cultures that contained large Bacillus type cells as evidenced by microscopy were selected for PCR. The selected cultures were characterized according to the method of Wolf and Barker (198). Molecular biology procedures Bacterial cultures were grown for 4 h, in 5 ml of sterile nutrient broth at 0 C and 50 rev min 1. The cells were harvested by centrifugation (5000 g, 15 min), washed and were treated with 1 lg of Trypsin (Sigma Chemical Co., USA) for 1 h at 7 C followed by boiling in a water bath in the presence of SDS (1%). The sample was then extracted with Tris equilibrated phenol followed by chloroform. The DNA was precipitated by the addition of 0 M sodium acetate and ethanol, air-dried and was suspended in 50 ll of sterile water. The optimized PCR reaction mixture contained: 1 PCR amplification buffer [10 mm Tris HCl (ph 9), 15mM MgCl, 50 mm KCl and 001% gelatin], 00 lm each deoxynucleotide triphosphate (Bangalore Genei, Bangalore, India), 1 U Taq DNA polymerase (Bangalore Genei), 5 lm each primer, in 5 ll PCR reaction mixture. The first amplification was carried out using genomic DNA (1 ll) as template and B1F : B1R set of primers. The amplicon obtained was used as a template (1 ll) in a subsequent PCR using B1F : BR set of primers. The thermal cycle program run on a Gene Amp PCR system consisted of one cycle at 94 C for 4 min and 0 cycles of 94 C for 0 min, 0 C for 045 min, 7 C for 115 min followed by incubation at 7 C for 10 min and a final incubation at 4 C. PCR products were analyzed by gel electrophoresis in 1% agarose gels. The amplified DNA fragments were visualized by u.v. illumination and the images were captured using a Hero LAB image analyzer (Wiesloch, Germany). Maintenance Bacterial cultures were streaked on to nutrient agar slants, incubated at 0 C overnight and then refrigerated at 4 C for further use. Primer design The nucleotide sequence of B. megaterium PHA gene cluster (Gene bank No 41047) was used for the design of primers (Sigma-Genosys, Cambridge, UK) by primer primer design program (MIT, Cambridge, MA, USA). The sequences of the primers and the expected amplicon sizes are given below. Primer name Sequence Corresponding region of the B. megaterium gene B1F 5 0 -AACTCCTGGGCTTGAAGACA B1R TCGCAATATGATCACGGCTA BR ACGGTCCACCAACGTTACAT Expected amplicon size (bp) Shake flask experiments Bacterial cultures were also grown in the mineral salt medium for PHA production (Ramsay et al with 0 g sucrose per liter. Medium (100 ml) was sterilized (15 lbs, 0 min) in 500 ml capacity Erlenmeyer flasks (Borosil, India). Cooled medium was inoculated with 10 ml of 4-hold culture inoculum grown in the above medium with loops of bacteria at 0 C and 50 rev min 1. The inoculated flasks were incubated at 0 C and 50 rev min 1 up to 7 h. These experiments were carried out in triplicates. Analysis For the measurement of biomass, 10 ml of culture broth was centrifuged (000 rev min 1, 15 min) and the sediment was washed thoroughly with distilled water and the cells were dried to a constant weight at C in airflow dryer. PHA was extracted and quantified (Law and Slepecky 191) from dried cells by the solvent extraction method of Williamson and Wilkinson (1958).

3 POLYHYDROXYALKANOATE-PRODUCING BACILLUS SPP. 71 Extracted PHA samples were also subjected to FTIR. For this, extracted PHA was dissolved in chloroform (AR) and placed on KBR window. After evaporation of the solvent, the film spectrum was taken (GC-FTIR spectrometer; Perkin Elmer, USA) at cm 1. Standard PHAs [polyhydroxybutyrate (PHB), P(HB-co-HV) from Sigma] were used for comparison. Extracted PHA sample of isolate no. (B. circulans) was also subjected to gas chromatography (GC) analysis by converting it to methyl esters of monomers (Brandl et al. 1988). The above-mentioned standards were also used for comparison. Conditions used for GC detection were: Carbowax column PEG M 0 (0 80 mesh, Shimadzu, Japan), injector temperature 0 C; detector temperature 75 C, initial column temperature 80 C for 4 min followed by temp ramp of 8 C per min and 10 C per min. 1 H-NMR was carried out for PHA isolated from dried cells (isolate ) by chloroform extraction (Labuzek and Radecka 001). RESULTS PCR detection of Bacillus spp. producing PHA Polymerase chain reaction was carried out with soil isolates and nine standard strains with the B1F : B1R set of primers. Ten of them reacted positively and the amplicon size observed was identical to that obtained (about 00 bp) with DNA from B. megaterium (Table 1). In most cases reamplification of the amplicon with a seminested set of primers (B1F : BR) resulted in the production of amplicons of 80 bp in size as obtained with the B. megaterium control. Very feeble amplification was seen with B. licheniformis. Only primary amplification occurred with DNA from B. laterospsorus (1) and B. sphaericus (7) when the first set of primers was used. DNA from A. eutrophus and P. oleovorans was not amplified (Data not shown). The amplicons from B. circulans (isolate no. ), B. brevis (isolate no. ), and B. sphaericus (isolate no. ) compared with B. megaterium, visualized after the electrophoretic separation of PCR may be seen in Fig. 1. Fermentative production of PHA by Bacillus spp. Bacillus spp. was also grown aerobically in mineral medium up to 7 h. Eleven of the isolated cultures produced PHA as analyzed by solvent extraction method. The concentration of PHA produced in these isolates varied between 11 41% of biomass dry weight (Table 1; Fig. ). Sequential analysis of the PHA levels over 7-h growth period also indicated that the highest concentration of the polymer was mostly produced by 4-h of fermentation and with many isolates; there was a drop in PHA concentration thereafter. Analysis of PHA Polymer which was obtained after solvent extraction and subjected to FTIR spectroscopy showed intense absorptions typical to PHA at cm 1 and at 180 cm 1 corresponding to C@O and CAO stretching groups, respectively (Fig. ). GC analysis of PHA from B. circulans (isolate no. ) clearly indicated that the polymer extracted was mostly PHB with polyhydroxyvalerate (PHV) (17%). 1 H-NMR confirmed this result (Fig. 4). Table 1 Comparison of PHA detection by PCR reaction using two primer sets and fermentative production followed by solvent extraction method, in various Bacillus spp. Isolate number Species Source PCR B1F B1R Reaction B1F BR PHA (%)* 1 B. sphaericus This study B. circulans This study B. brevis This study + Faint 1 4 B. sphaericus This study B. brevis This study B. sphaericus This study B. sphaericus This study Faint ve 90 8 B. circulans This study ve B. brevis This study B. sphaericus This study B. licheniformis This study ve Faint 40 1 B. laterosporus Standard Faint ve 0 1 B. circulans Standard ve ve 0 14 B. brevis Standard ve ve 0 15 B. megaterium Standard * In dry biomass by solvent extraction.

4 7 T.R. SHAMALA ET AL. a b c d e f g a h i Fig. 1 Polymerase chain reaction (PCR) amplicons from PCR using DNA from different isolates and with two sets of primers: (B1F : B1R (lanes b, d, f, h) and B1F : BR (lanes c, e, g, i), respectively, in the sets of following lanes) a: Molecular size marker (100 bp ladder); b, c: amplicons of DNA from isolate *; d, e: amplicons of DNA from isolate *; f, g: amplicons of DNA from isolate *; h, i: amplicons of DNA from B. megaterium (Standard). *Isolates,, as in Table Biomass % PHA (% biomass) Days 0 1 Fig. Variations in biomass (dry wt.) and PHA concentrations of selected isolates (,, and 15 as in Table 1) cultivated in triplicates 1 %T cm Fig. Infrared-spectra of PHA: 1 ¼ Stand- Standard PHB; ¼ Standard PHB-co-PHV;, 4, 5 and correspond to PHA of isolate no.,, and 15 of Table 1, respectively DISCUSSION Use of biopolymers is assuming importance because of the pollution problems associated with synthetic plastics, which are produced from non-renewable energy sources and are non-biodegradable. As an alternative to this, PHAs are gaining much attention world over. PHA-producing bacteria are classified into three groups based on PHA synthases

5 POLYHYDROXYALKANOATE-PRODUCING BACILLUS SPP CH O O CH CH C O 4 CH CH 5 CH CH O C HB HV Fig. 4 1 H-NMR of PHA isolated from B. circulans (isolate no. ) ppm present in them. But recently it has been shown that B. megaterium possesses enzymes that are distinctively different from all known PHA synthases in sequence and arrangement and hence may form a separate class by itself (McCool and Cannon 001). In addition to B. megaterium, B. cereus is also reported to produce PHA (Labuzek and Radecka 001). PHA is further divided into two groups namely short chain length PHA with C to C 5 monomer units and medium chain length PHA with C to C 1 monomer units (Nakamura et al. 1991; Fukui and Doi 1997). There are only a very few reports on bacteria that are capable of synthesizing both types of monomers and B. cereus is one amongst them (Labuzek and Radecka 001). Bacillus cereus has been reported to utilize caprolactone and biosynthesize 9% (w/w) copolymer containing -hydroxybutyrate, -hydroxyvalerate and -hydroxyhexanoate. These reports have initiated renewed interest in PHA synthesis by Bacillus spp. PCR protocol has been developed for bacteria isolated from the environment by colony PCR (Sheu et al. 000) and for specific detection of genes coding medium chain length PHA in Pseudomonas spp. (Solaiman et al. 000). In the present study 10 isolates of Bacillus spp. capable of producing PHA similar to B. megaterium type have been identified while using the PCR. Results have also been confirmed by cultivation of isolates followed by quantification and characterization of the PHA. Although one of the isolates (B. licheniformis) produced PHA by fermentation, its DNA amplification did not occur with the primers used. This may indicate that the isolate may not contain the B. megaterium type of PHA synthase gene. Overall the results confirm that the PCR protocol is applicable for rapid detection of PHA producers among Bacillus spp. Furthermore, B. megaterium type of PHA producer may be detected even in the absence of growth of bacteria in limiting media for the production and accumulation of PHA. The Bacillus isolates appear to produce a

6 74 T.R. SHAMALA ET AL. mixed polymer and that their yields and types may possibly be varied using various other substrates and cultural conditions. ACKNOWLEDGEMENT The authors wish to thank Dr M.C. Varadaraj for the supply of standard Bacillus cultures and Dr P. Srinivas for discussion on NMR analysis. Thanks are due to the Central Instrumentation Department of CFTRI for their help in GC analysis. REFERENCES Brandl, H., Gross, R.A, Lenz, R. Wand Clinton Fuller, R. (1988) Pseudomonas oleovorans as a source of PHA for potential applications as a biodegradable polyester. Applied and Environmental microbiology 54, Chen, G.Q., Konig, K.H. and Lafferty, R.M. (1991) Occurrence of poly-d--hydroxyalkanoates in the genus Bacillus. FEMS Microbiology Letters 84, Fukui, T. and Doi, Y. (1997) Cloning and analysis of the poly (-hydroxybutyrate-co--hydroxyhexanoate) biosynthesis genes of Aeromonas caviae. Journal of Bacteriology 179, Gorenflo, V., Steinbuchel, A., Marose, S., Rosenberg, H. and Scheper, T. (1999) Quantification of bacterial polyhydroxyalkanoic acids by Nile red staining. Applied Microbiology and Biotechnology 51, Hong, K., Sun, S., Tian, W., Chen, G.Q. and Huang, W. (1999) A rapid method for detecting bacterial polyhydroxyalkanoates in intact cells by Fourier transform infrared spectroscopy. Applied Microbiology and Biotechnology 51, 5 5. Labuzek, S. and Radecka, I. (001) Biosynthesis of PHB tercopolymer by Bacillus cereus UW85. Journal of Applied Microbiology 90, Law, J.H. and Slepecky, R.A. (191) Assay of poly-beta-hydroxybutyric acid. Journal of Bacteriology 8,. McCool, G.J. and Cannon, M.C. (001) PhaC and PhaR are required for polyhydroxyalkanoic acid synthase activity in Bacillus megaterium. Journal of Bacteriology 18, Misra, A.K., Thakur, M.S., Srinivas, P. and Karanth, N.G. (000) Screening of poly-beta-hydroxybutyrate producing microorganisms using fourier transform infrared spectroscopy. Biotechnology letters, Nakamura, S., Kunioka, M. and Doi, Y. (1991) Biosynthesis and characterization of bacterial poly (-hydroxybutyrate-co--hydroxypropionate). Macromolecular Reports 8, Ostle, A.G. and Holt, J.G. (198) Nile blue A as a fluorescent stain for poly-beta-hydroxybutyric acid. Applied and Environmental Microbiology 44, Ramsay, B.A., Lomaliza, K., Chavarie, C., Dube, B., Bataille, P. and Ramsay, J.A. (1990) Production of poly-(beta-hydroxybutyricco-beta-hydroxyvaleric) acids. Applied and environmental Microbiology 5, Schlegel, H.G., Lafferty, R. and Krauss, I. (1970) The isolation of mutants not accumulating poly-beta-hydroxybutyric acid. Archives for Microbiology 70, Sheu, D.S., Wang, Y.T. and Lee, C.Y. (000) Rapid detection of polyhydroxyalkanoate accumulating bacteria isolated from the environment by colony PCR. Microbiology 14, Solaiman, D.K.Y., Ashby, R.D. and Foglia, T.A. (000) Rapid and specific identification of medium-chain-length polyhydroxyalkanoate synthase gene by polymerase chain reaction. Applied Microbiology and Biotechnology 5, Spiekermann, P., Rehm, B.H., Kalscheuer, R., Baumeister, D. and Steinbuchel, A. (1999) A sensitive, viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Archives for Microbiology 171, Steinbuchel, A. and Schlegel, H.F. (1991) Physiology and molecular genetics of poly (beta-hydroxyalkanoic acids) synthesis in Alcaligenes eutrophus. Molecular Microbiology 5, Williamson, D.H. and Wilkinson, J.F. (1958) The isolation and estimation of poly-beta-hydroxybutyrate inclusions of Bacillus species. Journal of General Microbiology 19, Wolf, J. and Barker, A.N. (198) The genus Bacillus: Aids to the identification of its species. In Identification Methods for Microbiologists eds Gibbs, B.M. and Shapton, D.A. The Society for Applied Bacteriology Technical Series, London: Academic Press.