VOLUME: 1 ARTICLE NUMBER: 0010 In the format provided by the authors and unedited. Multicopy plasmids potentiate the evolution of antibiotic resistance in bacteria Alvaro San Millan 1,2,*, Jose Antonio Escudero 3,4Ψ, Danna R Gifford 1,Ψ, Didier Mazel 3,4, R Craig MacLean 1. 1 Department of Zoology, University of Oxford. OX1 3PS, Oxford, United Kingdom. 2 Department of Microbiology, Hospital Universitario Ramon y Cajal (IRYCIS). 28034, Madrid, Spain. 3 Institut Pasteur, Unité de Plasticité du Génome Bactérien, Département Génomes et Génétique, 28 Rue du Dr. Roux, 75015, Paris, France. 4 CNRS, UMR3525, 28 Rue du Dr. Roux, 75015, Paris, France. Ψ These authors contributed equally to this study. * Correspondence: alvaro.sanmillan@hrc.es NATURE ECOLOGY & EVOLUTION DOI: 10.1038/s41559-016-0010 www.nature.com/natecolevol 1
Supplementary Figure 1. Ampicillin resistance level of the strains analysed in this study log2 fold-change MIC (relative to MG) 14 (65.5 g/l) AMP 12 (16.4 g/l) 10 (4.1 g/l) 8 (1.02 g/l) 6 (256 mg/l) 4 (64 mg/l) 2 (16 mg/l) 0 (4 mg/l) 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 Strains MG (wild-type) MG::bla TEM-1 MG/pBGT MG::bla TEM-1 R164S MG/pBGT R164S MG/pBGT G54U MG/pBGT G55U MG/pBGT R164S G54U MG/pBGT R164S G55U Strains Level of ampicillin (AMP) resistance of each strain analysed in this study represented as the log 2 of the fold-increase in MIC compared to the parental MG1655. The MIC of ampicillin in the wild-type MG1655 strain is 4 mg/l. NATURE ECOLOGY & EVOLUTION DOI: 10.1038/s41559-016-0010 www.nature.com/natecolevol 2
Supplementary Figure 2. Amplification of a beneficial mutation carried on a multicopy plasmid. Fitness + wild type plasmid mutant plasmid Time _ Slow growth Rapid growth Schematic representation of the amplification of a beneficial mutation carried on a small multi-copy plasmid over time. The fitness of the different plasmid-carrying bacteria is colour-coded using the scale represented in the figure. The increase in frequency of the plasmid carrying the beneficial mutation is driven by the random partition of the plasmid copies between the daughter cells and the fitness advantage associated to the beneficial gene dosage. The number of copies of the mutant plasmid carrying the beneficial mutation correlates with fitness. NATURE ECOLOGY & EVOLUTION DOI: 10.1038/s41559-016-0010 www.nature.com/natecolevol 3
Supplementary table 1. Strains used in this study SUPPLEMENTARY INFORMATION Strain name 1 Strain number Relevant genotype Reference F030 E. coli MG1655 pkobeg. Parental strain. 1 MG E020 F030 curated This work MG::bla TEM-1 D987 F030 attb::bla TEM-1 This work E580 E020/p3655 This work MG/pBGT E581 E020/pE582 This work MG/pBGT R164S E581-2 E020/pE582-2 This work MG::bla TEM-1 R146 F025 F030 attb::bla TEM-1(R164S) This work MG/pBGT G54U F074 E020/pF074 This work MG/pBGT G55U F076 E020/pF076 This work MG/pBGT R164S E581-3 E020/pE582-3 This work G54U MG/pBGT R164S G55U E581-4 E020/pE582-4 This work 1 Names used for the strains in the paper. NATURE ECOLOGY & EVOLUTION DOI: 10.1038/s41559-016-0010 www.nature.com/natecolevol 4
Supplementary table 2. Plasmids used in this study SUPPLEMENTARY INFORMATION Plasmid name 1 Plasmid number Relevant properties p3655 psu18t-pbadgfp2 2 pbgt pe582 p3655::bla TEM-1 pbgt R164 pe582-2 pe582 with R164S mutation in TEM1 pbgt G54U pf074 pe582 with G54U mutation in RNAI pbgt G55U pf076 pe582 with G55U mutation in RNAI pbgt R164 G54U pe582-3 pe582 with R164S mutation in TEM1 and G54U mutation in RNAI pbgt R164 G55U pe582-4 pe582 with R164S mutation in TEM1 and G55U mutation in RNAI 1 Names used for the plasmids in the paper. NATURE ECOLOGY & EVOLUTION DOI: 10.1038/s41559-016-0010 www.nature.com/natecolevol 5
Supplementary table 3. Primers used in this study SUPPLEMENTARY INFORMATION Number Name Sequence Purpose 3652 ybhc-f CCTGTACCGTACAGAGTAAT GCCCGCCACCCTCCGGGCCGGTATAAAAA 3653 attb-r Amplification of AGCAGGCTTCA homology regions AGCGCCCTAGCGCCCGCTCCTTATACTAA 3654 attb-f CTTGAGCGAAA around attb 3655 ybhb-r TGGCGATAATATTTCACCGC 3656 ybhc External F TTTGTGACCAGAAGACCGCA 3657 ybhb External R CTCATCAGTAACGATCTGCG Insertion verification TGAAGCCTGCTTTTTTATACCGGCCCGGA 3658 Tem1 pbad F GGGTGGCGGGC TTTCGCTCAAGTTAGTATAAGGAGCGGGC 3659 Tem1 pbad R GCTAGGGCGCT GTTAGATATTTATCCTCGAGCGGCCCGGA 4304 Tem to pze1r F GGGTGGCGGGC Amplification of bla TEM-1. ACAGGAGTCCAAGCGAGCTCGGAGCGGG 4305 Tem to pze1r R CGCTAGGGCGCT 3086 MV474 CGTTGATCGGCACGTAAGAG Amplification of 738 MV83 AAACGACGGCCAGTGCCAAG p3655 backbone 296 3Orip15A CGTAATCATGGTCATAGCTGTTTCC Amplification of 837 CO57 GTACTGCGATGAGTG orip15a. 737 MV82 CAGCTATGACCATGATTACG Amplification of 1701 Lam_attR_casFw AATTACGCCCCGCCCTGCCACTC p3655 backbone without orip15a pbgt-f ACATTTCCGTGTCGCCCTT Plasmid target for pbgt-r CACTCGTGCACCCAACTGA qpcr dxs-f CGAGAAACTGGCGATCCTTA Chromosomal target dxs-r CTTCATCAAGCGGTTTCACA for qpcr NATURE ECOLOGY & EVOLUTION DOI: 10.1038/s41559-016-0010 www.nature.com/natecolevol 6
Supplementary references 1. Chaveroche MK, Ghigo JM, d'enfert C. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res 28, E97 (2000). 2. Le Roux F, Binesse J, Saulnier D, Mazel D. Construction of a Vibrio splendidus mutant lacking the metalloprotease gene vsm by use of a novel counterselectable suicide vector. Appl Environ Microbiol 73, 777-784 (2007). NATURE ECOLOGY & EVOLUTION DOI: 10.1038/s41559-016-0010 www.nature.com/natecolevol 7